CN105525023A - Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method - Google Patents
Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method Download PDFInfo
- Publication number
- CN105525023A CN105525023A CN201610080808.4A CN201610080808A CN105525023A CN 105525023 A CN105525023 A CN 105525023A CN 201610080808 A CN201610080808 A CN 201610080808A CN 105525023 A CN105525023 A CN 105525023A
- Authority
- CN
- China
- Prior art keywords
- clostridium difficile
- difficile toxin
- primer
- sequence
- seqidno
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B by adopting a probe method, and a detection method, which can detect clostridium difficile and also can detect and quantify toxin A and B genes. The detection kit mainly comprises specific primers and probes, wherein the specific primers and the probes are composed of primer pairs for detecting clostridium difficile, primer pairs and probes for detecting clostridium difficile toxin A, as well as primer pairs and probes for detecting clostridium difficile toxin B. According to the detection kit and the detection method, the operation is simple, the report time is short, the clostridium difficile strains can be specifically, sensitively and accurately identified for the first time, and the key toxins A and B of clostridium difficile are detected and quantified. A foundation is laid for the early diagnosis for clostridium difficile infection, and the detection kit and the detection method are suitable for screening causes of diarrhea patients with unknown causes clinically.
Description
Technical field
The invention belongs to biomedical sector, particularly relate to probe method fluorescent quantificationally PCR detecting kit and the detection method of a kind of Clostridium difficile toxin A/B.
Background technology
Clostridium difficile (ClostridiumDifficile, C.difficile) is a kind of gram-positive, toxin producing or non-toxogenic anaerobic spore-bearing bacilli, and it is distributed widely in the ight soil of physical environment, animal and human.Clostridium difficile can colonize in the enteron aisle of the mankind, itself does not have aggressive, but research finds, life-time service Broad spectrum antibiotics, especially clindamycin, cephalosporins, after quinolone antibiotic, cause flora imbalance, the clostridium difficile of resistance is made to be selected rear amount reproduction, there is clostridium difficile related infection, cause C.difficile induced diarrhea, be acknowledged as at present and caused Antibiotic associated diarrhea (antibioticassociateddiarrhea, and pseudomembranous enterocolitis (Pseudo-membranecolitis AAD), PMC) important pathogenic bacteria.C. difficile infection (CDI) patients with clinical manifestations the lighter self limiting is suffered from diarrhoea, and pseudomembranous enteritis and toxic megacolon can appear in severe one.CDI has that recurrence rate is high, resistant rate is high, refractory rate is high, mortality ratio is high, medical expense high.Therefore, the Rapid identification of clostridium difficile and Mycotoxin identification work extremely urgent.
In recent years, the diagnostic method of clostridium difficile have depend on anaerobic condition microbial culture, depend on glutamate dehydrogenase (GDH) ELISA detection method prepared by antibody, the molecular diagnostic techniques depending on extracting genome DNA.Corresponding bacterial strain can be obtained when depending on the toxin determination method qualification of strain culturing, facilitate follow-up study, but clostridium difficile belong to anerobe, cultivate difficulty, waste time and energy.Glutamate dehydrogenase (GDH) ELISA detection method needs Dispersal risk, and cost is high, the loaded down with trivial details length consuming time of process, though and the good poor specificity of its stability, C.difficile cannot be distinguished and produce strain and avirulent strain.At present, what detection C.difficile application was maximum is the molecular biological assay being in study frontier, the method directly can extract enteric microorganism genome without cultivation from sample, utilize molecular biology method to carry out being separated, to detect and quantitatively, its result can react composition and the content thereof of high abundance bacterial classification in enteric microorganism more accurately.
Along with nucleic acid development, 16SrDNA sequential analysis has become the gold standard of qualification bacterium.Utilize 16SrDNA sequence preservative area to design primer, this primer almost can be combined with the ribose target site of all kinds.Can Rapid identification be carried out, thus give antibacterial therapy in time.But the method also has limitation, when bacterial 16 S rDNA sequence not of the same race is almost identical, its identification capacity is just restricted (qualification as staphylococcus and burkholderia).
The toxin A (product of tcdA genes encoding) that C.difficile produces, also known as enterotoxin, causes ileum intestines wall neutrophil infiltration, and release lymphokine, causes liquid to secrete in a large number and hemorrhagic necrosis; Toxin B (product of tcdB genes encoding), also known as cytotoxin, can make actin depolymerizing, damages cytoskeleton, causes cell pyknosis downright bad, coup injury intestines parietal cell.Each bacterial strain of C.difficile, according to the productive difference of their toxin, is roughly divided into TcdA and produces TcdB generation type (A+B+), TcdA non-generation TcdB generation type (A-B+) and the non-generation type of toxin (A-B-).There are some researches show, it is high that A-B+ bacterial strain has disease rates in China, disguised strong, and the feature that resistance is high is even more serious to the hazardness of clinical department.Therefore, select tcdA and tcdB as detecting the goal gene of clostridium difficile, simple, sensitive and rapid detection is implemented to clostridium difficile toxic strain, significant for clinical diagnosis and treatment.
Detecting the copy number of foreign gene by the method for real-time fluorescence quantitative PCR, is the novel method developed rapidly in recent years, and it, with advantages such as low cost, quick, highly sensitive, instead of Southernblot method that is expensive, that waste time and energy gradually.Source difference according to fluorescent signal divides the method for fluorescent quantitation, mainly comprises specificity fluorescent probe (as TaqMan probe) method and non-specific fluorescence dyestuff (as SYBRGreen dyestuff) method.Because SYBRGreen dyestuff can combine with all dsDNA, the false positive therefore caused by the amplified production of primer dimer, mistake, can increase the error of quantitative data.At present for the detection by quantitative of clostridium difficile, report that many methods are multiple real time fluorescence quantifying PCR (multiple qPCR).Although the method can the multiple target gene of disposable detection, but also there is a lot of drawback, such as 1) design of primers difficulty is large: complicated multiple qPCR design of primers must depend on comparatively large-scale database and computer simulation qPCR result, and loaded down with trivial details Late Stage Verification, the not general small-size laboratory of this process can complete; 2) product suppresses mutually: the generation of multiple qPCR by product tetra-sodium, can suppress the extension that qPCR reacts; 3) in a qPCR reaction system, the amount of dNTP raw material is certain, so often increase by a heavy primer, the amount that dNTP raw material will be made to divide each target equally reduces.
Summary of the invention
On the one hand, for solving problems of the prior art, the invention provides a kind of primer pair detecting clostridium difficile, this primer pair is the 16SrDNA primer for detecting C.difficile, and it can filter out C.difficile specifically.
Detect a primer pair for clostridium difficile, the upstream primer of described primer pair has the sequence as shown in SEQIDNO:1, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:2.
On the other hand, present invention also offers a kind of primer pair detecting Clostridium difficile toxin A, the upstream primer of described primer pair has the sequence as shown in SEQIDNO:3, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:4.
Another aspect, present invention also offers a kind of oligonucleotide probe detecting Clostridium difficile toxin A, and described probe has sequence as shown in SEQIDNO:5 or its complementary sequence.
Preferably, be combined with fluorescent substance at 5 ＇ ends of oligonucleotide, be combined with cancellation material at 3 ＇ ends.
More preferably, described fluorescent substance is at least one in FAM, HEX, TET, JOE, VIC, ROX; Described cancellation material is at least one in TAMRA, BHQ1, BHQ2, BHQ3, DABCYL.
Again on the one hand, present invention also offers a kind of oligonucleotide group detecting Clostridium difficile toxin A, it has the primer pair of described detection Clostridium difficile toxin A and the oligonucleotide probe of described detection Clostridium difficile toxin A.
On the other hand, present invention also offers a kind of primer pair detecting Clostridium difficile toxin B, the upstream primer of described primer pair has the sequence as shown in SEQIDNO:6, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:7.
Another aspect, present invention also offers a kind of oligonucleotide probe detecting Clostridium difficile toxin B, and described probe has sequence as shown in SEQIDNO:8 or its complementary sequence.
Preferably, be combined with fluorescent substance at 5 ＇ ends of oligonucleotide, be combined with cancellation material at 3 ＇ ends.
More preferably, described fluorescent substance is at least one in FAM, HEX, TET, JOE, VIC, ROX; Described cancellation material is at least one in TAMRA, BHQ1, BHQ2, BHQ3, DABCYL.
Again on the one hand, present invention also offers a kind of oligonucleotide group detecting Clostridium difficile toxin B, it has the primer pair of described detection Clostridium difficile toxin B and the oligonucleotide probe of described detection Clostridium difficile toxin B.
On the other hand, present invention also offers the primer pair of a species-specific amplification Clostridium difficile toxin A gene, its have Outside primer to inner primer pair;
The right upstream primer of described Outside primer has the sequence as shown in SEQIDNO:9, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:10;
The right upstream primer of described inner primer has the sequence as shown in SEQIDNO:11, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:12.
On the other hand, present invention also offers the primer pair of a species-specific amplification Clostridium difficile toxin B gene, its have Outside primer to inner primer pair;
The right upstream primer of described Outside primer has the sequence as shown in SEQIDNO:13, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:14;
The right upstream primer of described inner primer has the sequence as shown in SEQIDNO:15, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:16.
On the other hand, present invention also offers the probe method fluorescent quantificationally PCR detecting kit of a kind of Clostridium difficile toxin A/B, it comprises the oligonucleotide group of described detection Clostridium difficile toxin A and the oligonucleotide group of described detection Clostridium difficile toxin B.
Preferably, the probe method fluorescent quantificationally PCR detecting kit of described Clostridium difficile toxin A/B also comprises the primer pair of described detection clostridium difficile.
Preferably, the probe method fluorescent quantificationally PCR detecting kit of described Clostridium difficile toxin A/B also comprises the positive quality control product of Clostridium difficile toxin A and Clostridium difficile toxin B, the positive quality control product of described Clostridium difficile toxin A has the sequence as shown in SEQIDNO:17, and the positive quality control product of described Clostridium difficile toxin B has the sequence as shown in SEQIDNO:18.
Preferably, the preparation method of the positive quality control product of described Clostridium difficile toxin A and the positive quality control product of described Clostridium difficile toxin B is:
A, from the ight soil of clostridium difficile patient, extract total genomic dna;
B, with steps A) in extract total genomic dna be template, use the primer pair of the primer pair of described specific amplification Clostridium difficile toxin A gene and described specific amplification Clostridium difficile toxin B gene, the object fragment of increase according to nest-type PRC two one-step circulation method Clostridium difficile toxin A gene and Clostridium difficile toxin B gene;
C, recycling step B) in the object fragment that obtains, described object fragment is connected in the blue white carrier T of instant, is converted into subsequently in intestinal bacteria, the white colony grown after transforming being carried out PCR colony identification, extracting the plasmid through being accredited as positive.
Again on the one hand, present invention also offers the probe method fluorescent quantitative PCR detection method of a kind of Clostridium difficile toxin A/B, comprise the following steps:
1) from human faecal mass sample, total genomic dna is extracted;
2) with step 1) in the total genomic dna that extracts be template, use primer described in claim 1 to carry out PCR, detect pcr amplification product and can judge whether described sample carries clostridium difficile; If described sample carries clostridium difficile, then enter step 3);
3) with step 1) in the total genomic dna that extracts be template, use the oligonucleotide group of detection Clostridium difficile toxin A described in claim 6 and the oligonucleotide group of detection Clostridium difficile toxin B according to claim 11 to carry out qPCR respectively;
4) by measuring the Ct value of DNA, the copy concentrations of DNA can be obtained according to typical curve.
Relative to prior art, beneficial effect of the present invention is:
(1) identify whether testing sample is clostridium difficile, and this is first Application in clostridium difficile detection method by the 16SrDNA Auele Specific Primer of clostridium difficile; Experiment show preferably out can filter out C.difficile specifically for the 16SrDNA primer detecting C.difficile;
(2) absolute quantitation of A/B content of toxins is completed by Taqman probe method real-time fluorescence quantitative PCR.Being accredited as the Mycotoxin identification of the sample of clostridium difficile, by drawing the typical curve of A, B toxin quality control product, having carried out the absolute quantitation of this content of toxins.Not only special, sensitive but also accurate.
(3) this test kit primer detected result of screening is more reliable.C.difficile is very low in health HE bacterium number level, we optimize qPCR reaction system and condition, devise Auele Specific Primer and probe, detect with other the diplomatic primers detecting C.difficile toxin gene tcdA with tcdB and compare, amplification efficiency value E more meets the standard (90%≤E≤110%) of qPCR amplification efficiency, and result is more reliable.For the early diagnosis of C. difficile infection provides the foundation, be applicable to the cause of disease examination of clinical unknown cause diarrhoea patient.
Accompanying drawing explanation
Fig. 1 shows the primer location after the full length sequence conservative Analysis of tcdB gene designed by quality control product preparation;
Fig. 2 shows the position at qPCR primer and probe place after the full length sequence conservative Analysis of tcdB gene;
Fig. 3 is the PCR detected result of bacterial 16 S rDNA universal primer;
Fig. 4 is the amplification figure of tcdA object fragment in the preparation process of clostridium difficile quality control product;
Fig. 5 is the amplification figure of tcdB object fragment in the preparation process of clostridium difficile quality control product;
Fig. 6 is the bacterium colony PCR qualification figure in the preparation process of clostridium difficile quality control product after tcdA conversion;
Fig. 7 is the bacterium colony PCR qualification figure in the preparation process of clostridium difficile quality control product after tcdB conversion;
Fig. 8 is the sensitivity technique amplification curve of clostridium difficile tcdA;
Fig. 9 is the sensitivity technique typical curve of clostridium difficile tcdA;
Figure 10 is the sensitivity technique amplification curve of clostridium difficile tcdB;
Figure 11 is the sensitivity technique typical curve of clostridium difficile tcdB;
Figure 12 is the sensitivity technique utilizing other diplomatic primer pair clostridium difficile tcdA and tcdB.
Embodiment
For better the object, technical solutions and advantages of the present invention being described, below in conjunction with specific embodiment, the invention will be further described.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention, NM specific experiment method in the following example, conveniently experimental technique carries out usually.
Embodiment 1
the Auele Specific Primer of 16SrDNA
The specific primer design method of clostridium difficile 16SrDNA is as follows:
When the 16SrDNA sequence of bacterium not of the same race is almost identical, 16SrDNA universal primer qualification bacterial species limited in one's ability.In order to address this problem, we design many primers, and through the screening of several 10 primers, finishing screen selects only special to C.difficile 16SrDNA primer, identifies C.difficile according to this.
What filter out is as follows for the 16SrDNA primer sequence detecting C.difficile the most special:
C.diff-16s-F：TTGAGCGATTTACTTCGGTAAAGA
C.diff-16s-R：CCATCCTGTACTGGCTCACCT
16SrDNA special primer detects C.difficile
From the ight soil of 234 routine enteron aisles diarrhoea clinical patients, extract bacterium total genomic dna, utilize filter out for detecting the most special 16SrDNA primer of C.difficile, detect above-mentioned sample by PCR and whether carry clostridium difficile.
Wherein, PCR reaction system and condition as follows:
PCR response procedures is: denaturation 98 DEG C 30 seconds, sex change 98 DEG C 10 seconds, anneal 60 DEG C 15 seconds, extend 72 DEG C 1 minute (sex change, annealing and extension totally 36 circulations), stop 72 DEG C 5 minutes.
By the pcr amplification product of above 234 routine samples, through the display of agargel electrophoresis result, have 131 routine samples to carry clostridium difficile, all the other 103 routine samples are negative.In order to verify whether the above results exists false male/female property, we select bacterial 16 S rDNA universal primer, and (primer sequence is: 16s-27F:AGAGTTTGATCCTGGCTCAG; 16S-1492R:GGTTACCTTGTTACGACTT), increase 234 described routine samples.Sequencing result is through comparison, in above-mentioned 131 routine positive, be tested with the 16SrDNA sequence that 121 examples belong to clostridium difficile, all the other 10 examples belong to other bacterial strain (clostridium paraputrificum 3 example of fusobacterium, aerogenesis folder film clostridium 5 example, clostridium ramosum 1 example and clostridium butylicum 1 example).In addition, in the sample that above-mentioned 103 routine clostridium difficile detected results are negative (as shown in Figure 3), the 16SrDNA sequence that 8 examples belong to clostridium difficile is tested with.To sum up, the positive coincidence rate of the described 16SrDNA primer for detecting C.difficile is 92.37%, and negative match-rate is 92.23%, shows that the specificity of this primer is satisfactory.
Embodiment 2
the Auele Specific Primer of the gene mass controlled product of tcdA and tcdB, qPCR detect the method for design of primer and probe sequence
By ncbi database and
http:// blast.ncbi.nlm.nih.gov/Blast.cgionline comparison software, finds out tcdA gene and the conserved sequence of tcdB gene between different strains.The sequence difference of tcdB gene between different strains is very large, and partial sequence likelihood is only 94.9%.Figure 1 shows that the full length sequence conservative Analysis of different strains tcdB gene, frame position is out outer, inner primer sequence location prepared by primer tcdB quality control product.Fig. 2 frame position is out qPCR primer and the probe location of tcdB, therefore by means of Saqman software in DNAStar software package to select the conserved sequence of tcdB gene.Finally design primer with software PrimerPremier5.0, obtain the following Auele Specific Primer for the preparation of quality control product respectively, and the qPCR of tcdA and tcdB gene detects primer and probe sequence, specific as follows:
TcdA and tcdB quality control product prepares specific primer sequence used respectively:
The Outside primer of tcdA
tcdA-out-F：5’-TTCAAGCAGAAATAGAGCAC-3’
tcdA-out-R：5’-GTCTTCAGAAAGAGATCCACC-3’
The inner primer of tcdA
tcdA-in-F:5’-ATGGATAGGTGGAGAAGTCAG-3’
tcdA-in-R:5’-GCATAAGCTCCTGGACCAC-3’
The Outside primer of tcdB
tcdB-out-F：5’-CGATATGTATGGAGTAATGATG-3’
tcdB-out-R：5’-GTATAGTTTATTGATTCTCCCTC-3’
The inner primer of tcdB
tcdB-in-F:5’-GGTGTATTTAGTACAGAAGATGG-3’
tcdB-in-F:5’-TCATATATCCATCCAGTCTC-3’
The qPCR specific detection primer of tcdA and tcdB gene and probe sequence are respectively
tcdA-q-F:5’-GCTTTCGCTTTAGGCAGTGT-3’
tcdA-q-R:5’-GAGTTTTCTGCGGTAGCTGA-3’
tcdA-pro:5’-FAM-CCAACACCTTAACCCAGCCATAGAG-TAMRA-3’
tcdB-q-F:5’-GCACCTGCTAATACTGTAAATG-3’
tcdB-q-R:5’-GTCTCAATTGTATATGTTTCTCC-3’
tcdB-pro:5’-FAM-TACGGACAAGCAGTTGAATATAGTGG-TAMRA-3’
Wherein FAM is fluorescent reporter group, and TAMRA is fluorescent quenching group.Described primer and probe synthesize by Shanghai Jierui Biology Engineering Co., Ltd.
the preparation of C.difficile toxin gene tcdA and tcdB quality control product
1. prepare positive quality control product: from the ight soil of C.difficile clinical patients, extract bacterium total genomic dna, with obtained total genomic dna for template, tcdA and the tcdB quality control product in the present embodiment is used to prepare Auele Specific Primer used, the object fragment of increase according to nest-type PRC two one-step circulation method tcdA gene and tcdB gene; Reclaim the object fragment obtained, described object fragment is connected in the blue white carrier T of instant, is converted into subsequently in intestinal bacteria, the white colony grown is carried out PCR colony identification, extracting the plasmid through being accredited as positive after conversion.
Concrete steps are: first by bacterium total genomic dna concentration dilution to 1ng/ μ L, getting 1 μ L is template, first carries out first time with the Outside primer of tcdA and tcdB and increases; Then, with the inner primer of tcdA and tcdB, to first time amplification obtain PCR primer object fragment, with identical dosing system and reaction conditions carry out second time increase, PCR reaction system and condition as follows:
PCR response procedures is: denaturation 94 DEG C 5 minutes, sex change 94 DEG C 30 seconds, anneal 56 DEG C 30 seconds, extend 72 DEG C 1 minute (sex change, annealing and extension totally 36 circulations), stop 72 DEG C 5 minutes.
The tcdA gene object clip size obtained is 1122bp, as shown in Figure 4.In the diagram, A shows the Outside primer amplified production 1444bp of tcdA, M:DNAMarker2000bp; B shows the inner primer amplified production 1122bp of tcdA, M:DNAMarker2000bp.
TcdB gene object clip size is 953bp, as shown in Figure 5.In figure, A shows the Outside primer amplified production 1754bp of tcdB, M:DNAMarker2000bp; B shows the inner primer amplified production 953bp of tcdB, M:DNAMarker2000bp.
The object fragment amplification product that second time is obtained by reacting is reclaimed, recovery fragment is connected in the blue white carrier T (A type) of instant, linked system following (unit: μ L):
Reaction system mixing be placed on Metal constant temperature bath in 22 DEG C hatch 30 minutes.Then, product will be connected by heat shock, be converted in E. coli competent JM109.The white colony grown after conversion is carried out PCR colony identification.Qualification result shows, and the conversion bacterium colony of tcdA has 9 samples to amplify band, as shown in Figure 6, and wherein 7 colony identification PCR primer sizes consistent with object clip size (i.e. 1122bp); The conversion bacterium colony (see Fig. 7) of tcdB, also has 9 samples can amplify expection product band of the same size (953bp), therefrom respectively selects 2 plasmids through being accredited as the positive to deliver to raw work order-checking company and checks order.
Sequencing result is through reference material (KC292122.1 and the KC292195.1) comparison with C.difficile toxin gene tcdA and tcdB, the homology showing this quality control product sequence and reference material sequence, up to 100%, shows that prepared tcdA and tcdB quality control product sequence belongs to tcdA and tcdB gene order.The positive quality control product sequence of described acquisition is specific as follows:
The quality control product sequence (1122bp) of a.tcdA
ATGGATAGGTGGAGAAGTCAGTGATATTGCTCTTGAATACATAAAACAATGGGCTGATATTAATGCAGAATATAATATTAAACTGTGGTATGATAGTGAAGCATTCTTAGTAAATACACTAAAAAAGGCTATAGTTGAATCTTCTACCACTGAAGCATTACAGCTACTAGAGGAAGAGATTCAAAATCCTCAATTTGATAATATGAAATTTTACAAAAAAAGGATGGAATTTATATATGATAGACAAAAAAGGTTTATAAATTATTATAAATCTCAAATCAATAAACCTACAGTACCTACAATAGATGATATTATAAAGTCTCATCTAGTATCTGAATATAATAGAGATGAAACTGTATTAGAATCATATAGAACAAATTCTTTGAGAAAAATAAATAGTAATCATGGGATAGATATCAGGGCTAATAGTTTGTTTACAGAACAAGAGTTATTAAATATTTATAGTCAGGAGTTGTTAAATCGTGGAAATTTAGCTGCAGCATCTGACATAGTAAGATTATTAGCCCTAAAAAATTTTGGCGGAGTATATTTAGATGTTGATATGCTTCCAGGTATTCACTCTGATTTATTTAAAACAATATCTAGACCTAGCTCTATTGGACTAGACCGTTGGGAAATGATAAAATTAGAGGCTATTATGAAGTATAAAAAATATATAAATAATTATACATCAGAAAACTTTGATAAACTTGATCAACAATTAAAAGATAATTTTAAACTCATTATAGAAAGTAAAAGTGAAAAATCTGAGATATTTTCTAAATTAGAAAATTTAAATGTATCTGATCTTGAAATTAAAATAGCTTTCGCTTTAGGCAGTGTTATAAATCAAGCCTTGATATCAAAACAAGGTTCATATCTTACTAACCTAGTAATAGAACAAGTAAAAAATAGATATCAATTTTTAAACCAACACCTTAACCCAGCCATAGAGTCTGATAATAACTTCACAGATACTACTAAAATTTTTCATGATTCATTATTTAATTCAGCTACCGCAGAAAACTCTATGTTTTTAACAAAAATAGCACCATACTTACAAGTAGGTTTTATGCCAGAAGCTCGCTCCACAATAAGTTTAAGTGGTCCAGGAGCTTATGC
The quality control product sequence (953bp) of b.tcdB
GGTGTATTTAGTACAGAAGATGGATTTAAATATTTTGCCCCAGCTAATACACTTGATGAAAACCTAGAAGGAGAAGCAATTGATTTTACTGGAAAATTAATTATTGACGAAAATATTTATTATTTTGATGATAATTATAGAGGAGCTGTAGAATGGAAAGAATTAGATGGTGAAATGCACTATTTTAGCCCAGAAACAGGTAAAGCTTTTAAAGGTCTAAATCAAATAGGTGATTATAAATACTATTTCAATTCTGATGGAGTTATGCAAAAAGGATTTGTTAGTATAAATGATAATAAACACTATTTTGATGATTCTGGTGTTATGAAAGTAGGTTACACTGAAATAGATGGCAAGCATTTCTACTTTGCTGAAAACGGAGAAATGCAAATAGGAGTATTTAATACAGAAGATGGATTTAAATATTTTGCTCATCATAATGAAGATTTAGGAAATGAAGAAGGTGAAGAAATCTCATATTCTGGTATATTAAATTTCAATAATAAAATTTACTATTTTGATGATTCATTTACAGCTGTAGTTGGATGGAAAGATTTAGAGGATGGTTCAAAGTATTATTTTGATGAAGATACAGCAGAAGCATATATAGGTTTGTCATTAATAAATGATGGTCAATATTATTTTAATGATGATGGAATTATGCAAGTTGGATTTGTCACTATAAATGATAAAGTCTTCTACTTCTCTGACTCTGGAATTATAGAATCTGGAGTACAAAACATAGATGACAATTATTTCTATATAGATGATAATGGTATAGTTCAAATTGGTGTATTTGATACTTCAGATGGATATAAATATTTTGCACCTGCTAATACTGTAAATGATAATATTTACGGACAAGCAGTTGAATATAGTGGTTTAGTTAGAGTTGGGGAAGATGTATATTATTTTGGAGAAACATATACAATTGAGACTGGATGGATATATGA
the probe method fluorescent quantificationally PCR detecting kit of Clostridium difficile toxin A/B
This test kit is by (1) ight soil extracting genome DNA liquid; (2) 16SDNA detection system; (3) qPCR reaction solution; (4) positive quality control product; (5) specification sheets and (6) box body composition.
Wherein, (1) ight soil extracting genome DNA liquid is for extracting ight soil genomic dna, all extracting solutions that can realize this function are all applicable to the present invention, also can select the reagent in existing ight soil genome DNA extracting reagent kit on market, as the DP328 of TIANGEN company; (2) comprise in 16SDNA detection system in embodiment 1 for detecting the most special 16SrDNA primer of C.difficile, also can comprise other and carry out the required reagent of PCR reaction; (3) comprise qPCR specific detection primer and the probe of tcdA and tcdB gene in the present embodiment in qPCR reaction solution, also comprise other and carry out the required reagent of qPCR reaction; (4) positive quality control product is obtained by the method preparing positive quality control product in the present embodiment.
the detection method of the probe method fluorescent quantificationally PCR detecting kit of Clostridium difficile toxin A/B
Described detection kit is utilized to identify clostridium difficile strain and to the crucial toxin A of clostridium difficile with B detects and quantitative method, described method is as follows:
(1) ight soil genomic dna is extracted
The extraction of ight soil total genomic dna is carried out in strict accordance with ight soil genome DNA extracting reagent kit (TIANGEN company DP328) operation instructions, and carried out condition optimizing a little for C.difficile: the cracking temperature of sample pretreatment is adjusted to 95 DEG C and hatches 5min, gram positive bacterium-C.difficile cracking the broken wall of more difficult broken wall can be made, make DNA structure integrity keep optimum regime simultaneously.
(2) detection of clostridium difficile
Bacterium total genomic dna (gDNA) is extracted from the ight soil of enteron aisle diarrhoea clinical patients, utilize filter out for detecting the most special 16srDNA primer of C.difficile to the object fragment that increases, detect sample by agarose gel electrophoresis and whether carry clostridium difficile.
(3) the crucial toxin A of probe method fluorescence quantitative PCR detection clostridium difficile and B, and carry out absolute quantitation
From the ight soil of enteron aisle diarrhoea clinical patients, extract bacterium total genomic dna (gDNA), with the DNA extracted for template, use the qPCR specific detection primer of tcdA and tcdB gene and probe to carry out qPCR respectively; The copy concentrations of testing sample DNA can be obtained according to typical curve by mensuration Ct value.The present invention is optimized qPCR reaction system, optimize after concrete qPCR reaction system and condition as follows:
Its response procedures is: denaturation 95 DEG C 30 seconds, sex change 95 DEG C 15 seconds, anneal 60 DEG C 30 seconds (sex change and annealing totally 40 circulations), the collection fluorescent signal when annealing.
The method for drafting of typical curve is as follows:
By prepare in the present embodiment positive quality control product (through and ncbi database comparison, homology is up to 100%) as the standard substance of drawing standard curve, utilize nucleic acid-protein analysis-e/or determining DNA concentration, according to copy number calculation formula:
Calculate the copy number of tcdA and tcdB positive quality control product.According to the logarithmic value of positive quality control product copy number gradient concentration and the relation drawing standard curve of quality control product Ct value.After recording the Ct value of testing sample DNA, reference standard curve equation can obtain the copy concentrations of testing sample DNA.
Embodiment 3
the remolding sensitivity of this test kit and existing Clostridium difficile toxin A/B detection kit comparatively
In order to determine the qPCR concrete operation method sensitivity described in embodiment 2, we with quality control product starting point concentration for 2.19 × 10
8copies/ μ L (tcdA) and 2.29 × 10
8the template concentrations of copies/ μ L (tcdB) for the preparation of the starting point concentration of typical curve, and with EASYDilution absolute quantitation diluent by 10 times of concentration gradient serial dilutions, detects the minimum detectability of described qPCR system.In addition, select other the diplomatic primer detecting C.difficile toxin gene tcdA and tcdB, carry out qPCR with the system that present method is set up, carry out the sensitivity of the primer of (TcdCDoesNotSignificantlyRepressToxinExpressioninClostrid iumdifficile630DErm) on relatively this primer and other document.
Result judging criterion: select enterotoxigenic E.Coli (ATCC35401) to be negative control, detects under identical qPCR detection system.With the vertex setting threshold line of threshold line just above normal negative control; If template fluorescence growth curve to be measured exceedes threshold line, and increase in good logarithm, be then judged as the positive.Otherwise, be judged as feminine gender.
Detected result shows, and to the qPCR detection system of C.difficile toxin gene tcdA and tcdB, the minimum detectability of this test kit is respectively 2.19 × 10
3copies/ μ L (tcdA) (Fig. 8,9) and 2.29 × 10
3copies/ μ L (tcdB) (Figure 10,11), this result consistent with the sensitivity technique result of other document primers (Figure 12).It is worth mentioning that, under same detection system prerequisite, the normalized form that the primer of this test kit obtains is tcdA:Y=-3.016 × LgX+41.349 (R
2=0.939, E=114.595) and tcdB:Y=-3.198 × LgX+17.66 (R
2=0.904, E=105.45), its amplification efficiency value E is all high than the amplification efficiency of other document the primers, more meets the standard (90%≤E≤110%) of qPCR amplification efficiency, shows that the primer detected result of screening for this test kit is more reliable.
Embodiment 4
the specificity analyses of this test kit qPCR detection system
Salmonellas (CICC21490), Vibrio vulnificus (CICC10383), courageous and upright intestinal bacteria (ATCC43889), pathogenic colon bacillus (ATCC43887), enterotoxigenic E.Coli (ATCC35401), enteroinvasive E.Coli (ATCC43893) is gone out for template with intestines, detect with judging criterion according to the method described above, result is feminine gender, illustrates that the detection primer specificity of this test kit is good.
The concrete primer information of this patent refers to following table.
Finally to should be noted that; above embodiment is only in order to illustrate technical scheme of the present invention but not limiting the scope of the invention; although be explained in detail the present invention with reference to preferred embodiment; those of ordinary skill in the art is to be understood that; can modify to technical scheme of the present invention or equivalent replacement, and not depart from essence and the scope of technical solution of the present invention.
Claims (18)
1. detect a primer pair for clostridium difficile, it is characterized in that: the upstream primer of described primer pair has the sequence as shown in SEQIDNO:1, the downstream primer of described primer pair has the sequence as shown in SEQIDNO:2.
2. detect a primer pair for Clostridium difficile toxin A, it is characterized in that: the upstream primer of described primer pair has the sequence as shown in SEQIDNO:3, the downstream primer of described primer pair has the sequence as shown in SEQIDNO:4.
3. detect an oligonucleotide probe for Clostridium difficile toxin A, it is characterized in that: described probe has sequence as shown in SEQIDNO:5 or its complementary sequence.
4. the oligonucleotide probe of detection Clostridium difficile toxin A according to claim 3, is characterized in that: be combined with fluorescent substance at 5 ＇ ends of oligonucleotide, be combined with cancellation material at 3 ＇ ends.
5. the oligonucleotide probe of detection Clostridium difficile toxin A according to claim 4, is characterized in that: described fluorescent substance is at least one in FAM, HEX, TET, JOE, VIC, ROX; Described cancellation material is at least one in TAMRA, BHQ1, BHQ2, BHQ3, DABCYL.
6. detect an oligonucleotide group for Clostridium difficile toxin A, it is characterized in that: it has the primer pair of detection Clostridium difficile toxin A according to claim 2 and the oligonucleotide probe of detection Clostridium difficile toxin A according to claim 3.
7. detect a primer pair for Clostridium difficile toxin B, it is characterized in that: the upstream primer of described primer pair has the sequence as shown in SEQIDNO:6, the downstream primer of described primer pair has the sequence as shown in SEQIDNO:7.
8. detect an oligonucleotide probe for Clostridium difficile toxin B, it is characterized in that: described probe has sequence as shown in SEQIDNO:8 or its complementary sequence.
9. the oligonucleotide probe of detection Clostridium difficile toxin B according to claim 8, is characterized in that: be combined with fluorescent substance at 5 ＇ ends of oligonucleotide, be combined with cancellation material at 3 ＇ ends.
10. the oligonucleotide probe of detection Clostridium difficile toxin B according to claim 9, is characterized in that: described fluorescent substance is at least one in FAM, HEX, TET, JOE, VIC, ROX; Described cancellation material is at least one in TAMRA, BHQ1, BHQ2, BHQ3, DABCYL.
11. 1 kinds of oligonucleotide groups detecting Clostridium difficile toxin B, is characterized in that: it has the primer pair of detection Clostridium difficile toxin B according to claim 7 and the oligonucleotide probe of detection Clostridium difficile toxin B according to claim 8.
The primer pair of 12. 1 species-specific amplification Clostridium difficile toxin A genes, is characterized in that: its have Outside primer to inner primer pair;
The right upstream primer of described Outside primer has the sequence as shown in SEQIDNO:9, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:10;
The right upstream primer of described inner primer has the sequence as shown in SEQIDNO:11, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:12.
The primer pair of 13. 1 species-specific amplification Clostridium difficile toxin B genes, is characterized in that: its have Outside primer to inner primer pair;
The right upstream primer of described Outside primer has the sequence as shown in SEQIDNO:13, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:14;
The right upstream primer of described inner primer has the sequence as shown in SEQIDNO:15, and the downstream primer of described primer pair has the sequence as shown in SEQIDNO:16.
The probe method fluorescent quantificationally PCR detecting kit of 14. 1 kinds of Clostridium difficile toxin A/B, is characterized in that: it comprises the oligonucleotide group of detection Clostridium difficile toxin A according to claim 6 and the oligonucleotide group of detection Clostridium difficile toxin B according to claim 11.
The probe method fluorescent quantificationally PCR detecting kit of 15. Clostridium difficile toxin A/B as claimed in claim 14, is characterized in that: it also comprises the primer pair of detection clostridium difficile according to claim 1.
The probe method fluorescent quantificationally PCR detecting kit of 16. Clostridium difficile toxin A/B as claimed in claim 14, it is characterized in that: it also comprises the positive quality control product of Clostridium difficile toxin A and Clostridium difficile toxin B, the positive quality control product of described Clostridium difficile toxin A has the sequence as shown in SEQIDNO:17, and the positive quality control product of described Clostridium difficile toxin B has the sequence as shown in SEQIDNO:18.
The probe method fluorescent quantificationally PCR detecting kit of 17. Clostridium difficile toxin A/B as claimed in claim 16, is characterized in that: the preparation method of the positive quality control product of described Clostridium difficile toxin A and the positive quality control product of described Clostridium difficile toxin B is:
A, from the ight soil of clostridium difficile patient, extract total genomic dna;
B, with steps A) in extract total genomic dna be template, use the primer pair of specific amplification Clostridium difficile toxin A gene described in claim 12 and the primer pair of specific amplification Clostridium difficile toxin B gene according to claim 13, the object fragment of increase according to nest-type PRC two one-step circulation method Clostridium difficile toxin A gene and Clostridium difficile toxin B gene;
C, recycling step B) in the object fragment that obtains, described object fragment is connected in the blue white carrier T of instant, is converted into subsequently in intestinal bacteria, the white colony grown after transforming being carried out PCR colony identification, extracting the plasmid through being accredited as positive.
The probe method fluorescent quantitative PCR detection method of 18. 1 kinds of Clostridium difficile toxin A/B, is characterized in that: comprise the following steps:
1) from human faecal mass sample, total genomic dna is extracted;
2) with step 1) in the total genomic dna that extracts be template, use primer described in claim 1 to carry out PCR, detect pcr amplification product and can judge whether described sample carries clostridium difficile; If described sample carries clostridium difficile, then enter step 3);
3) with step 1) in the total genomic dna that extracts be template, use the oligonucleotide group of detection Clostridium difficile toxin A described in claim 6 and the oligonucleotide group of detection Clostridium difficile toxin B according to claim 11 to carry out qPCR respectively;
4) by measuring the Ct value of DNA, the copy concentrations of DNA can be obtained according to typical curve.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610080808.4A CN105525023A (en) | 2016-02-04 | 2016-02-04 | Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610080808.4A CN105525023A (en) | 2016-02-04 | 2016-02-04 | Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105525023A true CN105525023A (en) | 2016-04-27 |
Family
ID=55767546
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610080808.4A Pending CN105525023A (en) | 2016-02-04 | 2016-02-04 | Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105525023A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110029155A (en) * | 2019-05-27 | 2019-07-19 | 天益健康科学研究院（镇江）有限公司 | One kind being based on quantitative fluorescent PCR combined type enteric bacteria detection method |
| CN110055311A (en) * | 2019-04-17 | 2019-07-26 | 江苏佰思瑞生物科技有限公司 | Clostridium difficile fluorescence quantitative PCR detection primer sets and kit |
| CN112266915A (en) * | 2020-10-22 | 2021-01-26 | 大连理工大学 | Aptamer for detecting clostridium difficile and application thereof |
| CN114214437A (en) * | 2021-11-24 | 2022-03-22 | 西湖大学 | Method for identifying toxin-producing clostridium difficile and genotyping of toxin thereof |
| CN114959074A (en) * | 2022-01-11 | 2022-08-30 | 河北医科大学第二医院 | Specific sequence of high-toxicity clostridium difficile and application of specific sequence in identification and typing |
| CN118531139A (en) * | 2024-05-08 | 2024-08-23 | 云南省疾病预防控制中心 | Clostridium difficile cysE and cysK gene quantitative detection method |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102952886A (en) * | 2012-11-28 | 2013-03-06 | 中华人民共和国张家港出入境检验检疫局 | Dual fluorescence quantitative PCR (polymerase chain reaction) detection method and detection kit for clostridium difficile enterotoxin A and B |
| CN103305629A (en) * | 2013-04-16 | 2013-09-18 | 西安建筑科技大学 | Detection method for CVA16 in environmental water body |
| CN103305628A (en) * | 2013-04-16 | 2013-09-18 | 西安建筑科技大学 | Detection method for EV71virus in environmental water body |
| CN103361434A (en) * | 2013-07-24 | 2013-10-23 | 浙江省疾病预防控制中心 | Multiple fluorescence PCR detection kit and detection method for clostridium difficile toxin genes |
| CN103764850A (en) * | 2011-09-01 | 2014-04-30 | 株式会社益力多本社 | Method for detecting toxin-producing clostridium difficile |
-
2016
- 2016-02-04 CN CN201610080808.4A patent/CN105525023A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103764850A (en) * | 2011-09-01 | 2014-04-30 | 株式会社益力多本社 | Method for detecting toxin-producing clostridium difficile |
| CN102952886A (en) * | 2012-11-28 | 2013-03-06 | 中华人民共和国张家港出入境检验检疫局 | Dual fluorescence quantitative PCR (polymerase chain reaction) detection method and detection kit for clostridium difficile enterotoxin A and B |
| CN103305629A (en) * | 2013-04-16 | 2013-09-18 | 西安建筑科技大学 | Detection method for CVA16 in environmental water body |
| CN103305628A (en) * | 2013-04-16 | 2013-09-18 | 西安建筑科技大学 | Detection method for EV71virus in environmental water body |
| CN103361434A (en) * | 2013-07-24 | 2013-10-23 | 浙江省疾病预防控制中心 | Multiple fluorescence PCR detection kit and detection method for clostridium difficile toxin genes |
Non-Patent Citations (10)
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055311A (en) * | 2019-04-17 | 2019-07-26 | 江苏佰思瑞生物科技有限公司 | Clostridium difficile fluorescence quantitative PCR detection primer sets and kit |
| CN110029155A (en) * | 2019-05-27 | 2019-07-19 | 天益健康科学研究院（镇江）有限公司 | One kind being based on quantitative fluorescent PCR combined type enteric bacteria detection method |
| CN112266915A (en) * | 2020-10-22 | 2021-01-26 | 大连理工大学 | Aptamer for detecting clostridium difficile and application thereof |
| CN114214437A (en) * | 2021-11-24 | 2022-03-22 | 西湖大学 | Method for identifying toxin-producing clostridium difficile and genotyping of toxin thereof |
| CN114959074A (en) * | 2022-01-11 | 2022-08-30 | 河北医科大学第二医院 | Specific sequence of high-toxicity clostridium difficile and application of specific sequence in identification and typing |
| CN114959074B (en) * | 2022-01-11 | 2023-08-22 | 河北医科大学第二医院 | Specific sequence of clostridium difficile with high toxigenic and application thereof in identification and typing |
| CN118531139A (en) * | 2024-05-08 | 2024-08-23 | 云南省疾病预防控制中心 | Clostridium difficile cysE and cysK gene quantitative detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105525023A (en) | Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method | |
| Huijsdens et al. | Quantification of bacteria adherent to gastrointestinal mucosa by real-time PCR | |
| CN102605055B (en) | Multiplex quantitative PCR (polymerase chain reaction) detection kit for vibrio parahaemolyticus and detection method | |
| CN103361434B (en) | Multiple fluorescence PCR detection kit and detection method for clostridium difficile toxin genes | |
| Clancy et al. | Development of a rapid recombinase polymerase amplification assay for the detection of Streptococcus pneumoniae in whole blood | |
| CN103866034A (en) | Multiple real-time fluorescence quantification PCR (polymerase chain reaction) detection kit and detection method for helicobacter pylori in gastric juice | |
| CN102230013B (en) | Target sequence, primer, probe and kit for detecting Mycoplasma pneumonia | |
| CN103468811B (en) | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit | |
| CN110904250B (en) | Multiplex fluorescent quantitative PCR primer, kit and detection method for detecting multiple bacteria | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| CN102453762A (en) | Kit and method for detecting porcine proliferative enteropathy (PPE) pathogenic bacteria Lawsonia Intracellularis | |
| CN114891902A (en) | Primer-probe combination for rapidly detecting five virulent pathogenic bacteria based on liquid drop digital PCR and application method thereof | |
| CN109234419A (en) | Bacillus anthracis double fluorescent quantitative PCR detection kit and detection method | |
| CN102952886A (en) | Dual fluorescence quantitative PCR (polymerase chain reaction) detection method and detection kit for clostridium difficile enterotoxin A and B | |
| CN109337995B (en) | PCR detection method and kit for eubacterium terrae and subspecies thereof | |
| CN103333903A (en) | Target sequence, primer and probe for detecting helicobacter pylori and kit thereof | |
| CN108070638B (en) | Recombinase polymerase isothermal amplification method for detecting orientia tsutsutsugamushi, special primer and probe thereof and application | |
| CN106967839A (en) | Primer, probe, kit and the method for B races streptococcus fluorescence quantitative PCR detection | |
| CN104232783A (en) | Quick detection method for cow brucella attenuated vaccine strain A19 | |
| CN101768636A (en) | Composition and kit for detecting vibrio cholerae and detection method | |
| CN105567802A (en) | Fluorescence PCR (polymerase chain reaction) detection kit for Chlamydia pneumoniae | |
| CN103421892B (en) | Fluorescent PCR method for identifying the drug-resistant mutation of macrolides and for identifying Campylobacter jejuni | |
| CN106011154A (en) | Molecular detection kit for klebsiella pneumoniae causing hepatic abscess and application thereof | |
| CN108753997A (en) | A kind of fluorescent quantitation recombinase polymeric enzymatic amplification method for detecting Brucella sp | |
| CN108048586A (en) | A kind of detection method of ox kind Brucella sp attenuated vaccine strain S19 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160427 |