CN103981270A - Photobacterium damsela rapid detection primer, kit and application - Google Patents
Photobacterium damsela rapid detection primer, kit and application Download PDFInfo
- Publication number
- CN103981270A CN103981270A CN201410225271.7A CN201410225271A CN103981270A CN 103981270 A CN103981270 A CN 103981270A CN 201410225271 A CN201410225271 A CN 201410225271A CN 103981270 A CN103981270 A CN 103981270A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- concentration
- detection
- luminous bacillus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a photobacterium damsela rapid detection primer, a kit and an application. The primer consists of an outer primer and an inner primer, wherein the outer primer consists of an outer primer upstream primer shown by SEQ ID NO.1 and an outer primer downstream primer shown by SEQ ID NO. 2; the inner primer consists of an inner primer upstream primer shown by SEQ ID NO.3 and an inner primer downstream primer shown by SEQ ID NO.4. The problems that the detection of photobacterium damsela is long in cycle and high in detection cost, can not be applied to on-site detection, and the like in the prior art can be solved by adopting the photobacterium damsela rapid detection primer; the primer disclosed by the invention is rapid and ordered in detection, realizes the routinization and standardization of the detection process, is standard in operation, and is hard to cause errors; an amplification primer has very good specificity and accuracy; by adopting a method of embedding dyes, a reaction pipe does not need to be opened after completing reaction, and results can be directly observed by naked eyes after taking out the reaction pipe, thus preventing amplified products from polluting follow-up samples to be detected, and improving the application reliability of the kit.
Description
Technical field
The present invention relates to a kind of Mermaid luminous bacillus quick detection kit and detection method thereof, specifically adopt loop-mediated isothermal amplification technique cultured fishes pathogenic bacterium to be carried out to test kit and the detection method thereof of rapid detection, belong to aquatic pathogenic bacterium rapid detection field.
Background technology
It is a kind of Gram-negative tyrothricin of tool hemolytic that Mermaid luminous bacillus kills fish subspecies (Photobacterium damselae subsp.piscicida), there is pod membrane, once be called as and killed fish pasteurella (Pasteurella piscicida), mermaid vibrios (Vibrio damsela), the host that parasitizes is not had a specificity, to multiple cultured fishes, all have highly pathogenic, can cause America wolf perch, channel catfish, five Yellowtail of Japan, cabio, yellow tail Yellowtail, the morbidities such as golden head porgy, at home, from morbidity large yellow croaker, Cynoglossus semilaevis, Trachinotus ovatus, east star spot, rough gentian cabrilla etc. is separated to this bacterium, it is one of important pathogenic bacteria of cultured fishes, there is very strong infectivity, once morbidity, can cause very high mortality ratio.Due to the specific living environment of aquatic animal and physiological property, once disease occurs, be difficult to control, often cause huge financial loss, therefore for aquatic animal disease, the early detection of cause of disease is with prophylactic treatment is particularly important timely and effectively.The current detection for fish Mermaid luminous bacillus, the traditional bacterium isolation identification of main employing, serological reaction and PCR detection technique are not yet set up, bacterium isolation identification length consuming time, cost is high, mainly with killing aquatic animal, is prerequisite, complicated operation, need professional plant and instrument and technician, in breeding production, be badly in need of a kind of can be applied to cultivation site, quick and precisely, Mermaid luminous bacillus detection technique easy and simple to handle and products thereof.
Loop-mediated isothermal amplification technique (Loop-mediated Isothermal Amplification, LAMP) be a kind of novel nucleic acids isothermal amplification technique of setting up for 2000, it is characterized in that 4 Auele Specific Primers of 6 zone design for target gene, under the effect of strand displacement archaeal dna polymerase, in isothermal condition (60～65 ℃), place 30～60min and can complete nucleic acid amplification reaction, in reaction solution, add nucleic acid dye SYBR Green I or fluorexon, if have nucleic acid amplification to react by Show Color, immediately obtain detected result.The core technology of LAMP is the design of choosing of specific gene fragment and primer thereof, and primer is different, and the LAMP detection technique of setting up is also different aspect reaction accuracy, specificity, susceptibility.At present not yet relevant for the report of Mermaid luminous bacillus LAMP detection technique.
Summary of the invention
The object of the invention is to overcome the deficiencies in the prior art, a kind of Mermaid luminous bacillus rapid detection primer is provided.
Second object of the present invention is to provide a kind of a kind of Mermaid luminous bacillus quick detection kit that can be applied to Site Detection.
The 3rd object of the present invention is to provide a kind of testing process and can carries out by quickly and orderly, in 2h, can complete all detection operations, sequencing and the stdn of testing process have been realized, working specification, the application to little, the easy and simple to handle a kind of Mermaid luminous bacillus quick detection kit that is difficult for makeing mistakes of fish body damage.
Technical scheme of the present invention is summarized as follows:
A Mermaid luminous bacillus rapid detection primer, is comprised of outer primer and inner primer, and described outer primer is comprised of the outer primer downstream primer shown in the outer primer upstream primer shown in SEQ ID NO.1 and SEQ ID NO.2; Described inner primer is comprised of the inner primer downstream primer shown in the inner primer upstream primer shown in SEQ ID NO.3 and SEQ ID NO.4.
A Mermaid luminous bacillus quick detection kit, comprising:
(1) sample pretreatment liquid, it consists of the 20mmol/L Tris-HCl of pH=8.0,2mmol/L EDTA, volumetric concentration is 1.2%Triton X-100, solvent is distilled water;
(2) DEPC water;
(3) LAMP reaction solution, the consisting of of 24 μ l LAMP reaction solutions: 2.5 μ l10 * reaction buffers; The dNTP that 3 μ l concentration are 2.5mmol/L; 1 μ l concentration is the Bst archaeal dna polymerase of 8U/ μ l; 1 μ l concentration be 5 μ mol/L by the outer primer upstream primer shown in SEQ ID NO.1,1 μ l concentration be 5 μ mol/L by the outer primer downstream primer shown in SEQ ID NO.2,1 μ l concentration be 40 μ mol/L by the inner primer upstream primer shown in SEQ ID NO.3,1 μ l concentration be 40 μ mol/L by the inner primer downstream primer shown in SEQ ID NO.4; The trimethyl-glycine of 4 μ l1.6mol/L; Title complex, 8.5 μ l DEPC water that 1 μ l fluorexon and mn ion form;
(4) positive control solution, described positive control solution is the Mermaid luminous bacillus genomic dna of 1 μ g/ml;
(5) FTA diaphragm, the grinding rod of sterile packaged are some.
The application of above-mentioned a kind of Mermaid luminous bacillus quick detection kit, comprises the steps:
(1) get sample tissue to be checked and add 100 μ l sample pretreatment liquid, grinding rod grinds, and boils rear standing 10min, obtains supernatant liquor;
(2) drying at room temperature after fully wetting in supernatant liquor FTA diaphragm being obtained in step (1); Separately get two FTA diaphragms fully wetting rear drying at room temperature in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
(3) diaphragm step (2) being obtained adds respectively 100 μ l DEPC water, concussion washing 3～5min; From washings, take out diaphragm, put into respectively the reaction tubes that fills 24 μ l LAMP reaction solutions, be placed under 60-65 ℃ of condition and be incubated 40～60min, obtain negative control, positive control and detection liquid;
(4) negative control is orange, and it is green that positive control is, and according to detecting liquid color, judges whether to contain Mermaid luminous bacillus.
Sample to be checked is fish blood, fish spleen, fish nephridial tissue or bacterium.
Advantage of the present invention:
(1) the invention solves prior art and detect that the Mermaid luminous bacillus cycle is long, testing cost is high, can not be applied to the problems such as Site Detection, testing process can be carried out by quickly and orderly, in 2h, can complete all detection operations, sequencing and the stdn of testing process have been realized, working specification, is difficult for makeing mistakes.
(2) the present invention can effectively detect Mermaid luminous bacillus according to the preferred designed amplimer of Mermaid luminous bacillus IGS2 (AJ535849.1) gene, has good specificity and accuracy.
(3) adopt the method for built-in dyestuff, after reaction finishes, need not open reaction tubes, after taking out, direct visual inspection result, has avoided being amplified the follow-up sample to be checked of product pollution, has improved the application reliability of this test kit.
(4) improvement based on to sampling method, without microbial culture, the samples such as Fish Blood that only need to take a morsel can detect, and have realized Wicresoft's sampling, are particularly useful for the fish that economic worth is higher.
Accompanying drawing explanation
Fig. 1 is Mermaid luminous bacillus quick detection kit detected result schematic diagram.
Fig. 2 is Mermaid luminous bacillus quick detection kit practical application detected result figure.
Fig. 3 is Mermaid luminous bacillus quick detection kit practical application detected result figure.
Fig. 4 is Mermaid luminous bacillus quick detection kit susceptibility detected result figure.
Fig. 5 is Mermaid luminous bacillus quick detection kit specific detection result figure.
Embodiment
Below in conjunction with specific embodiment, the invention will be further described, the following examples do not limit the present invention, one of skill in the art can make improvements and change according to spirit of the present invention, and these described improvement and variation all should be considered as within the scope of the invention.
Instrument of the present invention and reagent:
Electric-heated thermostatic water bath is purchased from Beijing 3 sixteen scientific instrument company limiteds; High speed freezing centrifuge is purchased from SIGMA company; Bst archaeal dna polymerase, 10 * reaction buffer, dNTP are purchased from NEB company; Primer SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 synthesize by Shanghai Sheng Gong biotechnology company limited; DEPC water, Tris, Triton X-100 are purchased from Shanghai Sheng Gong biotechnology company limited; Trimethyl-glycine, fluorexon are purchased from SIGMA company; FTA diaphragm is purchased from General Electric's medical company (GE healthcare); EDTA, manganous sulfate are domestic analytical pure.
The title complex proportioning that fluorexon and mn ion form is 0.05mmol/L fluorexon and 0.6mmol/L mn ion.
Mermaid luminous bacillus genomic dna adopts business-like DNA extraction agent box (the Fast DNA extraction detection kit KG203 of day root) to extract from the Mermaid luminous bacillus bacterium liquid of pure culture.(Mermaid luminous bacillus is to extract from ill leopard line gill sour jujube perch spleen, kidney, and the Phylogenetic Analysis that is genetic marker through morphology, Analysis of Biochemical Characteristics and the 16S rDNA of take is accredited as Mermaid luminous bacillus)
The present invention can be used for detecting fish blood, fish spleen, fish nephridial tissue and whether infects Mermaid luminous bacillus, also can be used for detecting in water body, whether containing Mermaid luminous bacillus or whether certain bacterium liquid is Mermaid luminous bacillus.
Embodiment 1
A Mermaid luminous bacillus rapid detection primer, is comprised of outer primer and inner primer, and described outer primer is comprised of the outer primer downstream primer shown in the outer primer upstream primer shown in SEQ ID NO.1 and SEQ ID NO.2; Described inner primer is comprised of the inner primer downstream primer shown in the inner primer upstream primer shown in SEQ ID NO.3 and SEQ ID NO.4.
Embodiment 2
A Mermaid luminous bacillus quick detection kit, (to detect the example that is packaged as of 8 samples) comprising:
(1) 8 sampling tube that fills sample pretreatment liquid, in every pipe, there are 100 μ l sample pretreatment liquid, the 20mmol/L Tris-HCl that consists of pH=8.0 of sample pretreatment liquid, 2mmol/L EDTA, volumetric concentration is 1.2%Triton X-100, and solvent is distilled water;
(2) sluicing pipe is 10, and every pipe includes 100 μ l DEPC water
(3) reaction tubes is 10, and every pipe is containing 24 μ l LAMP reaction solutions, and it consists of: dNTP, 1 μ l concentration that 2.5 μ l10 * reaction buffers, 3 μ l concentration are 2.5mmol/L are the Bst archaeal dna polymerase of 8U/ μ l; 1 μ l concentration be 5 μ mol/L by the outer primer upstream primer shown in SEQ ID NO.1,1 μ l concentration be 5 μ mol/L by the outer primer downstream primer shown in SEQ ID NO.2,1 μ l concentration be 40 μ mol/L by the inner primer upstream primer shown in SEQ ID NO.3,1 μ l concentration be 40 μ mol/L by the inner primer downstream primer shown in SEQ ID NO.4; The trimethyl-glycine of 4 μ l1.6mol/L; Title complex, 8.5 μ l DEPC water that 1 μ l fluorexon and mn ion form;
(4) positive control pipe is 1, and including 10 μ l concentration is the positive control solution of the Mermaid luminous bacillus genomic dna of 1 μ g/ml;
(5) FTA diaphragm, the grinding rod of sterile packaged are some.
Embodiment 3
The foundation of Mermaid luminous bacillus quick detection kit detection method (using the test kit of embodiment 2)
(1) template preparation: the Mermaid luminous bacillus genomic dna that adopts the pure culture of DNA extraction test kit (the Fast DNA extraction detection kit KG203 of day root) extraction, as positive control solution, Mermaid luminous bacillus bacterium liquid with pure culture, as detecting sample, the feasibility of the test detection method of setting up.
(2) design of primers is synthetic
Adopt BLAST software analysis Mermaid luminous bacillus gene order, filter out the nucleotide sequence of Mermaid luminous bacillus Photobacterium damselae subsp.piscicida IGS2 (AJ535849.1) gene, according to LAMP technology design of primers principle, for this fragment, design LAMP primer synthetic, the primer is as follows:
SEQ?ID?NO.1：5’ACTCTTTCTTAGGATAAGAAAGGT3’
SEQ?ID?NO.2：5’ACCACTTTTTAATAACTCTCAGAG3’
SEQ?ID?NO.3：5’GATCGAACCGCTGACCTCTTCttttAATTTGGGGCTATAGCTCAG3’
SEQ?ID?NO.4：5’ATTTTCTGCACGGATTCGCAggatccTCGACAAAGCGATTCAACG3’
(3) testing process
1. by FTA diaphragm fully wetting rear drying at room temperature in the Mermaid luminous bacillus bacterium liquid of pure culture step (1) Suo Shu; Separately get two FTA diaphragms fully wetting rear drying at room temperature in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
2. the diaphragm 1. step being obtained adds respectively in the sluicing pipe that fills 100 μ l DEPC water, concussion washing 4min; From washings, take out diaphragm, put into respectively the reaction tubes that fills 24 μ l LAMP reaction solutions, be placed under 65 ℃ of conditions and be incubated 50min, obtain negative control, positive control and detection liquid;
3. the color of liquid in observing response pipe, it is orange that negative control is, and it is green that positive control is, and according to detecting liquid color, judges whether to contain Mermaid luminous bacillus.(in Fig. 1,1 is Mermaid luminous bacillus bacterium liquid detected result, and reaction solution is obvious green to the results are shown in Figure 1; 2 positive contrasts, reaction solution is obvious green; 3 negative contrasts, it is orange that reaction solution is).
(4) LAMP reaction conditions and optimization
In setting reaction tubes, primer mixed solution outer primer and inner primer concentration ratio are respectively 1:1,1:2,1:4,1:6,1:8,1:10,1:12, reaction times is from 20min, 25min, 30min, 40min, 50min, 60min, temperature of reaction is 54 ℃, 57 ℃, 60 ℃, 63 ℃, 65 ℃, 68 ℃, selects the LAMP detection technique of optimum response parameter Erecting and improving.Final definite reaction parameter is as follows:
The concentration ratio of outer primer and inner primer is 1:8, be that outer primer SEQ ID NO.1, SEQ ID NO2 concentration are 5 μ mol/L, inner primer SEQ ID NO.3, SEQ ID NO.4 primer concentration are 40 μ mol/L, reaction tubes is placed in to 60-65 ℃ of insulation 40-60min, obtain detecting liquid, directly observe and detect liquid color, judge that reaction result is positive or negative.
The application of embodiment 4. Mermaid luminous bacillus quick detection kit
(1) extract sample DNA to be checked
Under aseptic condition, extract fish blood 100 μ l to be checked, add 100 μ l sample pretreatment liquid, boil rear standing 10min, obtain supernatant liquor;
(2) by FTA diaphragm fully wetting rear drying at room temperature in the supernatant liquor of step (1) acquisition, separately get two FTA diaphragms, drying at room temperature after fully soaking in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
(3) diaphragm step (2) being obtained adds respectively 100 μ l DEPC water, concussion washing 4min; From washings, take out diaphragm, put into respectively the reaction tubes that fills 24 μ l LAMP reaction solutions, be placed under 63 ℃ of conditions and be incubated 50min, obtain negative control, positive control and detection liquid;
(4) take out reaction tubes, directly observing response liquid in pipe color is green, and judgement is to contain Mermaid luminous bacillus.
The application of embodiment 5. Mermaid luminous bacillus quick detection kit
(1) extract sample DNA to be checked
Under aseptic condition, get a healthy fish spleen 100mg, the fish spleen 100mg of artificial challenge's Mermaid luminous bacillus sequela, a healthy fish kidney 100mg, the fish kidney 100mg of artificial challenge's Mermaid luminous bacillus sequela, with grinding rod, grind respectively, boil rear standing 10min, obtain supernatant liquor;
(2) drying at room temperature after fully wetting in the supernatant liquor 4 FTA diaphragms being obtained in step (1) respectively; Separately get two FTA diaphragms fully wetting rear drying at room temperature in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
(3) diaphragm step (2) being obtained adds respectively 100 μ l DEPC water, concussion washing 3min; From washings, take out diaphragm, put into respectively the reaction tubes that fills 24 μ l LAMP reaction solutions, be placed under 65 ℃ of conditions and be incubated 40min, obtain negative control, positive control and detection liquid;
(4) take out reaction tubes, direct observing response liquid in pipe color, the reaction tubes of healthy fish spleen and fish kidney is orange, and it is green that the fish spleen of artificial challenge's Mermaid luminous bacillus sequela and the reaction tubes of fish kidney are, and after judgement, both contain Mermaid luminous bacillus.(the results are shown in Figure 2.1 negative contrast, is orange; 2 positive contrasts, are green; 3 is the fish kidney lapping liquid detected result after the morbidity of artificial challenge's Mermaid luminous bacillus, is green; 4 is healthy eastern star spot kidney lapping liquid detected result, is orange; 5 is healthy fish spleen lapping liquid detected result, is orange; 6 is the fish spleen lapping liquid detected result after the morbidity of artificial challenge's Mermaid luminous bacillus, is green.
The application of embodiment 6. Mermaid luminous bacillus quick detection kit
(1) extract sample DNA to be checked
Get the bacterium liquid of pure culture, boil rear standing 10min, obtain supernatant liquor;
(2) drying at room temperature after fully wetting in supernatant liquor FTA diaphragm being obtained in step (1); Separately get two FTA diaphragms fully wetting rear drying at room temperature in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
(3) diaphragm step (2) being obtained adds 100 μ l DEPC water, concussion washing 5min; From washings, take out diaphragm, put into respectively the reaction tubes that fills 24 μ l LAMP reaction solutions, be placed under 60 ℃ of conditions and be incubated 60min, obtain negative control, positive control and detection liquid;
(4) take out reaction tubes, directly observing response liquid in pipe color is green, and judgement institute sample product are to contain Mermaid luminous bacillus.The results are shown in 3.1 positive contrast, is green; 2 is the bacterium liquid of pure culture, is green; 3 negative contrasts, are orange.
The detection sensitivity of embodiment 7 Mermaid luminous bacillus quick detection kit is measured
To in the Mermaid luminous bacillus access TSB liquid nutrient medium of pure culture, cultivate after 24h, with stroke-physiological saline solution washing 3 times, adjusting bacterial concentration is 3 * 10
8cfu/ml, 10 multiple proportions gradient dilutions, get the bacterium liquid that diluted according to method described in embodiment 6, detect the Mermaid luminous bacillus bacterium liquid of gradient dilution.Result as shown in Figure 4, the negative contrast of sample 1 (being orange), 2-9 is respectively 3 * 10 as the Mermaid luminous bacillus bacterial concentration of template
1cfu/ml (being orange), 3 * 10
2cfu/ml (being green), 3 * 10
3cfu/ml (being green), 3 * 10
4cfu/ml (being green), 3 * 10
5cfu/ml (being green), 3 * 10
6cfu/ml (being green), 3 * 10
7cfu/ml (being green), 3 * 10
8cfu/ml (being green).Result shows 3 * 10
2the bacterium liquid of the above concentration of cfu/ml, all presents green, shows that this test kit is 3 * 10 to the minimal detectable concentration of Mermaid luminous bacillus
2cfu/ml.
The detection specificity test of embodiment 8. Mermaid luminous bacillus quick detection kit
Get respectively Streptococcus iniae, flavobacterium columnare, Vibrio harveyi, Aeromonas veronii, Nocardia bacteria, Mermaid luminous bacillus bacterium liquid after pure culture evaluation, according to method described in embodiment 6, detect above sample.Detected result is shown in Fig. 5, and sample 1-8 is respectively negative control (being orange), Streptococcus iniae (being orange), flavobacterium columnare (being orange), Vibrio harveyi (being orange), Aeromonas veronii (being orange), Nocardia bacteria (being orange), Mermaid luminous bacillus (being green), positive control (being green).Sample 7 Mermaid luminous bacillus and sample 8 positive controls are positive, and negative control and other bacterium detected result are all negative, confirm that this test kit has good detection specificity.
Those of ordinary skill in the art can understand, and in protection scope of the present invention, for above-described embodiment, modifies, and it is all possible adding and replacing, and it does not all exceed protection scope of the present invention.
Claims (4)
1. a Mermaid luminous bacillus rapid detection primer, is characterized in that being comprised of outer primer and inner primer, and described outer primer is comprised of the outer primer downstream primer shown in the outer primer upstream primer shown in SEQ ID NO.1 and SEQ ID NO.2; Described inner primer is comprised of the inner primer downstream primer shown in the inner primer upstream primer shown in SEQ ID NO.3 and SEQ ID NO.4.
2. a Mermaid luminous bacillus quick detection kit, is characterized in that comprising:
(1) sample pretreatment liquid, it consists of the 20mmol/L Tris-HCl of pH=8.0,2mmol/L EDTA, volumetric concentration is 1.2%Triton X-100, solvent is distilled water;
(2) DEPC water;
(3) LAMP reaction solution, the consisting of of 24 μ l LAMP reaction solutions: 2.5 μ l10 * reaction buffers; The dNTP that 3 μ l concentration are 2.5mmol/L; 1 μ l concentration is the Bst archaeal dna polymerase of 8U/ μ l; 1 μ l concentration be 5 μ mol/L by the outer primer upstream primer shown in SEQ ID NO.1,1 μ l concentration be 5 μ mol/L by the outer primer downstream primer shown in SEQ ID NO.2,1 μ l concentration be 40 μ mol/L by the inner primer upstream primer shown in SEQ ID NO.3,1 μ l concentration be 40 μ mol/L by the inner primer downstream primer shown in SEQ ID NO.4; The trimethyl-glycine of 4 μ l1.6mol/L; Title complex, 8.5 μ l DEPC water that 1 μ l fluorexon and mn ion form;
(4) positive control solution, described positive control solution is the Mermaid luminous bacillus genomic dna of 1 μ g/ml;
(5) FTA diaphragm, the grinding rod of sterile packaged are some.
3. the application of a kind of Mermaid luminous bacillus quick detection kit of claim 2, is characterized in that comprising the steps:
(1) get sample tissue to be checked and add 100 μ l sample pretreatment liquid, grinding rod grinds, and boils rear standing 10min, obtains supernatant liquor;
(2) drying at room temperature after fully wetting in supernatant liquor FTA diaphragm being obtained in step (1); Separately get two FTA diaphragms fully wetting rear drying at room temperature in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
(3) diaphragm step (2) being obtained adds respectively 100 μ l DEPC water, concussion washing 3～5min; From washings, take out diaphragm, put into respectively the reaction tubes that fills 24 μ l LAMP reaction solutions, be placed under 60-65 ℃ of condition and be incubated 40～60min, obtain negative control, positive control and detection liquid;
(4) negative control is orange, and it is green that positive control is, and according to detecting liquid color, judges whether to contain Mermaid luminous bacillus.
4. application according to claim 3, is characterized in that described sample to be checked is fish blood, fish spleen, fish nephridial tissue or bacterium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410225271.7A CN103981270B (en) | 2014-05-26 | 2014-05-26 | Mermaid luminous bacillus rapid detection primer, test kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410225271.7A CN103981270B (en) | 2014-05-26 | 2014-05-26 | Mermaid luminous bacillus rapid detection primer, test kit and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103981270A true CN103981270A (en) | 2014-08-13 |
| CN103981270B CN103981270B (en) | 2015-12-09 |
Family
ID=51273441
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410225271.7A Expired - Fee Related CN103981270B (en) | 2014-05-26 | 2014-05-26 | Mermaid luminous bacillus rapid detection primer, test kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103981270B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104531885A (en) * | 2015-01-14 | 2015-04-22 | 天津市水产技术推广站 | Aeromonas veronii rapid detection primer, kit and application |
| CN105176997A (en) * | 2015-11-02 | 2015-12-23 | 深圳市富炜城投资有限公司 | Detection primer set, detection kit and detection method for Vibrio parahaemolyticus, Photobacterium damsela and Nocardia seriolea |
| CN110747285A (en) * | 2019-11-27 | 2020-02-04 | 中国水产科学研究院黄海水产研究所 | Rapid identification method for strong pathogenic mermaid photobacterium mermaid subspecies |
-
2014
- 2014-05-26 CN CN201410225271.7A patent/CN103981270B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| CARLOS R. OSORIO ET AL: "16S rRNA Gene Sequence Analysis of Photobacterium damselae and Nested PCR Method for Rapid Detection of the Causative Agent of Fish Pasteurellosis", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》, vol. 65, no. 7, 31 July 1999 (1999-07-31), pages 2942 - 2946, XP002144797 * |
| 张晓君等: "泥鳅(Misgurnus anguillicaudatus)病原霍乱弧菌(Vibrio cholerae)PCR与LAMP 检测方法的比较研究", 《海洋与湖沼》, vol. 44, no. 1, 31 January 2013 (2013-01-31), pages 219 - 214 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104531885A (en) * | 2015-01-14 | 2015-04-22 | 天津市水产技术推广站 | Aeromonas veronii rapid detection primer, kit and application |
| CN105176997A (en) * | 2015-11-02 | 2015-12-23 | 深圳市富炜城投资有限公司 | Detection primer set, detection kit and detection method for Vibrio parahaemolyticus, Photobacterium damsela and Nocardia seriolea |
| CN105176997B (en) * | 2015-11-02 | 2018-04-20 | 深圳市富炜城投资有限公司 | A kind of vibrio parahaemolytious, Mermaid luminous bacillus and Yellowtail nocardial detection primer group, detection kit and detection method |
| CN110747285A (en) * | 2019-11-27 | 2020-02-04 | 中国水产科学研究院黄海水产研究所 | Rapid identification method for strong pathogenic mermaid photobacterium mermaid subspecies |
| CN110747285B (en) * | 2019-11-27 | 2020-07-03 | 中国水产科学研究院黄海水产研究所 | Rapid identification PCR reaction system for mermaid subspecies of photobacterium mermaid with strong pathogenicity and non-strong pathogenicity |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103981270B (en) | 2015-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107022644A (en) | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables | |
| CN105238876B (en) | LAMP primer group and its application method for tobacco ralstonia solanacearum detection | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| CN104531885B (en) | Aeromonas veronii quick detection primer, kit and application | |
| CN104232784A (en) | Multiplex PCR (polymerase chain reaction) method for testing three main pathogens in beef | |
| CN103966341B (en) | Streptococcus agalactiae rapid detection primer and method thereof | |
| CN102899416B (en) | Cucumber phytophthora LAMP (Loop-mediated Isothermal Amplification) primer and rapid detection method thereof | |
| CN103484536A (en) | Kit used for rapid detection of enterobacter sakazakii in milk, and applications thereof | |
| CN106282375A (en) | The LAMP primer group of a kind of Salmonella typhimurium and test kit and using method | |
| CN104263845B (en) | A kind of triple PCR method simultaneously detecting mycoplasma hyopneumoniae, pig pasteurella multocida and haemophilus parasuis | |
| CN104328171B (en) | Loop-mediated isothermal amplification primer, kit and method for detecting rat staphylococcus aureus | |
| CN102643919B (en) | Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food | |
| CN103981270B (en) | Mermaid luminous bacillus rapid detection primer, test kit and application | |
| CN108728559A (en) | Detect RPA primers, probe, kit and the method for escherichia coli O157 | |
| CN101967516A (en) | Vibrio cholerae typing and virulence gene detection kit and detection method | |
| CN105132519A (en) | Selective medium used for quantitative detection of escherichia coli and escherichia coli quantitative detection method | |
| CN104152546A (en) | Kit and method for simultaneously detecting salmonella, listeria monocytogenes and staphylococcus aureus | |
| CN102676664A (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN104313128A (en) | Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum | |
| CN106434935A (en) | Composition and method for identifying pasteurella multocida and/or haemophilus parasuis | |
| CN105755143A (en) | LAMP kit for detection of bacillus erysipelatos-suis and detection method | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN102618635B (en) | FR-PCR detection method for specificity of salmonella typhimurium | |
| CN103966342B (en) | Streptococcus iniae rapid detection primer and method thereof | |
| CN105624299A (en) | High-pathogenicity Vibrio parahaemolyticus rapid detection primer and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20151209 Termination date: 20180526 |