CN114262707B - sgRNA for detecting campylobacter jejuni gene, CRISPR/Cas12a system, kit, detection method and application - Google Patents

Abstract

The invention discloses an sgRNA (ribonucleic acid) for detecting campylobacter jejuni genes, a CRISPR/Cas12a system, a kit, a detection method and application, and belongs to the technical field of bacteria detection. The method comprises the step of specifically detecting the sgRNA of the campylobacter jejuni gene, wherein the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 1. The detection method has the advantages of good specificity, extremely high sensitivity, simple and quick operation, low cost, no need of large-scale instruments and equipment, visualization and more contribution to popularization and application of molecular detection technology of campylobacter jejuni in a base layer.

Description

sgRNA for detecting campylobacter jejuni gene, CRISPR/Cas12a system, kit, detection method and application

Technical Field

The invention relates to the technical field of bacterial detection, in particular to a sgRNA and CRISPR/Cas12a system for detecting campylobacter jejuni genes, a kit, a detection method and application.

Background

Campylobacter jejuni (Campylobacter jejuni) is a gram negative bacterium growing microaerophilically and is an important zoonotic pathogen affecting the food safety of animal products. It is one of three major human diarrhea pathogens other than salmonella and shigella. Campylobacter jejuni causes acute bacterial gastroenteritis upon infection of humans, and can also lead to other complications such as meningitis, urinary tract infections, guillain-Barre syndrome (GBS) and Fisher Syndrome (FS), bacteremia and autoimmune neuroparalysis. As an important food-borne pathogen, the global incidence is even higher than some other common pathogens that also cause acute gastrointestinal infections, such as e.coli, shigella or salmonella. Infections caused by campylobacter jejuni have been reported throughout the world including europe, north america, australia, middle east, africa, asia, etc., and the incidence and prevalence have been on the rise. Birds serve as main hosts of campylobacter jejuni, chickens and viscera thereof sold on the market are often polluted by the campylobacter jejuni, and raw pork, raw beef and raw mutton can also be polluted by the campylobacter jejuni. In addition, campylobacter jejuni can also cause human infection through animal fecal contaminated water sources or human-to-animal contact.

A classical method for identifying Campylobacter jejuni is a biochemical identification method, and the inoculated modified Camp-BAP agar or Skirrow agar can be subjected to microaerophilic (5% O) at 42+ -1deg.C by reference to "food safety national Standard food microbiology test Campylobacter jejuni test" (GB 4789.9-2014) ₂ ,10％CO ₂ And 85% N ₂ ) The culture is carried out for 48 hours under the condition, and the higher culture temperature can inhibit some competitive flora in samples such as food and the like, and then the identification is completed by combining biochemical experiments such as catalase, glycine tolerance, 3.5% sodium chloride intolerance, sodium hippurate, nitrate reduction and the like. International organization for standardization (ISO) in 2009 recommended the use of Bolton broth in detection of campylobacter jejuni, microaerophilic culture at 37 ℃ for 4-6h and then at 41.5 ℃ for 40-48h. Detection of Campylobacter from foods with high background values such as raw chicken meat products, raw meat and raw milk, etc., was cultured with Preston broth (Preston broth) under microaerophilic culture at 41.5℃for 24 hours, and then isolated culture was performed with active cefoperazone deoxycholate plates (CCDA). The identification method is complex in operation, long in time period and low in sensitivity, and cannot cope with the situation of urgent need of detection in the emergency. The single immunological method is easy to pollute and has serious cross reaction, and the conventional PCR detection method needs matched instruments such as a PCR instrument, an electrophoresis instrument, a gel imaging system and the like.

The immunomagnetic bead separation technology is a technology for coupling a specific antibody with magnetic beads with a certain size, combining the magnetic beads with cells by utilizing the principle that the specific antibody can be combined with cell surface antigens, separating the magnetic bead-cell complex from the environment under the action of an external magnetic field, and obtaining target cells, but only separation can be realized when the technology is singly used, detection is also required by combining other means, and the sensitivity of the detection method for separating by using the immunomagnetic separation technology at present still needs to be improved. The molecular biology detection technology loop-mediated isothermal amplification (LAMP) can design a primer according to a specific sequence of a strain and amplify the specific sequence, so that the purpose of identifying the strain is achieved. The CRISPR/Cas12a protein can specifically cut a target sequence under the guidance of sgRNA, simultaneously activate trans-cutting activity, randomly cut a probe to generate fluorescence, however, the sensitivity of detection by using single CRISPR/Cas nucleic acid is very limited, and the sensitivity of detection can be greatly improved by commonly combining a nucleic acid amplification technology with the detection technology.

Disclosure of Invention

The invention aims to provide an sgRNA, CRISPR/Cas12a system, a kit, a detection method and application for detecting campylobacter jejuni genes, so as to solve the problems that the existing campylobacter jejuni detection method is complex in operation, long in time period, low in sensitivity and incapable of coping with the situation of urgent detection in emergencies.

The technical scheme for solving the technical problems is as follows:

the invention provides an sgRNA for specifically detecting campylobacter jejuni, and the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 1. The sequence of SEQ ID NO.1: GAAUUUCUACUGUUGUAGAUCCUUUACAAGAAUGCACAAAUUUG.

The invention provides application of the sgRNA in detection of campylobacter jejuni.

The invention also provides application of the sgRNA in preparation of campylobacter jejuni detection products.

The invention provides a CRISPR/Cas12a system for detecting campylobacter jejuni, which comprises the sgRNA and a Cas12a protein.

Further, in the CRISPR/Cas12a system for detecting campylobacter jejuni, the CRISPR/Cas12a system further comprises a ssDNA probe with a FAM labeled at a5 'end and BHQ1 labeled at a 3' end.

Further, in the CRISPR/Cas12a system for detecting campylobacter jejuni, the nucleotide sequence of the ssDNA probe is shown as SEQ ID NO. 2. The sequence of SEQ ID NO.2: FAM-TTTTTT-BHQ1.

The invention also provides an isothermal amplification-CRISPR/Cas 12a system for detecting campylobacter jejuni, which comprises the CRISPR/Cas12a system and an isothermal amplification system;

the primer group of the isothermal amplification system comprises a forward outer primer, a reverse outer primer, a forward inner primer and a reverse inner primer;

the nucleotide sequence of the forward outer primer is shown as SEQ ID NO. 3; the nucleotide sequence of the reverse outer primer is shown as SEQ ID NO. 4; the nucleotide sequence of the forward inner primer is shown as SEQ ID NO. 5; the nucleotide sequence of the reverse inner primer is shown as SEQ ID NO. 6.

The sequence of SEQ ID NO.3: GAAAAACAGGCGTTGTG.

The sequence of SEQ ID NO.4: CCTCTTCAGCAGGTTGAA.

The sequence of SEQ ID NO.5:

GCATTCTTGTAAAGGCAAAGCATTTTTGGAAATAGCGATAAAAAAATAGGAC。

the sequence of SEQ ID NO.6:

TGCATGCTTGTGGTCATGATGTTTTCGCCATTAAAATTCTGACTTG

the invention also provides a kit for detecting campylobacter jejuni, which comprises the isothermal amplification-CRISPR/Cas 12a system and immunocapture magnetic beads.

Further, in the kit for detecting campylobacter jejuni, the immunocapture magnetic beads are modified by campylobacter jejuni antibodies.

The invention also provides a detection method of the kit for detecting campylobacter jejuni, which comprises the following steps of:

capturing campylobacter jejuni in a sample to be detected by using an immunocapture magnetic bead, and performing cleavage to obtain amplified template DNA;

isothermal amplification reaction is carried out on the amplification template to obtain an amplification product;

adding the amplification product into the CRISPR/Cas12a system to perform enzyme digestion reaction to obtain a signal product; and (5) comparing the signal products.

Campylobacter jejuni is mainly host for poultry, and pollution is serious and unavoidable in the whole food processing chain from farm to dining table. The current detection method of campylobacter jejuni comprises the traditional separation culture identification and the PCR, qPCR, loop-mediated isothermal amplification (LAMP) and other molecular detection methods. Because of the microaerophilic property of campylobacter jejuni, the isolated culture and identification of the campylobacter jejuni are more difficult than the conventional facultative anaerobic pathogenic bacteria, and the molecular detection methods such as PCR and qPCR require corresponding equipment and are not suitable for on-site detection. Single LAMP has application potential of on-site rapid detection due to the isothermal amplification characteristic, but the detection of results requires uncapping to easily cause false positive results such as aerosol pollution.

The invention has the following beneficial effects:

1. the invention designs LAMP amplification primers aiming at the hipO gene of campylobacter jejuni, establishes an LAMP identification system of campylobacter jejuni, and designs sgRNA for detecting the ICB-LAMP-CRISPR/Cas12a of campylobacter jejuni aiming at the hipO gene of campylobacter jejuni. The ICB-LAMP-CRISPR/Cas12a detection amplification method for rapidly, accurately and one-tube detecting campylobacter jejuni is established for the hipO gene of campylobacter jejuni. Combining LAMP with CRISPR/Cas12a allows for direct product detection without uncapping.

2. The invention combines the immune capture magnetic beads (ICB) enrichment sample, LAMP amplification and a CRISPR/Cas12a detection method into a ICB-LAMP-CRISPR/Cas12a detection kit and a detection method. The detection method has the advantages of good specificity, extremely high sensitivity, simple and quick operation, low cost, no need of large-scale instruments and equipment, visualization and more contribution to popularization and application of molecular detection technology of campylobacter jejuni in a base layer.

3. The detection method is an effective means in real-time monitoring and food safety detection of the campylobacter jejuni in the chicken farm so as to control the propagation of the campylobacter jejuni in the production chain, including contaminated feed, breeding hens and chicks, cross contamination in the processes of hatching, breeding, transportation, slaughtering, product processing and the like, and reduce public health threats.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram showing the capture of immunocapture magnetic beads at different time periods in test example 1;

FIG. 2 shows the fluorescence response of different signal products in test example 3;

FIG. 3 shows the fluorescence response of the signal product of sgRNA4 in test example 3 at different time periods;

FIG. 4 is a graph showing the effect of immunocapture magnetic bead concentration on the fluorescence response intensity of signal products in test example 4;

FIG. 5 is a specific analysis of the detection method of the present invention;

FIG. 6 shows the detection of chicken farm-derived strain isolates by the detection method of the present invention.

Detailed Description

The principles and features of the present invention are described below with reference to the following examples and drawings, which are provided for the purpose of illustrating the invention and are not to be construed as limiting the scope of the invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

In the drawings of the present invention, the opalescence with relatively high concentration is a fluorescence effect specifically indicated in the present invention.

Test example 1 construction of immunocapture magnetic beads (ICB)

Pretreatment of magnetic beads: the magnetic beads are oscillated for 1min in a vortex mode, so that the magnetic beads are fully oscillated and resuspended; 500. Mu.L of the magnetic bead suspension was placed in a 1.5mL EP tube, the EP tube was placed in a magnetic separation rack, the magnetic beads were enriched, and the supernatant was removed. 1mL of pre-chilled Wash Buffer A at 4deg.C was added to Wash, magnetic separation was performed, the supernatant was discarded, the EP tube was removed from the magnetic separator, and the Wash was repeated once.

Antibody coupling: after magnetic separation of the magnetic bead suspension pretreated with magnetic beads, 500. Mu.L of campylobacter jejuni antibody solution was added to the EP tube, and the mixture was vortexed for 30s to mix uniformly. The EP tube was vortexed for 15s and placed on a vertical mixer and mixed for 2h at room temperature. And enriching the magnetic beads by adopting a magnetic separation frame, and preserving the flowing-through liquid.

And (3) magnetic bead sealing: add 1mL Blocking Buffer to the EP tube, vortex for 30s, place the EP tube in a magnetic separation rack, enrich the beads, discard the supernatant. The operation was repeated four times. Then, 1. 1mL Blocking Buffer was added to the EP tube, and the mixture was vortexed for 30 seconds, and the EP tube was placed in a vertical mixer and reacted at room temperature for 2 hours. The EP tube was placed in a magnetic separation rack, the beads were enriched, and the supernatant was discarded. Add 1mL of ultrapure water to the EP tube, mix well, enrich the beads with a magnetic rack, discard the supernatant.

Determination of antigen capture time of immunomagnetic beads: will be 8×10 ³ CFU/mL campylobacter jejuni solution was added to the conjugated magnetic bead solution with campylobacter jejuni specific antibody of step 1.3, incubated in a horizontal shaker at room temperature at 100 rpm, magnetically separated at 10min intervals, and the bacterial count in the supernatant was detected by plate counting.

As shown in FIG. 1, the ICB constructed in the present invention is shown in the form of a powder of 8×10 ³ The upper capture limit was reached after 20 minutes incubation of CFU/mL campylobacter jejuni solution.

Test example 2 specific target gene screening and LAMP amplification method

Primer design: according to the published hipO Gene of campylobacter jejuni (Gene ID: 905276), specific primer sets were designed according to the primer design principle and the LAMP amplification technique principle. The primer group comprises a forward outer primer F3, a reverse outer primer B3, a forward inner primer FIP and a reverse inner primer BIP; the sequence of the forward outer primer F3 is shown as SEQ ID NO. 3; the sequence of the reverse outer primer B3 is shown as SEQ ID NO. 4; the sequence of the forward inner primer FIP is shown in SEQ ID NO. 5; the sequence of the reverse inner primer BIP is shown in SEQ ID NO.6, and the specific nucleotide sequence is shown in Table 1:

TABLE 1

LAMP amplification reaction:

extraction of DNA: the extraction and recovery are carried out by using a small amount of extraction kit of the bacterial genome DNA of Tiangen biochemical technology (Beijing) limited company, and the steps are as follows:

(1) the bacterial culture was centrifuged at 10,000rpm for 1 minute at 5mL and the supernatant was aspirated as much as possible.

(2) 200. Mu.L of buffer GA was added to the bacterial pellet, and the pellet was shaken until it was thoroughly suspended.

(3) mu.L of the protease K solution was added to the tube and mixed well.

(4) 220. Mu.L of buffer GB was added, shaken for 15 seconds, allowed to stand at 70℃for 10 minutes, the solution was strained clear, and centrifuged briefly to remove water droplets on the inner wall of the tube cap.

(5) Adding 220 μl of absolute ethanol, shaking thoroughly, mixing for 15 seconds, and centrifuging briefly to remove water droplets on the inner wall of the tube cover.

(6) The solution obtained in the previous step and the flocculent precipitate were both put into an adsorption column CB3 (the adsorption column was put into a collection tube), centrifuged at 12,000rpm for 30 seconds, the waste liquid was poured out, and the adsorption column CB3 was put into the collection tube.

(7) 500. Mu.L of buffer GD was added to the adsorption column CB3, and the mixture was centrifuged at 12,000rpm for 30 seconds, and the waste liquid was poured off to place the adsorption column CB3 into a collection tube.

(8) 600. Mu.L of the rinse PW was added to the adsorption column CB3, centrifuged at 12,000rpm for 30 seconds, the waste liquid was poured off, and the adsorption column CB3 was placed in a collection tube.

(9) The operation 8 is repeated.

The adsorption column CB3 was returned to the collection tube and centrifuged at 12,000rpm for 2 minutes to discard the waste liquid. The adsorption column CB3 was left at room temperature for several minutes to thoroughly dry the residual rinse solution in the adsorption material.

Transferring the adsorption column CB3 into a clean centrifuge tube, suspending and dripping 200 mu L of elution buffer TE into the middle part of the adsorption film, standing for 2 minutes at room temperature, centrifuging at 12,000rpm for 2 minutes, and collecting the solution into the centrifuge tube.

LAMP amplification system: the LAMP reaction was performed using the DNA set forth above. The 10 μl reagent system comprises: 1 mu L Isothermal Amplification Buffer II,6mM Mg ²⁺ 320U/mL Bst3.0DNA polymerase, 1.2mM dNTPs, 0.2. Mu.M outer primer (F3/B3), 1.6. Mu.M inner primer (FIP/BIP), 5. Mu.L genomic DNA (gDNA), and nuclease water make-up to 10. Mu.L. Reaction conditions: amplifying for 30min at 65 ℃.

Test example 3 establishment of ICB-LAMP-CRISPR/Cas12a cleavage method

Optimization of CRISPR/Cas12a detection System

6 sgRNA sequences and ssDNA probes for the hipO gene were designed, and the specific sequences are shown in Table 1.

8X 10 captured by ICB ³ The DNA released by CFU/mL campylobacter jejuni is used as a template for LAMP amplification, and LAMP amplification reaction occurs at the bottom of a tube. A total of 10. Mu.L of LAMP reaction products are taken as enzyme digestion substrates, and 20. Mu.L of CRISPR/Cas12a reaction system is adopted for screening the sgRNA cleavage activity. To avoid aerosol propagation caused by cap opening operation after LAMP amplification, a CRISPR/Cas12a reaction system is preset at the cap of the PCR tube, comprising 166.67nM

Lba Cas12a, 1.83. Mu.M sgRNA, 4U/. Mu.L RNase inhibitor, 2. Mu.L NEBuffer, 1.67. Mu.M FAM-BHQ 1-labeled ssDNA probe and DEPC water. After the LAMP reaction for 30min was completed, the PCR reaction tube was mixed upside down and digested at 37℃for 10 min. The fluorescence signal is collected by a CFX96Touch Real-Time PCR detection system, and the visual result is realized by a transmission light source with excitation wavelength of 485 nm.

As shown in FIG. 2, the results of screening the CRISPR/Cas12a detection system for sgRNA showed that in the present invention, the fluorescence reaction of sgRNA1-3 and sgRNA5-6 produced little fluorescence, the fluorescence of sgRNA4 produced, and the fluorescence of sgRNA4 produced more brightly under a transmission light source with excitation wavelength of 485nm, and the use of sgRNA4 as the detection in the subsequent experiments.

In order to further shorten the detection Time, the fluorescence generation process is collected by a CFX96Touch Real-Time PCR detection system for Real-Time monitoring, and the fluorescence intensities at different Time points are recorded by mobile phone photographing.

As shown in FIG. 3, in the present invention, the fluorescence intensity was increased with the increase of the incubation time, and reached the maximum value at about 30min. According to the fluorescence intensity at different time points, the enzyme digestion result can be visually judged at 10 min.

Test example 4 sensitivity analysis of the detection method of the present invention

The immunocapture magnetic beads are used for enriching campylobacter jejuni after 10-time gradient dilution, DNA is released through heating after magnetic separation, LAMP-CRISPR/Cas12a detection is carried out, and the reaction system and the reaction procedure are as described above.

As shown in fig. 4, the sensitivity detection result of the ICB-LAMP-CRISPR/Cas12a identification system shows that the sensitivity of the ICB-LAMP-CRISPR/Cas12a identification system in the invention is 8CFU/mL bacterial liquid.

Test example 5 specific analysis of the detection method of the present invention

Detecting campylobacter jejuni, campylobacter coli, escherichia coli, shigella, salmonella enteritidis, klebsiella pneumoniae and proteus mirabilis according to the optimal reaction conditions of the LAMP reaction system and the optimal cutting reaction conditions of CRISPR/Cas12a, and verifying the specificity of the method for detecting campylobacter jejuni.

As shown in FIG. 5, in the invention, the ICB-LAMP-CRISPR/Cas12a identification system detects that only campylobacter jejuni is detected to generate fluorescence and is positive, and the campylobacter coli, the escherichia coli, the shigella, the salmonella enteritidis and the klebsiella pneumoniae are all negative and non-fluorescent.

Test example 6 detection of chicken farm-derived isolates by the detection method of the present invention

For 31 identified campylobacter jejuni chicken farm-derived isolates, campylobacter jejuni was enriched by ICB, DNA was released by heating after magnetic separation, and samples were then tested using LAMP-CRISPR/Cas12a of the present invention to verify the ability of ICB-LAMP-CRISPR/Cas12a to detect campylobacter jejuni isolates.

As shown in FIG. 6, the ICB-LAMP-CRISPR/Cas12a identification system of the present invention was verified in 31 identified campylobacter jejuni chicken farm-derived isolates. The ICB-LAMP-CRISPR/Cas12a detection method can be applied to the detection of chicken farm campylobacter jejuni, and the ICB-LAMP-CRISPR/Cas12a detection is more convenient and faster, has higher sensitivity and specificity, and can visually observe the detection result with naked eyes.

The foregoing description of the preferred embodiments of the invention is not intended to limit the invention to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the invention are intended to be included within the scope of the invention.

Sequence listing

<120> sgRNA for detection of Campylobacter jejuni gene, system, kit, detection method and use

<140> 202111681762.9

<141> 2021-12-30

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 44

<212> RNA

<213> Artificial Sequence

<400> 1

gaauuucuac uguuguagau ccuuuacaag aaugcacaaa uuug 44

<210> 2

<211> 6

<212> DNA

<213> Artificial Sequence

<400> 2

tttttt 6

<210> 3

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 3

gaaaaacagg cgttgtg 17

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 4

cctcttcagc aggttgaa 18

<210> 5

<211> 52

<212> DNA

<213> Artificial Sequence

<400> 5

gcattcttgt aaaggcaaag catttttgga aatagcgata aaaaaatagg ac 52

<210> 6

<211> 46

<212> DNA

<213> Artificial Sequence

<400> 6

tgcatgcttg tggtcatgat gttttcgcca ttaaaattct gacttg 46

<210> 7

<211> 44

<212> RNA

<213> Artificial Sequence

<400> 7

gaauuucuac uguuguagau caagaaugca caaauuugcc uuau 44

<210> 8

<211> 44

<212> RNA

<213> Artificial Sequence

<400> 8

gaauuucuac uguuguagau uuuuuugcuu uuauaaggca aauu 44

<210> 9

<211> 44

<212> RNA

<213> Artificial Sequence

<400> 9

gaauuucuac uguuguagau cagcaagcaa uaaagaagua guau 44

<210> 10

<211> 44

<212> RNA

<213> Artificial Sequence

<400> 10

gaauuucuac uguuguagau uaaggcaaau uugugcauuc uugu 44

<210> 11

<211> 44

<212> RNA

<213> Artificial Sequence

<400> 11

gaauuucuac uguuguagau cuuuuauaag gcaaauuugu gcau 44

Claims (10)

1. A method for specifically detecting Campylobacter jejuniCampylobacter jejuni) Is characterized in that the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 1.

2. Use of the sgRNA of claim 1 for detecting campylobacter jejuni.

3. Use of the sgRNA of claim 1 for the preparation of a campylobacter jejuni detection product.

4. A CRISPR/Cas12a system for detecting campylobacter jejuni comprising the sgRNA of claim 1 and a Cas12a protein.

5. The CRISPR/Cas12a system for detecting campylobacter jejuni according to claim 4, further comprising a ssDNA probe 5 'end-labeled FAM,3' end-labeled BHQ1.

6. The CRISPR/Cas12a system for detecting campylobacter jejuni according to claim 5, wherein the nucleotide sequence of the ssDNA probe is shown in SEQ ID No. 2.

7. An isothermal amplification-CRISPR/Cas 12a system for detecting campylobacter jejuni, comprising the CRISPR/Cas12a system of claim 4 and an isothermal amplification system;

the primer group of the isothermal amplification system comprises a forward outer primer, a reverse outer primer, a forward inner primer and a reverse inner primer;

the nucleotide sequence of the forward outer primer is shown as SEQ ID NO. 3; the nucleotide sequence of the reverse outer primer is shown as SEQ ID NO. 4; the nucleotide sequence of the forward inner primer is shown as SEQ ID NO. 5; the nucleotide sequence of the reverse inner primer is shown as SEQ ID NO. 6.

8. A kit for detecting campylobacter jejuni comprising the isothermal amplification-CRISPR/Cas 12a system of claim 7 and immunocapture magnetic beads.

9. The kit for detecting campylobacter jejuni according to claim 8, wherein the immunocapture magnetic beads are modified with campylobacter jejuni antibodies.

10. A detection method based on the kit for detecting campylobacter jejuni according to claim 8 or 9, characterized by comprising the steps of:

capturing campylobacter jejuni in a sample to be detected by using an immunocapture magnetic bead, and performing cleavage to obtain amplified template DNA;

isothermal amplification reaction is carried out on the amplification template to obtain an amplification product;

adding the amplification product into the CRISPR/Cas12a system to perform enzyme digestion reaction to obtain a signal product; and (5) comparing the signal products.

Images