CN103981270B - Mermaid luminous bacillus rapid detection primer, test kit and application - Google Patents

Mermaid luminous bacillus rapid detection primer, test kit and application Download PDF

Info

Publication number
CN103981270B
CN103981270B CN201410225271.7A CN201410225271A CN103981270B CN 103981270 B CN103981270 B CN 103981270B CN 201410225271 A CN201410225271 A CN 201410225271A CN 103981270 B CN103981270 B CN 103981270B
Authority
CN
China
Prior art keywords
primer
seqidno
luminous bacillus
mermaid luminous
concentration
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201410225271.7A
Other languages
Chinese (zh)
Other versions
CN103981270A (en
Inventor
徐晓丽
姚学良
邵蓬
张勤
张振奎
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aquatic Products Technical Advice Station Tianjin
Original Assignee
Aquatic Products Technical Advice Station Tianjin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aquatic Products Technical Advice Station Tianjin filed Critical Aquatic Products Technical Advice Station Tianjin
Priority to CN201410225271.7A priority Critical patent/CN103981270B/en
Publication of CN103981270A publication Critical patent/CN103981270A/en
Application granted granted Critical
Publication of CN103981270B publication Critical patent/CN103981270B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses Mermaid luminous bacillus rapid detection primer, test kit and application, its primer is made up of outer primer and inner primer, is outer primer by SEQ? ID? outer primer upstream primer shown in NO.1 and SEQ? ID? outer primer downstream primer composition shown in NO.2; Is inner primer by SEQ? ID? inner primer upstream primer shown in NO.3 and SEQ? ID? inner primer downstream primer composition shown in NO.4.The invention solves prior art detect the Mermaid luminous bacillus cycle long, testing cost is high, can not be applied to the problems such as Site Detection, detect quickly and orderly, achieve sequencing and the stdn of testing process, working specification, not easily makes mistakes.Amplimer has good specificity and accuracy.Adopt the method for built-in dyestuff, need not open reaction tubes after reaction terminates, after taking out, direct visual results, avoids and is amplified the follow-up measuring samples of product pollution, improve the application reliability of this test kit.

Description

Mermaid luminous bacillus rapid detection primer, test kit and application
Technical field
The present invention relates to a kind of Mermaid luminous bacillus quick detection kit and detection method thereof, specifically adopt loop-mediated isothermal amplification technique to carry out test kit and a detection method thereof for rapid detection to cultured fishes pathogenic bacterium, belong to aquatic pathogenic bacterium field of fast detection.
Background technology
Mermaid luminous bacillus kills the Gram-negative tyrothricin of fish subspecies (Photobacteriumdamselaesubsp.piscicida) for a kind of tool hemolytic, there is pod membrane, once be called as and killed fish pasteurella (Pasteurellapiscicida), mermaid vibrios (Vibriodamsela), the host that parasitizes does not have a specificity, all have highly pathogenic to multiple cultured fishes, America wolf perch can be caused, channel catfish, Japan five Yellowtail, cabio, yellow tail Yellowtail, the morbidities such as golden head porgy, at home, from the large yellow croaker of morbidity, Cynoglossus semilaevis, Trachinotus ovatus, east star spot, rough gentian cabrilla etc. is separated to this bacterium, it is one of important pathogenic bacteria of cultured fishes, there is very strong infectivity, once morbidity, very high mortality ratio can be caused.Due to the specific living environment of aquatic animal and physiological property, disease, once occur, is difficult to control, often causes huge financial loss, and therefore for aquatic animal disease, the early detection of cause of disease is with prophylactic treatment is particularly important timely and effectively.At present for the detection of fish Mermaid luminous bacillus, the bacteria distribution qualification that main employing is traditional, serological reaction and PCR detection technique are not yet set up, bacteria distribution identifies length consuming time, cost is high, mainly with killing premised on aquatic animal, and complicated operation, need plant and instrument and the technician of specialty, be badly in need of in breeding production a kind of can be applied to cultivation site, quick and precisely, Mermaid luminous bacillus detection technique easy and simple to handle and products thereof.
Loop-mediated isothermal amplification technique (Loop-mediatedIsothermalAmplification, LAMP) be a kind of novel nucleic acids isothermal amplification technique set up for 2000, it is characterized in that 6 zone design, 4 Auele Specific Primers for target gene, under the effect of strand displacement archaeal dna polymerase, place 30 ~ 60min in isothermal condition (60 ~ 65 DEG C) and can nucleic acid amplification reaction be completed, nucleic acid dye SYBRGreenI or fluorexon is added in reaction solution, if there is nucleic acid amplification to react by Show Color, immediately obtain detected result.The core technology of LAMP is the design of choosing of specific gene fragment and primer thereof, and primer is different, and the LAMP detection technique set up is also different in reaction accuracy, specificity, susceptibility.Not yet there is the report about Mermaid luminous bacillus LAMP detection technique at present.
Summary of the invention
The object of the invention is to overcome the deficiencies in the prior art, a kind of Mermaid luminous bacillus rapid detection primer is provided.
Second object of the present invention is to provide a kind of a kind of Mermaid luminous bacillus quick detection kit that can be applied to Site Detection.
3rd object of the present invention is to provide a kind of testing process and can carries out by quickly and orderly, all detections operation can be completed in 2h, achieve sequencing and the stdn of testing process, working specification, to fish bulk damage little, the application of easy and simple to handle a kind of Mermaid luminous bacillus quick detection kit of not easily makeing mistakes.
Technical scheme of the present invention is summarized as follows:
A kind of Mermaid luminous bacillus rapid detection primer, be made up of outer primer and inner primer, described outer primer is made up of the outer primer downstream primer shown in the outer primer upstream primer shown in SEQIDNO.1 and SEQIDNO.2; Described inner primer is made up of the inner primer downstream primer shown in the inner primer upstream primer shown in SEQIDNO.3 and SEQIDNO.4.
A kind of Mermaid luminous bacillus quick detection kit, comprising:
(1) sample pretreatment liquid, it consists of the 20mmol/LTris-HCl of pH=8.0,2mmol/LEDTA, and volumetric concentration is 1.2%TritonX-100, and solvent is distilled water;
(2) DEPC water;
(3) LAMP reaction solution, consisting of of 24 μ lLAMP reaction solutions: 2.5 μ l10 × reaction buffers; 3 μ l concentration are the dNTP of 2.5mmol/L; 1 μ l concentration is the BstDNA polysaccharase of 8U/ μ l; 1 μ l concentration is 5 μm of ol/L by the outer primer upstream primer shown in SEQIDNO.1,1 μ l concentration is 5 μm of ol/L by the outer primer downstream primer shown in SEQIDNO.2,1 μ l concentration is 40 μm of ol/L by the inner primer upstream primer shown in SEQIDNO.3, and 1 μ l concentration is 40 μm of ol/L by the inner primer downstream primer shown in SEQIDNO.4; The trimethyl-glycine of 4 μ l1.6mol/L; The title complex that 1 μ l fluorexon and mn ion are formed, 8.5 μ lDEPC water;
(4) positive control solution, described positive control solution is the Mermaid luminous bacillus genomic dna of 1 μ g/ml;
(5) the FTA diaphragm of sterile packaged, grinding rod are some.
The application of above-mentioned a kind of Mermaid luminous bacillus quick detection kit, comprises the steps:
(1) get measuring samples tissue and add 100 μ l sample pretreatment liquid, grinding rod grinds, and boils rear standing 10min, obtains supernatant liquor;
(2) drying at room temperature after fully wetting in supernatant liquor FTA diaphragm obtained in step (1); Separately get two panels FTA diaphragm fully wetting rear drying at room temperature in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
(3) diaphragm that step (2) obtains is added 100 μ lDEPC water respectively, concussion washing 3 ~ 5min; From washings, take out diaphragm, put into the reaction tubes filling 24 μ lLAMP reaction solutions respectively, be incubated 40 ~ 60min under being placed in 60-65 DEG C of condition, obtain negative control, positive control and detection liquid;
(4) negative control is orange, and positive control, in green, judges whether containing Mermaid luminous bacillus according to detection liquid color.
Measuring samples is fish blood, fish spleen, fish nephridial tissue or bacterium.
Advantage of the present invention:
(1) the invention solves prior art detect the Mermaid luminous bacillus cycle long, testing cost is high, can not be applied to the problems such as Site Detection, testing process quickly and orderly is carried out, all detections operation can be completed in 2h, achieve sequencing and the stdn of testing process, working specification, not easily makes mistakes.
(2) the present invention effectively can detect Mermaid luminous bacillus according to the amplimer designed by preferred Mermaid luminous bacillus IGS2 (AJ535849.1) gene, has good specificity and accuracy.
(3) adopt the method for built-in dyestuff, need not open reaction tubes after reaction terminates, after taking out, direct visual results, avoids and is amplified the follow-up measuring samples of product pollution, improve the application reliability of this test kit.
(4) based on the improvement to sampling method, without microbial culture, the samples such as Fish Blood that only need to take a morsel can detect, and achieve Wicresoft's sampling, are particularly useful for the fish that economic worth is higher.
Accompanying drawing explanation
Fig. 1 is Mermaid luminous bacillus quick detection kit detected result schematic diagram.
Fig. 2 is Mermaid luminous bacillus quick detection kit practical application detected result figure.
Fig. 3 is Mermaid luminous bacillus quick detection kit practical application detected result figure.
Fig. 4 is Mermaid luminous bacillus quick detection kit susceptibility detected result figure.
Fig. 5 is Mermaid luminous bacillus quick detection kit specific detection result figure.
Embodiment
Below in conjunction with specific embodiment, the invention will be further described, the following examples do not limit the present invention, one of skill in the art can make improvements and change according to spirit of the present invention, and these described improvement and change all should be considered as within the scope of the invention.
Instrument of the present invention and reagent:
Electric-heated thermostatic water bath is purchased from Beijing 3 sixteen scientific instrument company limited; High speed freezing centrifuge is purchased from SIGMA company; BstDNA polysaccharase, 10 × reaction buffer, dNTP are purchased from NEB company; Primer SEQIDNO.1, SEQIDNO.2, SEQIDNO.3, SEQIDNO.4 synthesize by Shanghai Sheng Gong biotechnology company limited; DEPC water, Tris, TritonX-100 are purchased from Shanghai Sheng Gong biotechnology company limited; Trimethyl-glycine, fluorexon are purchased from SIGMA company; FTA diaphragm is purchased from General Electric's medical company (GEhealthcare); EDTA, manganous sulfate are domestic analytical pure.
The title complex proportioning that fluorexon and mn ion are formed is 0.05mmol/L fluorexon and 0.6mmol/L mn ion.
Mermaid luminous bacillus genomic dna adopts business-like DNA extraction agent box (the Fast DNA extraction detection kit KG203 of sky root) to extract from the Mermaid luminous bacillus bacterium liquid of pure culture.(Mermaid luminous bacillus extracts from ill leopard line gill sour jujube perch spleen, kidney, through morphology, Analysis of Biochemical Characteristics and be that the Phylogenetic Analysis of genetic marker is accredited as Mermaid luminous bacillus with 16SrDNA)
The present invention can be used for detecting fish blood, whether fish spleen, fish nephridial tissue infect Mermaid luminous bacillus, and whether whether also can be used for detecting in water body is Mermaid luminous bacillus containing Mermaid luminous bacillus or certain bacterium liquid.
Embodiment 1
A kind of Mermaid luminous bacillus rapid detection primer, be made up of outer primer and inner primer, described outer primer is made up of the outer primer downstream primer shown in the outer primer upstream primer shown in SEQIDNO.1 and SEQIDNO.2; Described inner primer is made up of the inner primer downstream primer shown in the inner primer upstream primer shown in SEQIDNO.3 and SEQIDNO.4.
Embodiment 2
A kind of Mermaid luminous bacillus quick detection kit, (being packaged as example with what detect 8 samples) comprising:
(1) 8 sampling tube filling sample pretreatment liquid, often there are 100 μ l sample pretreatment liquid in pipe, the 20mmol/LTris-HCl consisting of pH=8.0 of sample pretreatment liquid, 2mmol/LEDTA, volumetric concentration is 1.2%TritonX-100, and solvent is distilled water;
(2) sluicing pipe 10, often pipe includes 100 μ lDEPC water
(3) reaction tubes 10, often pipe is containing 24 μ lLAMP reaction solutions, and it consists of: the BstDNA polysaccharase that the dNTP that 2.5 μ l10 × reaction buffers, 3 μ l concentration are 2.5mmol/L, 1 μ l concentration are 8U/ μ l; 1 μ l concentration is 5 μm of ol/L by the outer primer upstream primer shown in SEQIDNO.1,1 μ l concentration is 5 μm of ol/L by the outer primer downstream primer shown in SEQIDNO.2,1 μ l concentration is 40 μm of ol/L by the inner primer upstream primer shown in SEQIDNO.3, and 1 μ l concentration is 40 μm of ol/L by the inner primer downstream primer shown in SEQIDNO.4; The trimethyl-glycine of 4 μ l1.6mol/L; The title complex that 1 μ l fluorexon and mn ion are formed, 8.5 μ lDEPC water;
(4) positive control pipe 1, includes the positive control solution that 10 μ l concentration are the Mermaid luminous bacillus genomic dna of 1 μ g/ml;
(5) the FTA diaphragm of sterile packaged, grinding rod are some.
Embodiment 3
The foundation (using the test kit of embodiment 2) of Mermaid luminous bacillus quick detection kit detection method
(1) Template preparation: the Mermaid luminous bacillus genomic dna of the pure culture adopting DNA extraction kit (the Fast DNA extraction detection kit KG203 of sky root) to extract, as positive control solution, with the Mermaid luminous bacillus bacterium liquid of pure culture, as detection sample, test set up the feasibility of detection method.
(2) design of primers synthesis
Adopt BLAST software analysis Mermaid luminous bacillus gene order, filter out the nucleotide sequence of Mermaid luminous bacillus Photobacteriumdamselaesubsp.piscicidaIGS2 (AJ535849.1) gene, according to LAMP technology design of primers principle, design LAMP primer for this fragment and synthesize, the primer is as follows:
SEQIDNO.1:5’ACTCTTTCTTAGGATAAGAAAGGT3’
SEQIDNO.2:5’ACCACTTTTTAATAACTCTCAGAG3’
SEQIDNO.3:5’GATCGAACCGCTGACCTCTTCttttAATTTGGGGCTATAGCTCAG3’
SEQIDNO.4:5’ATTTTCTGCACGGATTCGCAggatccTCGACAAAGCGATTCAACG3’
(3) testing process
1. by FTA diaphragm fully wetting rear drying at room temperature in the Mermaid luminous bacillus bacterium liquid of the pure culture described in step (1); Separately get two panels FTA diaphragm fully wetting rear drying at room temperature in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
2. diaphragm step 1. obtained adds in the sluicing pipe filling 100 μ lDEPC water respectively, concussion washing 4min; From washings, take out diaphragm, put into the reaction tubes filling 24 μ lLAMP reaction solutions respectively, under being placed in 65 DEG C of conditions, be incubated 50min, obtain negative control, positive control and detection liquid;
3. the color of liquid in observing response pipe, negative control is orange, and positive control, in green, judges whether containing Mermaid luminous bacillus according to detection liquid color.(in Fig. 1,1 is Mermaid luminous bacillus bacterium liquid detected result, and reaction solution is in significantly green to the results are shown in Figure 1; 2 is positive control, and reaction solution is in significantly green; 3 is negative control, and reaction solution is orange).
(4) LAMP reaction conditions and optimization
In setting reaction tubes, primer mixed solution outer primer and inner primer concentration ratio are respectively 1:1,1:2,1:4,1:6,1:8,1:10,1:12, reaction times is from 20min, 25min, 30min, 40min, 50min, 60min, temperature of reaction is 54 DEG C, 57 DEG C, 60 DEG C, 63 DEG C, 65 DEG C, 68 DEG C, selects the LAMP detection technique of optimum response parameter Erecting and improving.The reaction parameter finally determined is as follows:
The concentration ratio of outer primer and inner primer is 1:8, namely outer primer SEQIDNO.1, SEQIDNO2 concentration is 5 μm of ol/L, inner primer SEQIDNO.3, SEQIDNO.4 primer concentration is 40 μm of ol/L, reaction tubes is placed in 60-65 DEG C of insulation 40-60min, obtain detecting liquid, directly observe and detect liquid color, judge that reaction result is as positive or negative.
The application of embodiment 4. Mermaid luminous bacillus quick detection kit
(1) measuring samples DNA is extracted
Aseptically extract fish blood 100 μ l to be checked, add 100 μ l sample pretreatment liquid, boil rear standing 10min, obtain supernatant liquor;
(2) drying at room temperature after fully wetting in supernatant liquor FTA diaphragm obtained in step (1), separately get two panels FTA diaphragm, fully wetting rear drying at room temperature in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
(3) diaphragm that step (2) obtains is added 100 μ lDEPC water respectively, concussion washing 4min; From washings, take out diaphragm, put into the reaction tubes filling 24 μ lLAMP reaction solutions respectively, under being placed in 63 DEG C of conditions, be incubated 50min, obtain negative control, positive control and detection liquid;
(4) take out reaction tubes, direct observing response liquid in pipe color is in green, and judgement is containing Mermaid luminous bacillus.
The application of embodiment 5. Mermaid luminous bacillus quick detection kit
(1) measuring samples DNA is extracted
Aseptically, get a healthy fish spleen 100mg, the fish spleen 100mg of artificial challenge's Mermaid luminous bacillus sequela, a healthy fish kidney 100mg, the fish kidney 100mg of artificial challenge's Mermaid luminous bacillus sequela, respectively with grinding rod grinding, boil rear standing 10min, obtain supernatant liquor;
(2) drying at room temperature after fully wetting in the supernatant liquor 4 FTA diaphragms obtained in step (1) respectively; Separately get two panels FTA diaphragm fully wetting rear drying at room temperature in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
(3) diaphragm that step (2) obtains is added 100 μ lDEPC water respectively, concussion washing 3min; From washings, take out diaphragm, put into the reaction tubes filling 24 μ lLAMP reaction solutions respectively, under being placed in 65 DEG C of conditions, be incubated 40min, obtain negative control, positive control and detection liquid;
(4) reaction tubes is taken out, direct observing response liquid in pipe color, the reaction tubes of healthy fish spleen and fish kidney is orange, and the fish spleen of artificial challenge's Mermaid luminous bacillus sequela and the reaction tubes of fish kidney are in green, and after judging, both are containing Mermaid luminous bacillus.(the results are shown in Figure 2.1 is negative control, in orange; 2 is positive control, in green; 3 is the fish kidney lapping liquid detected result after the morbidity of artificial challenge's Mermaid luminous bacillus, in green; 4 is healthy eastern star spot kidney lapping liquid detected result, in orange; 5 is healthy fish spleen lapping liquid detected result, in orange; 6 is the fish spleen lapping liquid detected result after the morbidity of artificial challenge's Mermaid luminous bacillus, in green.
The application of embodiment 6. Mermaid luminous bacillus quick detection kit
(1) measuring samples DNA is extracted
Get the bacterium liquid of pure culture, boil rear standing 10min, obtain supernatant liquor;
(2) drying at room temperature after fully wetting in supernatant liquor FTA diaphragm obtained in step (1); Separately get two panels FTA diaphragm fully wetting rear drying at room temperature in DEPC water, positive control solution respectively, as negative control diaphragm and positive control diaphragm;
(3) diaphragm that step (2) obtains is added 100 μ lDEPC water, concussion washing 5min; From washings, take out diaphragm, put into the reaction tubes filling 24 μ lLAMP reaction solutions respectively, under being placed in 60 DEG C of conditions, be incubated 60min, obtain negative control, positive control and detection liquid;
(4) take out reaction tubes, direct observing response liquid in pipe color, in green, judges that institute's sample product are containing Mermaid luminous bacillus.The results are shown in 3.1 is positive control, in green; 2 is the bacterium liquid of pure culture, in green; 3 is negative control, in orange.
The detection sensitivity of embodiment 7 Mermaid luminous bacillus quick detection kit measures
After cultivating 24h in the Mermaid luminous bacillus of pure culture access TSB liquid nutrient medium, wash 3 times with stroke-physiological saline solution, adjustment bacterial concentration is 3 × 10 8cfu/ml, 10 multiple proportions gradient dilutions, get the bacterium liquid that diluted according to method described in embodiment 6, detect the Mermaid luminous bacillus bacterium liquid of gradient dilution.As shown in Figure 4, sample 1 is negative control (in orange) to result, and 2-9 is respectively 3 × 10 as the Mermaid luminous bacillus bacterial concentration of template 1cfu/ml (in orange), 3 × 10 2cfu/ml (in green), 3 × 10 3cfu/ml (in green), 3 × 10 4cfu/ml (in green), 3 × 10 5cfu/ml (in green), 3 × 10 6cfu/ml (in green), 3 × 10 7cfu/ml (in green), 3 × 10 8cfu/ml (in green).Result display 3 × 10 2the bacterium liquid of more than cfu/ml concentration, all presents green, shows that this test kit is 3 × 10 to the minimal detectable concentration of Mermaid luminous bacillus 2cfu/ml.
The detection specificity test of embodiment 8. Mermaid luminous bacillus quick detection kit
Get respectively pure culture and qualification after Streptococcus iniae, flavobacterium columnare, Vibrio harveyi, Aeromonas veronii, Nocardia bacteria, Mermaid luminous bacillus bacterium liquid, detect above sample according to method described in embodiment 6.Detected result is shown in Fig. 5, and sample 1-8 is respectively negative control (in orange), Streptococcus iniae (in orange), flavobacterium columnare (in orange), Vibrio harveyi (in orange), Aeromonas veronii (in orange), Nocardia bacteria (in orange), Mermaid luminous bacillus (in green), positive control (in green).Sample 7 Mermaid luminous bacillus and sample 8 positive control are positive, and negative control and other bacterium detected result are feminine gender, confirm that this test kit has good detection specificity.
Those of ordinary skill in the art can understand, and in protection scope of the present invention, modifies for above-described embodiment, and it is all possible for adding and replacing, and it does not all exceed protection scope of the present invention.

Claims (2)

1. a Mermaid luminous bacillus rapid detection primer, is characterized in that being made up of outer primer and inner primer, and described outer primer is made up of the outer primer downstream primer shown in the outer primer upstream primer shown in SEQIDNO.1 and SEQIDNO.2; Described inner primer is made up of the inner primer downstream primer shown in the inner primer upstream primer shown in SEQIDNO.3 and SEQIDNO.4.
2. a Mermaid luminous bacillus quick detection kit, is characterized in that comprising:
(1) sample pretreatment liquid, it consists of the 20mmol/LTris-HCl of pH=8.0,2mmol/LEDTA, and volumetric concentration is 1.2%TritonX-100, and solvent is distilled water;
(2) DEPC water;
(3) LAMP reaction solution, consisting of of 24 μ lLAMP reaction solutions: 2.5 μ l10 × reaction buffers; 3 μ l concentration are the dNTP of 2.5mmol/L; 1 μ l concentration is the BstDNA polysaccharase of 8U/ μ l; 1 μ l concentration is 5 μm of ol/L by the outer primer upstream primer shown in SEQIDNO.1,1 μ l concentration is 5 μm of ol/L by the outer primer downstream primer shown in SEQIDNO.2,1 μ l concentration is 40 μm of ol/L by the inner primer upstream primer shown in SEQIDNO.3, and 1 μ l concentration is 40 μm of ol/L by the inner primer downstream primer shown in SEQIDNO.4; The trimethyl-glycine of 4 μ l1.6mol/L; The title complex that 1 μ l fluorexon and mn ion are formed, 8.5 μ lDEPC water;
(4) positive control solution, described positive control solution is the Mermaid luminous bacillus genomic dna of 1 μ g/ml;
(5) the FTA diaphragm of sterile packaged, grinding rod are some.
CN201410225271.7A 2014-05-26 2014-05-26 Mermaid luminous bacillus rapid detection primer, test kit and application Expired - Fee Related CN103981270B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410225271.7A CN103981270B (en) 2014-05-26 2014-05-26 Mermaid luminous bacillus rapid detection primer, test kit and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410225271.7A CN103981270B (en) 2014-05-26 2014-05-26 Mermaid luminous bacillus rapid detection primer, test kit and application

Publications (2)

Publication Number Publication Date
CN103981270A CN103981270A (en) 2014-08-13
CN103981270B true CN103981270B (en) 2015-12-09

Family

ID=51273441

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410225271.7A Expired - Fee Related CN103981270B (en) 2014-05-26 2014-05-26 Mermaid luminous bacillus rapid detection primer, test kit and application

Country Status (1)

Country Link
CN (1) CN103981270B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104531885B (en) * 2015-01-14 2017-07-07 天津市水产技术推广站 Aeromonas veronii quick detection primer, kit and application
CN105176997B (en) * 2015-11-02 2018-04-20 深圳市富炜城投资有限公司 A kind of vibrio parahaemolytious, Mermaid luminous bacillus and Yellowtail nocardial detection primer group, detection kit and detection method
CN110747285B (en) * 2019-11-27 2020-07-03 中国水产科学研究院黄海水产研究所 Rapid identification PCR reaction system for mermaid subspecies of photobacterium mermaid with strong pathogenicity and non-strong pathogenicity

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
16S rRNA Gene Sequence Analysis of Photobacterium damselae and Nested PCR Method for Rapid Detection of the Causative Agent of Fish Pasteurellosis;CARLOS R. OSORIO et al;《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》;19990731;第65卷(第7期);第2942-2946页 *
泥鳅(Misgurnus anguillicaudatus)病原霍乱弧菌(Vibrio cholerae)PCR与LAMP 检测方法的比较研究;张晓君等;《海洋与湖沼》;20130131;第44卷(第1期);第219-214页 *

Also Published As

Publication number Publication date
CN103981270A (en) 2014-08-13

Similar Documents

Publication Publication Date Title
CN105238876B (en) LAMP primer group and its application method for tobacco ralstonia solanacearum detection
CN107385111A (en) The real-time fluorescence quantitative PCR detection primer and its kit of a kind of goose astrovirus
CN104531885A (en) Aeromonas veronii rapid detection primer, kit and application
CN104726567A (en) Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof
CN102943113A (en) Loop-mediated isothermal amplification detection primer groups of Escherichia coli 0157, detection method and reagent kit
CN104232784A (en) Multiplex PCR (polymerase chain reaction) method for testing three main pathogens in beef
CN103966341B (en) Streptococcus agalactiae rapid detection primer and method thereof
CN103981270B (en) Mermaid luminous bacillus rapid detection primer, test kit and application
CN105331714A (en) Peronophythora litchii LAMP (loop-mediated isothermal amplification) primer and rapid detection method thereof
CN102899416B (en) Cucumber phytophthora LAMP (Loop-mediated Isothermal Amplification) primer and rapid detection method thereof
CN108728559A (en) Detect RPA primers, probe, kit and the method for escherichia coli O157
CN104263845B (en) A kind of triple PCR method simultaneously detecting mycoplasma hyopneumoniae, pig pasteurella multocida and haemophilus parasuis
CN104328171B (en) Loop-mediated isothermal amplification primer, kit and method for detecting rat staphylococcus aureus
CN106282375A (en) The LAMP primer group of a kind of Salmonella typhimurium and test kit and using method
CN101967516A (en) Vibrio cholerae typing and virulence gene detection kit and detection method
CN105132519A (en) Selective medium used for quantitative detection of escherichia coli and escherichia coli quantitative detection method
CN105755143B (en) A kind of kit and detection method for being used to detect bacterium
CN102925548A (en) Actinobacillus pleuropneumoniae LAMP kit and application method thereof
CN104328175A (en) Loop-mediated isothermal amplification (LAMP) primers, kit and method for detecting mouse Klebsiella pneumoniae
CN103436623A (en) Rapid detection kit for viable salmonella in food and use method thereof
CN107475411A (en) A kind of Taqman real-time fluorescence PCR detection methods for detecting Borrelia burgdoyferi nucleic acid
CN102154488B (en) Double PCR (polymerase chain reaction) rapid detection method for escherichia coli O157:H7 and kit
CN103966342B (en) Streptococcus iniae rapid detection primer and method thereof
CN105624299A (en) High-pathogenicity Vibrio parahaemolyticus rapid detection primer and kit
CN109811073A (en) Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20151209

Termination date: 20180526