CN106544444B - LAMP (loop-mediated isothermal amplification) rapid detection kit for streptococcus faecalis dry pulverization and use method thereof - Google Patents
LAMP (loop-mediated isothermal amplification) rapid detection kit for streptococcus faecalis dry pulverization and use method thereof Download PDFInfo
- Publication number
- CN106544444B CN106544444B CN201611263571.XA CN201611263571A CN106544444B CN 106544444 B CN106544444 B CN 106544444B CN 201611263571 A CN201611263571 A CN 201611263571A CN 106544444 B CN106544444 B CN 106544444B
- Authority
- CN
- China
- Prior art keywords
- freeze
- streptococcus faecalis
- isothermal amplification
- solution
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a rapid LAMP (loop-mediated isothermal amplification) detection kit for streptococcus faecalis dry powder and a rapid detection method based on the kit. The kit comprises a freeze-dried isothermal amplification agent, a complex solution, positive control dry powder, negative control, a developing solution, a lysis solution and a confining solution, wherein the freeze-dried isothermal amplification agent contains dNTPs,BstDNA polymerase, amplification primers and a lyoprotectant. The primers in the kit correspond to eight sections of the specific gene sequence of the streptococcus faecalis, and the color developing solution is added after reaction, so that the kit has the advantages of obvious negative and positive color developing difference, strong specificity, high sensitivity, easiness in operation, simplicity in result judgment and the like, and is suitable for quality control, safety and rapid detection of food safety, beverages, water and other raw and auxiliary materials. The kit is convenient to transport at normal temperature, is simple and quick to use, does not need special instruments, reduces the cost, widens the application range of products, is more suitable for field quick detection and relevant detection in remote areas of the basic level, and has wide application prospect.
Description
Technical Field
The invention relates to a LAMP rapid detection reagent for dry pulverization and a rapid detection method based on the LAMP rapid detection reagent, in particular to a kit for LAMP rapid detection of dry pulverization of streptococcus faecalis and a rapid detection method based on the kit.
Background
Fecal streptococcus, which is a thermotolerant bacterium that is widely distributed in the intestinal tracts of humans and animals and excreted out of the body with feces, still grows well at temperatures of 44.5 ± 0.2 ℃. The water source used as drinking water is very easy to be directly or indirectly polluted by excrement, if intestinal infectious diseases exist in the pollution sources, the water source may contain live pathogenic factors, the polluted drinking water can cause diseases to people, the streptococcus faecalis used as an indicator of sanitary bacteria in the drinking water, the detection of the sanitation of the drinking water is very important, and the streptococcus faecalis can reflect whether the water body is polluted by the excrement or other pollution sources, so that whether the danger of pathogenic bacteria exists in the water body is indirectly known, measures are taken in time for treatment and protection, and the streptococcus faecalis cannot be detected when the drinking water is drunk according to regulations. The traditional biochemical methods which can be used for detecting the streptococcus faecalis in bottled water at present comprise a coating method, a multi-test-tube MPN method and a filter membrane method, and in order to improve the detection efficiency, molecular biological detection methods such as an enzyme-linked immunosorbent assay, a nucleic acid probe technology, a nucleic acid amplification technology and the like can be used for carrying out rapid detection and result preliminary screening. The technologies try to break through the traditional modes of morphology, biochemical reaction and the like, do not need to separate and purify target bacteria, and directly use the sample or the enriched liquid of the sample for detection, so that the detection is developed towards the direction of accuracy, rapidness and low cost.
LAMP technology is a novel in vitro isothermal amplification technique for specific nucleic acid fragments developed by Notomi et al, researchers in Japan, 2000. This technique utilizes two pairs of special primers and Bst DNA polymerase with strand displacement activity. The circular single-chain structure appears at the joint of the primers at the two ends of the template in the reaction, and the primers are smoothly combined with the template under the isothermal condition to carry out the strand displacement amplification reaction. LAMP is used for rapid detection without complex instruments, and has the advantages of simple result interpretation, high sensitivity, good specificity, wide detection range and low application cost. In practical application, a corresponding solution reaction system is prepared before detection, and the components are more, so that reagent pollution, detection interval pollution, result error and the like caused by frequent operation are easily caused. Therefore, the reagent is inconvenient for high-temperature long-distance transportation, field application and the like, and the corresponding cost is also increased. Meanwhile, the detection method is not popularized in the fields of food safety, medicine and the like at present, particularly in the aspect of rapid detection of water, as a non-standard method, the existing LAMP products only aim at the detection process, and the modes related to sample pretreatment are not mentioned. In addition, a small number of rapid streptococcus faecalis detection kits based on the loop-mediated isothermal amplification technology are available in the market, and dry powder type similar products capable of being transported at normal temperature do not exist.
The difficulties in developing the dry powder LAMP rapid detection kit mainly include the following: 1) the activity of BstDNA polymerase is kept not to be lost basically during the freeze-drying process; 2) designing a proper primer; 3) the color development was not sufficiently pronounced and results were difficult to distinguish.
In order to keep the activity of Bst DNA polymerase, a freeze-drying protective agent is added as a relatively conventional choice, and trehalose is a commonly used freeze-drying protective agent, but the protective effect is relatively limited, and the product quality is relatively difficult to ensure.
Disclosure of Invention
The invention aims to provide a rapid LAMP (loop-mediated isothermal amplification) detection kit for streptococcus faecalis dry powder and a rapid detection method based on the kit.
The technical scheme adopted by the invention is as follows:
a rapid detection kit applied to streptococcus faecalis in water comprises a freeze-drying isothermal amplification agent, a complex solution, positive control dry powder, negative control, a developing solution, a lysis solution and a confining solution, wherein the freeze-drying isothermal amplification agent contains dNTPs, Bst DNA polymerase, an outer primer, an inner primer, a ring primer and a freeze-drying protective agent, and the freeze-drying protective agent consists of trehalose, glycine and bovine serum albumin.
The freeze-dried isothermal amplification agent before freeze-drying consists of: 0.9-1.6 mmol/L dNTPs, 0.3-0.4U/muL BstDNA polymerase, 0.1-0.5 mumol/L outer primer F3/B3, 1.0-2.0 mumol/L inner primer FIP/BIP, 0.5-1.5 mumol/L loop primer LF/LB and freeze-drying composite protective agent containing 3-6% (w/v) trehalose, 0.01-0.1% (w/v) glycine, 0.1-1% bovine serum albumin and the balance of sterile ultrapure water.
The freeze-dried isothermal amplification agent before freeze-drying consists of: 0.9-1.6 mmol/L dNTPs, 0.3-0.4U/mu LBstDNA polymerase, 0.1-0.5 mu mol/L outer primer F3/B3, 1.0-2.0 mu mol/L inner primer FIP/BIP, 0.5-1.5 mu mol/L loop primer LF/LB and freeze-drying composite protective agent contain 4-5% (w/v) trehalose, 0.04-0.07% (w/v) glycine, 0.4-0.7% bovine serum albumin and the balance of sterile ultrapure water.
The redissolution contains 2-9 mmol/L MgSO4、8～12mmol/L KCl、15～20mmol/L Tris-HCl、8～12mmol/L(NH4)2SO40.1-0.3% Triton X-100 and 0.5-1.5 mol/L betaine.
The sequences of the outer primer F3/B3, the inner primer FIP/BIP and the loop primer LF/LB are as follows:
streptococcus faecalis-F3: TGGGCATTTTTCTTTCGG, respectively;
streptococcus faecalis-B3: CATTTAAAAACCAACGTACTTGA, respectively;
streptococcus faecalis-FIP: CAAACGTTGAGTCGCCGTTGCCAATAGTTCGCAACCGA, respectively;
streptococcus faecalis-BIP: GAAGGAGTGACCAACACAGAGACGACTCTCCAGCCAAATCG, respectively;
streptococcus faecalis-LF: TGTTCCGAAATCCGTTTCTATCA, respectively;
streptococcus faecalis-LB: CAAATTGAGCGAGACTATCCGT are provided.
The color development liquid consists of 0.3-1.5 mmol/L of calcein and 2.4-7.2 mmol/L of MnCl2Mixing to obtain the final concentration of calcein of 15-75 mu mol/L and MnCl2The final concentration of (a) is 120-360 [ mu ] mol/L.
The lysate contains: 10 to 20mmol/L Tris-HCl (pH 8.3), 1mmol/L EDTA, 0.3 to 1% (w/v) SDS.
The confining liquid is liquid paraffin.
A method for rapidly detecting streptococcus faecalis in water comprises the following steps:
1) taking a water sample, performing suction filtration, and putting a filter membrane into a streptococcus faecalis enrichment culture medium for enrichment culture;
2) separating microorganisms after the enrichment culture is finished, and extracting nucleic acid after cracking;
3) adding the redissolution into the freeze-dried isothermal amplification agent to completely dissolve the freeze-dried isothermal amplification agent to obtain a reaction solution;
4) adding the extracted sample nucleic acid, positive control and negative control into the reaction solution in different tubes according to isothermal amplification operation, adding color development solution after reaction, and judging the result.
As a further improvement of the rapid detection method, the enrichment culture medium is a sodium azide glucose liquid culture medium.
The invention has the beneficial effects that:
1) the compound freeze-drying protective agent is added in the dry-drying preparation process of the reagent, so that the stability of the reagent is greatly improved, the shelf life of the reagent can be prolonged to 2 years, the normal-temperature transportation is facilitated, the transportation cost is saved, and the using effect is basically not influenced after the reagent is exposed to the room temperature for 72 hours before use.
2) The dry powdered reagent combines partial component reagents in a reaction system according to corresponding proportions, and the reagent is dissolved and used after being dissolved in a re-solution, so that the solution preparation steps are reduced, the use is more convenient and accurate, and the reagent is more suitable for basic site detection;
3) the reaction process can be carried out under an isothermal condition, and special matched reagents and instruments are not needed, so that the detection cost is greatly reduced;
4) the amount of templates required by the reaction is small, the sensitivity is high, and the lowest detection limit can be as low as 9 CFU/Test;
5) the target gene sequence is used for designing and screening three pairs of primers, eight independent regions on the target sequence are specifically identified, high specificity is achieved, the reaction is completed within 35-50 min, and the method is efficient and rapid;
6) by adding the color developing solution mixed by the calcein and the manganese chloride according to a certain proportion before the reaction, the result can be interpreted through the color change of naked eyes or the change of a fluorescence monitoring instrument to a fluorescence spectrum, the color change difference of the negative and positive is obvious, the interpretation is intuitive and convenient, and the aerosol pollution caused by uncovering after the reaction is avoided.
Detailed Description
A rapid detection kit applied to streptococcus faecalis in water comprises a freeze-drying isothermal amplification agent, a complex solution, positive control dry powder, negative control, a developing solution, a lysis solution and a confining solution, wherein the freeze-drying isothermal amplification agent contains dNTPs, Bst DNA polymerase, an outer primer, an inner primer, a ring primer and a freeze-drying protective agent, and the freeze-drying protective agent consists of trehalose, glycine and bovine serum albumin.
The freeze-dried isothermal amplification agent before freeze-drying consists of: 0.9-1.6 mmol/L dNTPs, 0.3-0.4U/muL BstDNA polymerase, 0.1-0.5 mumol/L outer primer F3/B3, 1.0-2.0 mumol/L inner primer FIP/BIP, 0.5-1.5 mumol/L loop primer LF/LB and freeze-drying composite protective agent containing 3-6% (w/v) trehalose, 0.01-0.1% (w/v) glycine, 0.1-1% bovine serum albumin and the balance of sterile ultrapure water.
The freeze-dried isothermal amplification agent before freeze-drying consists of: 0.9-1.6 mmol/L dNTPs, 0.3-0.4U/mu LBstDNA polymerase, 0.1-0.5 mu mol/L outer primer F3/B3, 1.0-2.0 mu mol/L inner primer FIP/BIP, 0.5-1.5 mu mol/L loop primer LF/LB and freeze-drying composite protective agent contain 4-5% (w/v) trehalose, 0.04-0.07% (w/v) glycine, 0.4-0.7% bovine serum albumin and the balance of sterile ultrapure water.
The redissolution contains 2-9 mmol/L MgSO4、8～12mmol/L KCl、15～20mmol/L Tris-HCl、8～12mmol/L(NH4)2SO40.1-0.3% Triton X-100 and 0.5-1.5 mol/L betaine.
The sequences of the outer primer F3/B3, the inner primer FIP/BIP and the loop primer LF/LB are as follows:
streptococcus faecalis-F3: TGGGCATTTTTCTTTCGG, respectively;
streptococcus faecalis-B3: CATTTAAAAACCAACGTACTTGA, respectively;
streptococcus faecalis-FIP: CAAACGTTGAGTCGCCGTTGCCAATAGTTCGCAACCGA, respectively;
streptococcus faecalis-BIP: GAAGGAGTGACCAACACAGAGACGACTCTCCAGCCAAATCG, respectively;
streptococcus faecalis-LF: TGTTCCGAAATCCGTTTCTATCA, respectively;
streptococcus faecalis-LB: CAAATTGAGCGAGACTATCCGT are provided.
The color development liquid consists of 0.3-1.5 mmol/L of calcein and 2.4-7.2 mmol/L of MnCl2Mixing to obtain the final concentration of calcein of 15-75 mu mol/L and MnCl2The final concentration of (a) is 120-360 [ mu ] mol/L.
The lysate contains: 10 to 20mmol/L Tris-HCl (pH 8.3), 1mmol/L EDTA, 0.3 to 1% (w/v) SDS. Other commonly used lysing solutions may also be used.
The confining liquid is liquid paraffin. Other blocking liquids may be used.
A method for rapidly detecting streptococcus faecalis in water comprises the following steps:
5) taking a water sample, performing suction filtration, and putting a filter membrane into a streptococcus faecalis enrichment culture medium for enrichment culture;
6) separating microorganisms after the enrichment culture is finished, and extracting nucleic acid after cracking;
7) adding the redissolution into the freeze-dried isothermal amplification agent to completely dissolve the freeze-dried isothermal amplification agent to obtain a reaction solution;
8) adding the extracted sample nucleic acid, positive control and negative control into the reaction solution in different tubes according to isothermal amplification operation, adding color development solution after reaction, and judging the result.
As a further improvement of the rapid detection method, the enrichment culture medium is a sodium azide glucose liquid culture medium.
The kit is used for rapidly detecting the streptococcus faecalis based on the loop-mediated isothermal amplification technology, specifically identifies eight independent areas on a target sequence by utilizing three pairs of special primers and Bst DNA polymerase with strand displacement activity, realizes the strand displacement amplification reaction under the isothermal condition (60-65 ℃), overcomes the defects of long detection time, easy pollution, high cost and the like of a single-stranded template obtained by a thermal denaturation process in the traditional PCR reaction, and is simple and convenient to operate, low in technical quality requirement on detection personnel and convenient to rapidly screen large samples with low cost. At present, the food microbiology related inspection is mainly performed by using a current method of microorganism separation culture and morphological identification as a main method, combining biochemical identification, serology typing identification and the like at home, the primary identification generally needs 2-3 days, and the final identification report needs 10-15 days, but the detection by adopting the kit only needs 12-14 hours from the collection of samples to the completion of the detection, and the kit adopts calcein color developing solution, so that the result can be interpreted by naked eyes and is more visual and clear.
In the present invention, w/v is a mass-to-volume ratio unless otherwise specified, and percentages in the composition are mass percentages unless otherwise specified.
The technical scheme of the invention is further explained by combining experiments.
Screening of Streptococcus faecalis LAMP primers
The inventors designed 6 sets of primers, each as follows:
TABLE 1 LAMP primer sequences of different Streptococcus faecalis
Note: in the table, 6 primers ACE-F3, ACE-B3, ACE-FIP, ACE-BIP, ACE-LF and ACE-LB in the group 1 are numbered 1-6 in sequence, 6 primers ACE-F3, ACE-B3, ACE-FIP, ACE-BIP, ACE-LF and ACE-LB in the group 2 are numbered 7-12 in sequence, and the numbers of other groups are similar.
The optimal 6 groups of primer sequence combinations are adopted, all the primers contain loop primers, the reaction products are observed through agarose gel electrophoresis through unified and optimized reaction system tests, the primer 1 only needs 35min to have an obvious amplification band, the primers 2 and 3 are about 45min, and the primers 4, 5 and 6 are about 50 min.
Preparation of the kit:
primer: primer set 1 in table 1.
Freeze-drying isothermal amplification agent: the composition before lyophilization is as in table 2.
TABLE 2 composition of different lyophilized test agents
The preparation method of the freeze-drying detection agent comprises the following steps: and mixing the related component mixed solution to be subjected to freeze-drying treatment in an aseptic environment, packaging in a container, and drying according to a conventional freeze-drying procedure to obtain the freeze-dried isothermal amplification agent.
Compounding the solution: the composition of the composite material is as follows,
| components | Final concentration |
| KCl | 8mmol/L |
| Tris-HCl,，pH 8.8 | 16mmol/L |
| (NH4)2SO4 | 9mmol/L |
| MgSO4 | 8mmol/L |
| Triton X-100 | 0.2％ |
| Betaine | 1.2mol/L |
| Water (W) | Balance of |
The components of the double solution are mixed under a sterile environment and placed in a container.
Positive control dry powder: to the purified genomic DNA solutions of Streptococcus faecalis, 3% (w/v) trehalose was added, and the resulting solutions were separately dispensed into containers, and the positive control dry powders were prepared by the same lyophilization procedure as described above.
Color development liquid: consists of 0.3mmol/L of calcein and 7.2mmol/L of MnCl2Mixing at equal volume, final concentration of calcein is 15 μmol/L, and MnCl is obtained2Was placed in a container at a final concentration of 360. mu. mol/L.
Sealing liquid: liquid paraffin is packed in a sterile way and is placed in a container.
Lysis solution: containing 10 to 20mmol/L Tris-HCl (pH 8.3), 1mmol/L EDTA, 0.3 to 1% (w/v) SDS, and placing in a container.
Stability test
The freeze-dried isothermal amplification agents of examples 1 to 6 were respectively taken for stability experiments, stored at 4 ℃, and the reaction effect of the product was verified by using the kit every 3 months, and the results are shown in table 3:
TABLE 3 stability of different lyophilized isothermal amplification Agents
The composite freeze-drying protective agent of the example 1 is adopted for carrying out freeze-drying on the reaction reagent, after liquid nitrogen pre-freezing and freeze-drying, the reagent freeze-dried powder can keep higher stability, the longest quality guarantee period is 21-24 months and is far higher than the quality guarantee period of 12 months of products of the same type, the inspection limit of the reagent freeze-dried powder is slightly reduced when the quality guarantee period of 24 months is up to about 65CFU/TEST, and the detection requirement can be met. Except that the freeze-dried powder of the single protective agent only containing 5 percent of trehalose (w/v) has moisture absorption, the rest composite protective agents keep good shapes within respective shelf life ranges after being freeze-dried into powdery preparations, and collapse and hollow phenomena do not occur.
Comparison of minimum check Limit and sensitivity
1) Pure bacterial colonies of Streptococcus faecalis (ATCC29212) were picked up with sterile inoculating loops and diluted with sterile physiological saline in a gradient of 100，101，102，103，104，105，106，107，108) And respectively taking 100 mu L of each diluted bacterium liquid to be spirally inoculated to a TSA plate for culture and counting
2) Respectively taking 100 mu L of the diluted bacterial liquid, centrifuging for 5min at 6000r/min, removing the supernatant, adding 10 mu L of lysate to fully suspend the thallus precipitate, heating and cracking the thallus at 99 ℃ for 10min, centrifuging for 15min at 12000r/min after the thermal cracking is finished, and taking the supernatant as a crude thallus template gene;
3) the crude DNA is used as a template to carry out PCR and LAMP reaction, and the streptococcus faecalis PCR primer is as follows:
PF-5’-GGGCATTTTTCTTTCGGGATTA-3’(SEQ ID NO：37)
PR-5’-CCGCTTGCCTCGCCTTCTA-3’(SEQ ID NO：38)
4) the PCR amplification conditions were: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 56 deg.C for 30s, extension at 72 deg.C for 10min, and 35 cycles
5) Performing LAMP reaction by taking the crude DNA as a template, taking out a freeze-dried detection reaction tube, adding 20 mu L of the compound solution into each tube respectively, adding 2.5 mu L of the crude DNA template corresponding to each diluted bacterium solution and 2.5 mu L of sterile ultrapure water when the dry powder in the tube is completely dissolved, fully mixing uniformly, adding 20 mu L of tube sealing solution, tightly covering, and performing isothermal reaction at 64 ℃ for 50 min;
6) the PCR and LAMP amplification products are interpreted by agarose gel electrophoresis, and the plate colony count determines the lowest check limit.
As a result: agarose gel electrophoresis results show that the minimum detection limit of PCR of streptococcus faecalis is 105At fold-dilution, the LAMP minimum test limit was 106And (4) performing fold dilution. The corresponding colony count is determined by GB 4789.2-2010 food microbiology test colony count standard, and the fecal streptococcus is 106The fold dilution is 9CFU, and the LAMP detection sensitivity is much higher than that of PCR.
Detection of pure bacteria
1) Sample treatment:
when the method is used for screening and identifying pure bacteria, a single colony semi-ring is picked by using an inoculating loop, transferred to a sterile PCR tube containing 30 mu L of lysate, fully and uniformly mixed, and thermally cracked for 10min in a water bath or a metal bath at 99 ℃; transferring the sample to a centrifugal machine for centrifugation at 12000r/min for 10min after the cracking is finished, taking the supernatant, namely the crude genomic DNA of the sample, and selecting strains shown in table 4:
TABLE 4
2) Isothermal amplification reaction
Taking out the freeze-dried detection reaction tube, respectively adding 20 mu L of the compound solution into each tube, respectively adding 2.5 mu L of the DNA template of the crude extraction of the various bacteria when the dry powder in the tube is completely dissolved, wherein 1 tube is taken as a negative control, 1 tube is taken as a positive control, respectively adding 2.5 mu L of the corresponding control reagent, respectively adding 2.5 mu L of the developing solution into all the tubes, fully and uniformly mixing, adding 20 mu L of the sealing solution, tightly covering, carrying out isothermal amplification by a Biometra professional PCR instrument, and carrying out isothermal reaction at 64 ℃ for 50 min;
3) interpretation after reaction
And after the reaction is finished, comparing the color change before and after the reaction, if the color change shows fluorescent green, the color change is positive, if the color change shows light orange, the color change shows negative, if the result of the negative and positive control reaction tube does not accord with the condition, the detection result is invalid, the detection is required to be carried out again, and the reaction tube cover is not required to be opened in the whole observation process. The results are shown in Table 5
TABLE 5
As a result, through the detection of the invention, in the rapid detection of the selected streptococcus faecalis and non-streptococcus faecalis, the standard strain and the isolate selected from the streptococcus faecalis have obvious fluorescent green in a detection system, and the color of the selected non-streptococcus faecalis is light orange without color change before and after reaction, so that the invention has excellent specificity and can effectively detect the streptococcus faecalis.
The detection method of the streptococcus faecalis in the packaged drinking water comprises the following steps:
1) sample treatment: and (3) taking 250mL of a water sample to be detected, carrying out suction filtration, and then putting the filter membrane into 100mL of a streptococcus faecalis enrichment medium (sodium azide glucose liquid medium) for enrichment for 8-12h at the temperature of 37 +/-1 ℃. Absorbing and increasing bacteria liquid from 1mL to 1.5mL in a sterile centrifuge tube, centrifuging at 6000r/min for 5min, discarding supernatant, adding 30 mu L of lysate, fully suspending bacteria, flicking the tube wall to eliminate bubbles, heating at 99 ℃ for 10min, centrifuging at 12000r/min for 15min, and obtaining supernatant which is crude DNA;
2) isothermal amplification reaction: taking out the freeze-dried detection reaction tube, respectively adding 20 mu L of the compound solution into each tube, respectively adding 2.5 mu L of the DNA template obtained by crude extraction of each sample when the dry powder in the tube is completely dissolved, respectively taking 1 tube as a negative control and 1 tube as a positive control, respectively adding 2.5 mu L of corresponding control reagent, respectively adding 2.5 mu L of developing solution into all the tubes, fully and uniformly mixing, adding 20 mu L of sealing solution, tightly covering, carrying out isothermal amplification by a Biometra professional PCR instrument, and carrying out isothermal reaction at 64 ℃ for 45 min;
3) interpretation after reaction: after the reaction is finished, the solution in the reaction tube is observed to change from light orange before detection to fluorescent green, the change is the same as that of the positive control tube, the streptococcus faecalis is detected, and otherwise, no color change indicates no detection.
SEQUENCE LISTING
<110> Kyork Biotechnology Ltd of Guangdong
Guangdong Huanji microbial science and technology Co Ltd
<120> Streptococcus faecalis dry powdering LAMP (loop-mediated isothermal amplification) rapid detection kit and use method thereof
<130>ACE
<160>38
<170>PatentIn version 3.5
<210>1
<211>18
<212>DNA
<213> Artificial primer
<400>1
tgggcatttt tctttcgg 18
<210>2
<211>23
<212>DNA
<213> Artificial primer
<400>2
catttaaaaa ccaacgtact tga 23
<210>3
<211>38
<212>DNA
<213> Artificial primer
<400>3
caaacgttga gtcgccgttg ccaatagttc gcaaccga 38
<210>4
<211>41
<212>DNA
<213> Artificial primer
<400>4
gaaggagtga ccaacacaga gacgactctc cagccaaatc g 41
<210>5
<211>23
<212>DNA
<213> Artificial primer
<400>5
tgttccgaaa tccgtttcta tca 23
<210>6
<211>22
<212>DNA
<213> Artificial primer
<400>6
caaattgagc gagactatcc gt 22
<210>7
<211>22
<212>DNA
<213> Artificial primer
<400>7
ttacataatg tgaatgggca tt 22
<210>8
<211>18
<212>DNA
<213> Artificial primer
<400>8
gactctccag ccaaatcg 18
<210>9
<211>46
<212>DNA
<213> Artificial primer
<400>9
tccgaaatcc gtttctatca cattctcttt cgggattaaa acgctt 46
<210>10
<211>38
<212>DNA
<213> Artificial primer
<400>10
caacggcgac tcaacgtttg acggatagtc tcgctcaa 38
<210>11
<211>20
<212>DNA
<213> Artificial primer
<400>11
ggttgcgaac taattggtga 20
<210>12
<211>22
<212>DNA
<213> Artificial primer
<400>12
acgattgaag gagtgaccaa ca 22
<210>13
<211>19
<212>DNA
<213> Artificial primer
<400>13
ggcatttttc tttcgggat 19
<210>14
<211>18
<212>DNA
<213> Artificial primer
<400>14
gactctccag ccaaatcg 18
<210>15
<211>41
<212>DNA
<213> Artificial primer
<400>15
cgttgctgtt ccgaaatccg acgcttatca ccaatagttc g 41
<210>16
<211>43
<212>DNA
<213> Artificial primer
<400>16
gcgactcaac gtttgacgat ataaaaaaac ggatagtctc gct 43
<210>17
<211>19
<212>DNA
<213> Artificial primer
<400>17
tttctatcac attcggttg 19
<210>18
<211>21
<212>DNA
<213> Artificial primer
<400>18
tgaaggagtg accaacacag a 21
<210>19
<211>18
<212>DNA
<213> Artificial primer
<400>19
tgggcatttt tctttcgg 18
<210>20
<211>23
<212>DNA
<213> Artificial primer
<400>20
catttaaaaa ccaacgtact tga 23
<210>21
<211>38
<212>DNA
<213> Artificial primer
<400>21
caaacgttga gtcgccgttg ccaatagttc gcaaccga 38
<210>22
<211>41
<212>DNA
<213> Artificial primer
<400>22
gaaggagtga ccaacacaga gacgactctc cagccaaatc g 41
<210>23
<211>22
<212>DNA
<213> Artificial primer
<400>23
tgttccgaaa tccgtttcta tc 22
<210>24
<211>19
<212>DNA
<213> Artificial primer
<400>24
tggccaaatt gagcgagac 19
<210>25
<211>18
<212>DNA
<213> Artificial primer
<400>25
caccaatagt tcgcaacc 18
<210>26
<211>23
<212>DNA
<213> Artificial primer
<400>26
tcacatttaa aaaccaacgt act 23
<210>27
<211>46
<212>DNA
<213> Artificial primer
<400>27
actccttcaa tcgtcaaacg ttggaatgtg atagaaacgg atttcg46
<210>28
<211>38
<212>DNA
<213> Artificial primer
<400>28
gaccaacaca gagactggcc gatttgactc tccagcca 38
<210>29
<211>17
<212>DNA
<213> Artificial primer
<400>29
agtcgccgtt gctgttc 17
<210>30
<211>21
<212>DNA
<213> Artificial primer
<400>30
attgagcgag actatccgtt t 21
<210>31
<211>18
<212>DNA
<213> Artificial primer
<400>31
ggatttcgga acagcaac 18
<210>32
<211>22
<212>DNA
<213> Artificial primer
<400>32
tgaaatatct tctgtgacat cg 22
<210>33
<211>38
<212>DNA
<213> Artificial primer
<400>33
ctcgctcaat ttggccagtc cgactcaacg tttgacga 38
<210>34
<211>45
<212>DNA
<213> Artificial primer
<400>34
taaagtaggc gatttggctg gatgaggttc acatttaaaa accaa 45
<210>35
<211>21
<212>DNA
<213> Artificial primer
<400>35
tctgtgttgg tcactccttc a 21
<210>36
<211>17
<212>DNA
<213> Artificial primer
<400>36
gagtcaaatc aagtacg 17
<210>37
<211>22
<212>DNA
<213> Artificial sequence
<400>37
gggcattttt ctttcgggat ta 22
<210>38
<211>19
<212>DNA
<213> Artificial sequence
<400>38
ccgcttgcct cgccttcta 19
Claims (8)
1. A rapid detection kit applied to streptococcus faecalis in water comprises a freeze-dried isothermal amplification agent, a complex solution, positive control dry powder, negative control, a chromogenic solution, a lysis solution and a confining solution, wherein the freeze-dried isothermal amplification agent contains dNTPs,BstDNA polymerase, outer primer, inner primer, loop primer and freeze-drying protective agent, which is characterized in that: the freeze-drying protective agent consists of trehalose, glycine and bovine serum albumin;
the freeze-dried isothermal amplification agent comprises the following components before freeze-drying: 0.9 to 1.6mmol/L dNTPs, 0.3 to 0.4U/μ LBstDNA polymerase, 0.1-0.5 mu mol/L outer primer F3/B3, 1.0-2.0 mu mol/L inner primer FIP/BIP, 0.5-1.5 mu mol/L loop primer LF/LB and freeze-drying composite protective agent containing 3% (w/v) trehalose, 0.01-0.1% (w/v) glycine, 0.1-1% bovine serum albumin and the balance of sterile ultrapure water.
2. The rapid detection kit according to claim 1, characterized in that: the re-solution contains 2-9 mmol/LMgSO4、8～12 mmol/L KCl、15～20 mmol/L Tris-HCl、8～12 mmol/L (NH4)2SO40.1-0.3% Triton X-100 and 0.5-1.5 mol/L betaine.
3. The rapid detection kit according to claim 1, characterized in that: the sequences of the outer primer F3/B3, the inner primer FIP/BIP and the loop primer LF/LB are as follows:
streptococcus faecalis-F3: tgggcatttttctttcgg, respectively;
streptococcus faecalis-B3: catttaaaaaccaacgtacttga, respectively;
streptococcus faecalis-FIP: caaacgttgagtcgccgttgccaatagttcgcaaccga, respectively;
streptococcus faecalis-BIP: gaaggagtgaccaacacagagacgactctccagccaaatcg, respectively;
streptococcus faecalis-LF: tgttccgaaatccgtttctatca, respectively;
streptococcus faecalis-LB: caaattgagcgagactatccgt are provided.
4. The rapid test kit according to claim 1, characterized in that: the color development liquid consists of 0.3-1.5 mmol/L of calcein and 2.4-7.2 mmol/L of MnCl2Mixing to obtain the final concentration of calcein of 15-75 mu mol/L and MnCl2The final concentration of (a) is 120-360 [ mu ] mol/L.
5. The rapid test kit according to claim 1, characterized in that: the lysate contains: 10-20 mmol/L Tris-HCl (pH8.3), 1mmol/L EDTA, 0.3-1% (w/v) SDS.
6. The rapid test kit according to claim 1, characterized in that: the confining liquid is liquid paraffin.
7. A method for rapidly detecting streptococcus faecalis in water comprises the following steps:
1) taking a water sample, performing suction filtration, and putting a filter membrane into a streptococcus faecalis enrichment culture medium for enrichment culture;
2) separating microorganisms after the enrichment culture is finished, and extracting nucleic acid after cracking;
3) adding the redissolution into the freeze-dried isothermal amplification agent to completely dissolve the freeze-dried isothermal amplification agent to obtain a reaction solution;
4) adding the extracted sample nucleic acid, positive control and negative control into the reaction solution in different tubes according to isothermal amplification operation, adding color development solution after reaction, and judging the result;
the rapid detection method is realized by using the rapid detection kit of any one of claims 1 to 6.
8. The rapid detection method according to claim 7, wherein: the enrichment culture medium is sodium azide glucose liquid culture medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611263571.XA CN106544444B (en) | 2016-12-30 | 2016-12-30 | LAMP (loop-mediated isothermal amplification) rapid detection kit for streptococcus faecalis dry pulverization and use method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611263571.XA CN106544444B (en) | 2016-12-30 | 2016-12-30 | LAMP (loop-mediated isothermal amplification) rapid detection kit for streptococcus faecalis dry pulverization and use method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106544444A CN106544444A (en) | 2017-03-29 |
| CN106544444B true CN106544444B (en) | 2020-05-05 |
Family
ID=58397720
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611263571.XA Active CN106544444B (en) | 2016-12-30 | 2016-12-30 | LAMP (loop-mediated isothermal amplification) rapid detection kit for streptococcus faecalis dry pulverization and use method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106544444B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108285925A (en) * | 2017-12-29 | 2018-07-17 | 广东环凯微生物科技有限公司 | A kind of rugged Cronobacter sakazakii quick detection kit of slope |
| CN108277289A (en) * | 2017-12-29 | 2018-07-13 | 广东环凯生物科技有限公司 | Escherichia coli O157:The dry powdered LAMP quick detection kits of H7 |
| CN107988401A (en) * | 2017-12-29 | 2018-05-04 | 广东环凯微生物科技有限公司 | The dry powdered LAMP quick detection kits of salmonella |
| US11453907B2 (en) | 2020-03-23 | 2022-09-27 | The Broad Institute, Inc. | Crispr effector system based coronavirus diagnostics |
| CN114525324A (en) * | 2022-03-31 | 2022-05-24 | 河南冠宇仪器有限公司 | LAMP (loop-mediated isothermal amplification) detection primer group and kit for Burkholderia gladioli and preparation method of freeze-dried microspheres |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103014156A (en) * | 2012-11-30 | 2013-04-03 | 广东省微生物研究所 | Loop mediated isothermal amplification detection primer group, detection method and kit for enterococcus faecalis |
| CN103911367A (en) * | 2014-03-20 | 2014-07-09 | 中国农业大学 | Freeze-drying protective agent of nucleic acid amplification reaction reagents and freeze-drying method |
| CN105950778A (en) * | 2016-07-20 | 2016-09-21 | 中国疾病预防控制中心传染病预防控制所 | Nucleotide sequence for detecting enterococcus faecalis and staphylococcus aureus with MERT-LAMP technology |
-
2016
- 2016-12-30 CN CN201611263571.XA patent/CN106544444B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103014156A (en) * | 2012-11-30 | 2013-04-03 | 广东省微生物研究所 | Loop mediated isothermal amplification detection primer group, detection method and kit for enterococcus faecalis |
| CN103911367A (en) * | 2014-03-20 | 2014-07-09 | 中国农业大学 | Freeze-drying protective agent of nucleic acid amplification reaction reagents and freeze-drying method |
| CN105950778A (en) * | 2016-07-20 | 2016-09-21 | 中国疾病预防控制中心传染病预防控制所 | Nucleotide sequence for detecting enterococcus faecalis and staphylococcus aureus with MERT-LAMP technology |
Non-Patent Citations (3)
| Title |
|---|
| Loop-mediated isothermal amplification method for the rapid detection of Enterococcus faecalis in infected root canals;H. Kato等;《Oral Microbiology Immunology》;20071231;第22卷;摘要，表1 * |
| 消化内科患者感染粪肠球菌毒力基因检测及其耐药性分析;梅懿文等;《中国病原生物学杂志》;20150430;第10卷(第4期);第355-358、367页 * |
| 湖南省猪源粪肠球菌毒力基因的检测及部分表型的测定;崔成等;《中国兽医科学》;20141231;第44卷(第1期);第39-44页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106544444A (en) | 2017-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106544443B (en) | Pseudomonas aeruginosa dry efflorescence LAMP (loop-mediated isothermal amplification) rapid detection kit and use method thereof | |
| CN106498087B (en) | Clostridium perfringens dry pulverization LAMP (loop-mediated isothermal amplification) rapid detection kit and use method thereof | |
| CN106544444B (en) | LAMP (loop-mediated isothermal amplification) rapid detection kit for streptococcus faecalis dry pulverization and use method thereof | |
| CN103320434A (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN103361429A (en) | LAMP detection primer, kit and detection method for staphylococcus aureus containing internal standard | |
| CN104263838B (en) | Listeria monocytogenes LAMP-LFD detection kit and detection method thereof | |
| CN101942508B (en) | Escherichia coli detection kit and use method thereof | |
| CN101565753B (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN101555529B (en) | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof | |
| CN108277290A (en) | The dry powdered LAMP quick detection kits of staphylococcus aureus | |
| CN111690551A (en) | Separation, purification, culture and identification method for brucella | |
| CA2718214A1 (en) | Detection of bacteria belonging to the genus campylobacter by targeting cytolethal distending toxin | |
| CN108315451B (en) | Primer and probe for detecting clostridium perfringens and application thereof | |
| CN102251044A (en) | Enterorrhagia colibacillus stx1 gene detection kit and application method thereof | |
| CN115873930A (en) | Double-target-point drug-resistant salmonella detection method based on RPA-Cas12a | |
| CN101979660B (en) | Brucella detection kit and using method thereof | |
| KR100984785B1 (en) | Primer set and probe for detecting Salmonella typhimurium | |
| WO2017073753A1 (en) | Method for measuring ability to produce equol | |
| CN112301158B (en) | RDA method and kit for rapidly detecting Classical Swine Fever Virus (CSFV) | |
| CN104862399B (en) | Detect the PCR method and kit containing amplification interior label of bacillus cereus in food | |
| Tharannum et al. | Molecular confirmation of the presence of coliforms in drinking water using polymerase chain reaction | |
| CN102719548A (en) | Kit for detecting brucella and use method thereof | |
| CN101824482A (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| CN112301156A (en) | RDA method and kit for rapidly detecting human adenovirus | |
| CN114317790B (en) | Dual-fluorescence quantitative PCR detection method and kit for two pathogenic bacteria in pre-packaged drinking water |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |