CN101555529B - Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof - Google Patents
Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof Download PDFInfo
- Publication number
- CN101555529B CN101555529B CN200910138319XA CN200910138319A CN101555529B CN 101555529 B CN101555529 B CN 101555529B CN 200910138319X A CN200910138319X A CN 200910138319XA CN 200910138319 A CN200910138319 A CN 200910138319A CN 101555529 B CN101555529 B CN 101555529B
- Authority
- CN
- China
- Prior art keywords
- diagnostic kit
- listeria monocytogenes
- rapid diagnostic
- reaction solution
- liquid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and a testing method thereof; the diagnostic kit consists of two pairs of primers, a DNA polymerase, a reaction solution, a sample pretreatment solution, a color developing agent and a positive control solution which are respectively put in containers; the gene rapid diagnostic kit applies six sections and four primers to judge whether a target substance exists according to whether amplification occurs, thus having high specificity. The gene rapid diagnostic kit is rapid and highly effective, has high sensitivity, only needs a constant temperature for amplification and requires no special agents or equipment. The gene rapid diagnostic kit conducts diagnosis conveniently: pyrophosphate groups released by dNTP are bonded with mg2+ in the reaction solution to generate a sedimentary by product, i.e. magnesium pyrophosphate which can be observed and judged visually; after the color developing agent is added, the color for a positive result is significantly different from the color for a negative result, thus being more obvious and reliable.
Description
Technical field
The present invention relates to biological detection reagent, be specifically related to a kind of Listeria monocytogenes rapid diagnostic kit and detection method thereof based on loop-mediated isothermal amplification technique.
Background technology
At present listeria monocytogenes there is multiple detection method; From being accredited as main national standard (GB/T4789.7-2003) with pathogenic micro-organism isolation identification, morphology evaluation and automatic biochemical; Immunology detection technology, nucleic probe, polymerase chain reaction (PCR) technological equimolecular biological detection method [food safety detection and modern biotechnology to differential protein; Chemical Industry Press, 2004].Wherein the cause of disease detection of nucleic acids all improves a lot at aspects such as rapidity, security, accuracy and susceptibilitys; These new technologies are attempted to break through microbiologies such as traditional morphological, biochemical reaction and are detected old model; Need not separate purification to mikrobe; And directly its gene and gene product are carried out rapid detection with the enrichment liquid of sample or sample, and combine with Protocols in Molecular Biology and information biology means, to accurately, fast, the direction of sensitivity and robotization develops.
With polymerase chain reaction (PCR) technology is that the cause of disease nucleic acid detection technique of representative also exists some problems in practical application; Like the special instrument of common polymerase chain reaction (PCR) Technology Need, and there are easy crossed contamination and the loaded down with trivial details shortcoming of operating process.And fluorescence real-time quantitative polymerase chain reaction (real time PCR) and simplified operating process though technology has solved the problem of crossed contamination preferably, needs more complicated quantitatively determined instrument, therefore is not suitable for field quick detection.And the cost of fluorescent probe is higher in the real-time quantitative polymerase chain reaction PCR technology, has strengthened the difficulty of applying.The immunology detection technology is fast and convenient with low cost, but requires the monoclonal antibody of high quality high stability, otherwise because of accuracy is not enough, can only be the auxiliary detection means at present.So in time use the newest fruits of biotech development significant to satisfying improving constantly of pathogenic micro-organism detection requirement.Wherein isothermal duplication (Isothermal Amplification) nucleic acid Fast Detection Technique is the rapid progress on the cause of disease nucleic acid detection technique; The loop-mediated isothermal amplification technique of at present having set up (LAMP) has a lot of meliority, and does not also see that useful loop-mediated isothermal amplification technique detects monokaryon hyperplasia Liszt's gene quick diagnosis kit at present.
Summary of the invention
The objective of the invention is deficiency to prior art; Provide a kind of detect cost low, easy to use, detect rapidly and efficiently, highly sensitive Listeria monocytogenes rapid diagnostic kit based on loop-mediated isothermal amplification technique, this test kit is based on loop-mediated isothermal amplification technique and detects listeria monocytogenes.
Another object of the present invention provides the detection method of above-mentioned Listeria monocytogenes rapid diagnostic kit.
Above-mentioned purpose of the present invention is achieved through following technical scheme:
One, Listeria monocytogenes rapid diagnostic kit of the present invention; Form by two pairs of primers, Bst archaeal dna polymerase, reaction solution, stable liquid, sample pretreatment liquid, colour developing liquid and positive control solution; More than six kinds of liquid place container respectively, wherein:
Said two pairs of primers are:
Outer primer F3:ACAAGACTTCACCAATCCA is shown in SEQ ID NO:1;
Outer primer B3:GTCTTTTAAGTGGAGTAAACCTT is shown in SEQ ID NO:2;
Inner primer FIP:TAAGTCTCTTTGCAATTGACCGACTTTTACGTGTACACAGAAAAGCG is shown in SEQ ID NO:3;
Inner primer BIP:CCTGTGCCAAAGCATTTTTACATTTTTTAGGCAAGTCATCTTGTTCG is shown in SEQ ID NO:4;
Above-mentioned reaction solution contains 1.6～2mmol/L dNTP, 20～25mmol/L Tris-HCl, 10～12.5mmol/L Repone K, 10～12.5mmol/L ammonium sulfate, 8～10mmol/L sal epsom, 0.1～0.125%TritonX-100,0.8～1mol/L trimethyl-glycine, each 1.6～2mol/L of inner primer FIP/BIP and each 0.2～0.25mol/L of outer primer F3/B3.Preferred ratio is: reaction solution contains 2mmol/L dNTP, 25mmol/L Tris-Cl, 12.5mmol/L Repone K, 12.5mmol/L ammonium sulfate, 10mmol/L sal epsom, 0.125%TritonX-100,1mol/L trimethyl-glycine, each 2mol/L of inner primer FIP/BIP and each 0.25mol/L of outer primer F3/B3.(0.1～0.125%TritonX-1 00 is: the volume percent that Triton X-100 accounts for reaction solution is 0.1～0.125%)
Above-mentioned sample pretreatment liquid contains Tris-HCl, 1～2mmol/L EDTA and the 1～1.2%Triton X-100 of 10～20mmol/L pH 8.0.Preferred ratio is: sample pretreatment liquid contains Tris-HCl, 2mmol/L EDTA and the 1.2%TritonX-100 of 20mmol/L pH 8.0.(1～1.2%Triton X-100 is: the volume percent that Triton X-100 accounts for sample pretreatment liquid is 1～1.2%)
Above-mentioned positive control is Listeria monocytogenes group DNA.
Above-mentioned colour developing liquid is preferably SYBR Green I.
Aforementioned stable liquid is preferably Yellow Protopet 2A.
Two, the production technique of gene quick diagnosis kit of the present invention
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, reaction solution is aseptic subpackaged, and confirm the quality inspection of sampling with carrying out concentration according to experiment;
3, stable liquid is aseptic subpackaged, the sampling quality inspection;
4, with the positive control sample preparations, packing, sampling quality inspection;
5, assembling test kit.
Three, the detection method of gene quick diagnosis kit of the present invention
1, sample preparation:
Testing sample is centrifugal in centrifuge tube, remove supernatant, add sample pretreatment liquid in the deposition and mix, cooled on ice after the boiling water bath deactivation, behind the high speed centrifugation, supernatant is sample template DNA for use;
2, loop-mediated isothermal amplification technique reaction process
In reaction tubes, add reaction solution 38～40 volume %, Bst archaeal dna polymerase 0.9～1.8 volume %, stable liquid 52～54.5 volume %, sample template DNA 4.5～9 volume %, 63～65 ℃ of isothermal reaction 45～90min.Said volume percent is meant the volume percent that accounts for four component TVs.
3, post-reaction treatment
In above-mentioned reaction tubes and positive controls, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative.
The present invention is said based on loop-mediated isothermal amplification technique (loop-mediated isothermal amplication of DNA; Abbreviation LAMP) method of rapid detection listeria monocytogenes; It is the special inside and outside primer (being inner primer FIP/BIP and outer primer F3/B3) of two couples that utilizes the Bst archaeal dna polymerase and design according to target-gene sequence; Six isolated areas on the specific recognition target sequence; Start the endless chain replacement(metathesis)reaction, start complementary strand in target DNA district synthetic, and result's complementary sequence on same chain goes round and begins again and is formed with the very stem of polycyclic Cauliflower structure-circular DNA mixture.In the LAMP reaction process, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product---magnesium pyrophosphate milky white precipitate, can be through the visual inspection result of determination.The LAMP reaction is under constant temperature (63～65 ℃) condition, to accomplish in 45～90 minutes.This comparatively gentle temperature condition and do not have temperature cycle that required instrument is oversimplified, overcome conventional P CR inherent detection time long, pollute easily and detect shortcoming such as cost height.In addition, this detection method is lower to testing staff's technical quality requirement, and actually operating is very easy, does not need special reagent and plant and instrument, helps setting up rapid screening system with low cost.The LAMP method is a kind of gene amplification method of easy, quick, high degree of specificity.Constant temperature gene amplification technology and round pcr (comprising the fluorescence real-time quantitative PCR technology) are compared; Can find and technology on methodology indexs such as sensitivity, specificity and sensing range, to be equivalent to or to be superior to round pcr; And do not rely on any special plant and instrument and can realize on-the-spot high-throughput rapid detection, and detect cost far below fluorescent quantitative PCR technique.Domestic do not have the test kit of this respect to sell at present as yet.Be accredited as passing method main, that combine biochemical analysis and serological typing to identify with mikrobe separation and Culture and morphology in the national standard at present, preliminary evaluation needs 2～3 days, accomplishes probation report and needs 10～15 days; Adopt gene quick diagnosis kit of the present invention only to need 2 hours.And, having added colour developing liquid in the reaction solution of the present invention, qualification result is visual and clear more.
Compared with prior art, the present invention has following beneficial effect: 1. gene quick diagnosis kit of the present invention only needs just ability amplified reaction of a steady temperature, does not need special reagent and equipment, and it is low to detect cost; 2. gene quick diagnosis kit of the present invention is used six sections, four primers, and whether the existence that just can judge target substance according to whether increasing to be, so has high specific; 3. gene quick diagnosis kit of the present invention amplification fast and efficient can accomplish amplification less than 1 hour, and productive rate is high; 4. gene quick diagnosis kit of the present invention is highly sensitive, and amplification template only needs 10 copies or still less; 5. gene quick diagnosis kit of the present invention is identified easy, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product-magnesium pyrophosphate deposition, can identify through visual inspection, and after adding colour developing liquid, yin and yang attribute colour development difference as a result is remarkable, the checking rate is high, and is more obviously reliable.
Description of drawings
Fig. 1 is bacterium and DNA of bacteria mixed solution LAMP figure as a result;
Among Fig. 1,1 positive contrast; 2 negative contrasts; 3-9 is respectively: listeria innocua, sheep listeria spp, this listeria spp of Weir, Ge Shi listeria spp, Salmonellas, Escherichia coli O 157, streptococcus aureus; 10-30 is 21 routine Listeria monocytogenes; 31 is the DNA of bacteria mixed solution.
Fig. 2 is for singly increasing the different weaker concn LAMP of listeria spp detected result;
Among Fig. 2,1 is bacterium stoste; 2-11 is respectively 10
1-10
10Extension rate; 12 positive contrasts; 13 negative contrasts.
Fig. 3 is for singly increasing the different weaker concn LAMP of listeria spp detected result;
Among Fig. 3, M is Marker; 1 positive contrast; 2 negative contrasts; 3 is bacterium stoste, and 4-13 is respectively 10
1-10
10Extension rate.
Embodiment
The preparation of embodiment 1 test kit
(1) synthesize oligomerization picodna primer by following sequence through dna synthesizer:
Outer primer F3:ACAAGACTTCACCAATCCA is shown in SEQ ID NO:1;
Outer primer B3:GTCTTTTAAGTGGAGTAAACCTT is shown in SEQ ID NO:2;
Inner primer FIP:TAAGTCTCTTTGCAATTGACCGACTTTTACGTGTACACAGAAAAGCG is shown in SEQ ID NO:3;
Inner primer BIP:CCTGTGCCAAAGCATTTTTACATTTTTTAGGCAAGTCATCTTGTTCG is shown in SEQ ID NO:4;
(2) purchase archaeal dna polymerase: the Bst archaeal dna polymerase places container.
(3) preparation reaction solution: reaction solution contains 2mmol/LdNTP, 25mmol/L Tris-Cl, 12.5mmol/L Repone K, 12.5mmol/L ammonium sulfate, 10mmol/L sal epsom, 0.125 volume %TritonX-100,1mol/L trimethyl-glycine, each 2mol/L of inner primer FIP/BIP and each 0.25mol/L of outer primer F3/B3, places container.
(4) preparation sample pretreatment liquid: sample pretreatment liquid contains 20mmol/L Tris-HCl (pH 8.0), 2mmol/L EDTA and 1.2 volume %Triton X-100, places container.
(5) purchase stable liquid: Yellow Protopet 2A places container.
(6) purchase colour developing liquid: SYBR Green I places container.
(7) extract positive control: Listeria monocytogenes group DNA places container.
(8) above-mentioned 7 containers are dressed up test kit, encapsulation.
Preparation technology is summarized as follows:
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, reaction solution is aseptic subpackaged, and confirm the quality inspection of sampling with carrying out concentration according to experiment;
3, with the stable liquid packing, the sampling quality inspection;
4, with the positive control sample preparations, packing, sampling quality inspection;
5, assembling test kit.
The preparation of embodiment 2 test kits
The prescription of reaction solution is: reaction solution contains 1.8mmol/LdNTP, 20mmol/LTris-Cl, 10mmol/L Repone K, 10mmol/L ammonium sulfate, 8mmol/L sal epsom, 0.1 volume %TritonX-100,0.8mol/L trimethyl-glycine, each 1.6mol/L of inner primer FIP/BIP and each 0.2mol/L of outer primer F3/B3.
The prescription of sample pretreatment liquid is: sample pretreatment liquid contains 10mmol/L Tris-HCl (pH 8.0), 1mmol/L EDTA and 1 volume %Triton X-100.
Other are with embodiment 1.
The application of embodiment 3 Listeria monocytogenes gene quick diagnosis kits
1 materials and methods
1.1 material
1.1.1 bacterial strain
There are 28 strains in our company with bacterial strain, is mainly derived from the biological article of USS collecting center, clinical isolates strain and environment separation bacterial strain.See table 1 for details.
Table 1 strain name and source
| Bacterium source | Bacterial strain and numbering |
| The biological article collecting center (ATCC) of USS | Singly increase listeria spp (7466), listeria innocua (33090), sheep listeria spp (19119), this listeria spp of Weir (35897), Ge Shi listeria spp (25401); |
| Clinical separation strain | Derive from Listeria monocytogenes 20 strains in the test sample; |
| Other bacterial strain | Salmonellas, Escherichia coli O 157, each 1 strain of streptococcus aureus. |
1.1.2 key instrument and reagent
1.2 the evaluation of isolated strains
1.2.1 the bacterial classification of the cultivation Listeria monocytogenes stab culture of Listeria monocytogenes is recovered with nutrient broth, 30 ℃, cultivates 24-48 hour.Isolated single bacterium colony in 24-48 hour in the dull and stereotyped 30 ℃ of cultivations of ordinary nutrient agar.
After 1.2.2 the isolation identification clinical separation strain of clinical separation strain increases bacterium; On the flat board of Oxford, isolate single bacterium colony; Be inoculated in triple sugariron (TSI) slant medium and observe the projects such as acid, aerogenesis and product hydrogen sulfide of whether producing; Be inoculated in hydrogen sulfide-indole-power (SIM) agar test simultaneously, be incubated at 25 ℃, observe whether dynamic and become umbrella shape shape or crescent shape growth.Choose suspicious single bacterium colony and make gramstaining, adopt the monokaryon hyperplasia property listeria bacteria biochemical identification box of Huankai Microbes Tech Co., Ltd., Guangdong to carry out the biochemistry affirmation.
1.3 sample preparation (template DNA extraction)
1.3.1 get the bacterium liquid sample of 1mL liquid culture, centrifugal 2 minutes of 10000rpm obtains bacterial sediment;
Mix 1.3.2 in above-mentioned bacterial sediment, add 100 μ L sample pretreatment liquid, boil in the boiling water after 20 minutes and placed cooled on ice immediately 10 minutes, centrifugal 2 minutes of 10000rpm, supernatant is the sample template DNA.
1.4 the reaction process of loop-mediated isothermal amplification technique
1.4.1 prepare reaction system at 200 μ L reaction tubess: reaction solution 22 μ L, Bst archaeal dna polymerase 0.5 μ L (4U), stable liquid 30 μ L, template DNA 2.5 μ L.
1.4.2 with the reaction tubes for preparing in 65 ℃ of isothermal reactions 1 hour.
1.5 post-reaction treatment
In above-mentioned reaction product, add 2 μ L SYBR Green I; Mixing; Also add SYBR Green I mixing in heliotropism control tube (singly increasing the listeria spp genomic dna) and the negative control pipe (deionized water) simultaneously; If the same shows green with the positive control pipe of reaction tubes is then positive, as if reaction tubes the same with the negative control pipe manifest orange then negative.
1.6 electrophoresis
Prepare 0.2% agarose gel electrophoresis.Carry out the coupling reaction observations with SYBR Green I as dyestuff.
1.7 specific degree test
1.7.1 pure bacterial strain LAMP detects and with the LAMP method 28 strain bacteriums increased, and is green positive according to the coupling reaction observations, orange feminine gender, verification method specificity.
1.7.2 the detection of several bacterial strains hybrid dna is got 2ul with LAMP to the DNA equal-volume mixed solution that singly increases listeria spp and Salmonella, Escherichia coli O 157, streptococcus aureus and is done the LAMP detection.
1.8 sensitivity test, is chosen two with singly increasing listeria spp (7466) after pure culture 24-48 on the ordinary nutrient agar flat board hour and is completely encircled bacterium colony and be suspended in the 5mL SPSS, with 10 times of doubling dilutions to 10 of saline water
-10Selecting 3 suitable concentration levels to get 100ul is tiled on the ordinary nutrient agar flat board; Make 3 flat boards respectively; Cultivate 48h for 30 ℃; Get the flat board of colony count between 30～300 and make plate count, the mean of the colony count of 3 flat boards of this concentration level is calculated bacterial concentration, is bacterium colony mean number * extension rate * 10; Simultaneously, each concentration level is got 1mL, extracts DNA, makes LAMP and detects.
1.9 test of replica test specific degree and sensitivity test repeat respectively 2 times.
2 results
2.1 singly increase the foundation of listeria spp LAMP detection method
2.2 it is positive that the specific degree test sheet increases listeria spp (7466) detected result, 7 strains are non-, and singly to increase listeria spp all negative, singly increases listeria spp and Salmonellas, Escherichia coli O 157,4 kinds of DNA of bacteria mixed solutions of streptococcus aureus are positive, like Fig. 1.The visualizingre agent box has high specific as a result.
2.3 sensitivity test through the bacterium colony plate count, selects the 6th extent of dilution to carry out reading, average colony count is 181cfu, calculates that the bacterium original liquid concentration is 1.81 * 10
8Cfu/mL, the LAMP method can detect the 5th extent of dilution, is 1.81 * 10
3Cfu/mL.Like Fig. 2.
2.4 electrophoresis observation carries out electrophoresis observation to above-mentioned LAMP product, product scalariform band is clear, meets the band pattern of normal amplification, and is as shown in Figure 3.
2.5 replica test specific degree test repetition twice, the result is consistent.Sensitivity test repeats twice, order-of-magnitude agreement.
Listeria monocytogenes rapid diagnostic kit and detection method sequence table SEQ UENCE LISTING thereof based on loop-mediated isothermal amplification technique
< 110>Guangzhou Huafeng Biotech Co., Ltd.
< 120>based on the Listeria monocytogenes rapid diagnostic kit and the detection thereof of loop-mediated isothermal amplification technique
Method
<130>
<160>4
<170>PatentIn?version?3.2
<210>1
<211>19
<212>DNA
< 213>artificial sequence
<400>1
Outer primer F3:ACAAGACTTCACCAATCCA
<210>2
<211>23
<212>DNA
< 213>artificial sequence
<400>2
Outer primer B3:GTCTTTTAAGTGGAGTAAACCTT
<210>3
<211>47
<212>DNA
< 213>artificial sequence
<400>3
Inner primer FIP:TAAGTCTCTTTGCAATTGACCGACTTTTACGTGTACACAGAAAAGCG
<210>4
<211>47
<212>DNA
< 213>artificial sequence
<400>4
Inner primer BIP:CCTGTGCCAAAGCATTTTTACATTTTTTAGGCAAGTCATCTTGTTCG
Claims (4)
1. Listeria monocytogenes rapid diagnostic kit is characterized in that being made up of two pairs of primers, Bst archaeal dna polymerase, reaction solution, stable liquid, sample pretreatment liquid, colour developing liquid and positive control solution, more than seven kinds of liquid place container respectively,
Above-mentioned two pairs of primers are:
Outer primer F3:ACAAGACTTCACCAATCCA;
Outer primer B3:GTCTTTTAAGTGGAGTAAACCTT;
Inner primer FIP:TAAGTCTCTTTGCAATTGACCGACTTTTACGTGTACACAGAAAAGCG;
Inner primer BIP:CCTGTGCCAAAGCATTTTTACATTTTTTAGGCAAGTCATCTTGTTCG;
Above-mentioned reaction solution contains 1.6～2mmol/L dNTP, 20～25mmol/L Tris-Cl, 10～12.5mmol/L Repone K, 10～12.5mmol/L ammonium sulfate, 8～10mmol/L sal epsom, 0.1～0.125%TritonX-100,0.8～1mol/L trimethyl-glycine, each 1.6～2mol/L of inner primer FIP/BIP and each 0.2～0.25mol/L of outer primer F3/B3;
Above-mentioned sample pretreatment liquid contains Tris-HCl, 1～2mmol/L EDTA and the 1～1.2%Triton X-100 of 10～20mmol/L pH 8.0;
Above-mentioned positive control is Listeria monocytogenes group DNA.
2. according to the said test kit of claim 1, it is characterized in that said colour developing liquid is SYBRGreen I.
3. according to the said test kit of claim 1, it is characterized in that said sample pretreatment liquid contains the Tris-HCl of 20mmol/L pH 8.0,2mmol/L EDTA and 1.2%Triton X-100.
4. according to the said test kit of claim 1, it is characterized in that said reaction solution contains 2mmol/L dNTP, 25mmol/L Tris-Cl, 12.5mmol/L Repone K, 12.5mmol/L ammonium sulfate, 10mmol/L sal epsom, 0.125%TritonX-100,1mol/L trimethyl-glycine, each 2mol/L of inner primer FIP/BIP and each 0.25mol/L of outer primer F3/B3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910138319XA CN101555529B (en) | 2008-04-29 | 2009-04-28 | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810027759.3 | 2008-04-29 | ||
| CNA2008100277593A CN101307351A (en) | 2008-04-29 | 2008-04-29 | Rapid diagnosis kit for listeria monocytogenes gene based on loop-mediated isothermal amplification technology and detecting method thereof |
| CN200910138319XA CN101555529B (en) | 2008-04-29 | 2009-04-28 | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101555529A CN101555529A (en) | 2009-10-14 |
| CN101555529B true CN101555529B (en) | 2012-01-11 |
Family
ID=40124029
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100277593A Pending CN101307351A (en) | 2008-04-29 | 2008-04-29 | Rapid diagnosis kit for listeria monocytogenes gene based on loop-mediated isothermal amplification technology and detecting method thereof |
| CN200910138319XA Active CN101555529B (en) | 2008-04-29 | 2009-04-28 | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100277593A Pending CN101307351A (en) | 2008-04-29 | 2008-04-29 | Rapid diagnosis kit for listeria monocytogenes gene based on loop-mediated isothermal amplification technology and detecting method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN101307351A (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101307351A (en) * | 2008-04-29 | 2008-11-19 | 广州华峰生物科技有限公司 | Rapid diagnosis kit for listeria monocytogenes gene based on loop-mediated isothermal amplification technology and detecting method thereof |
| CN101748201B (en) * | 2008-11-28 | 2012-06-27 | 中华人民共和国黑龙江出入境检验检疫局检验检疫技术中心 | Method of loop-mediated isothermal amplification (LAMP) for detecting Listeria monocytogenes |
| CN103725763A (en) * | 2012-10-12 | 2014-04-16 | 苏州四同医药科技有限公司 | High-specificity high-sensitivity listeria monocytogene detection method |
| CN110964788B (en) * | 2015-09-02 | 2022-08-26 | 上海旺旺食品集团有限公司 | Rapid constant-temperature detection method of cronobacter sakazakii, primer group and application |
| CN108865922A (en) * | 2018-05-02 | 2018-11-23 | 山东出入境检验检疫局检验检疫技术中心 | listeria monocytogenes standard sample and preparation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101082579A (en) * | 2006-05-29 | 2007-12-05 | 广州华峰生物科技有限公司 | Gene rapid diagnosis method based on annular mediated isothermal amplification technology |
| CN101307351A (en) * | 2008-04-29 | 2008-11-19 | 广州华峰生物科技有限公司 | Rapid diagnosis kit for listeria monocytogenes gene based on loop-mediated isothermal amplification technology and detecting method thereof |
-
2008
- 2008-04-29 CN CNA2008100277593A patent/CN101307351A/en active Pending
-
2009
- 2009-04-28 CN CN200910138319XA patent/CN101555529B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101082579A (en) * | 2006-05-29 | 2007-12-05 | 广州华峰生物科技有限公司 | Gene rapid diagnosis method based on annular mediated isothermal amplification technology |
| CN101307351A (en) * | 2008-04-29 | 2008-11-19 | 广州华峰生物科技有限公司 | Rapid diagnosis kit for listeria monocytogenes gene based on loop-mediated isothermal amplification technology and detecting method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101555529A (en) | 2009-10-14 |
| CN101307351A (en) | 2008-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101570795B (en) | Mycobacterium tuberculosis gene rapid diagnostic primer based on loop-mediated isothermal amplification technology and use in preparing rapid diagnostic kit | |
| CN101654706B (en) | Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof | |
| CN101660005B (en) | Rapid diagnostic kit based on loop-mediated isothermal amplification technique for hepatitis A virus genes and detection method thereof | |
| CN101935693B (en) | Mycobacterium tuberculosis detection kit and use method thereof | |
| CN101565753B (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN101555529B (en) | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof | |
| CN102094090B (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN101008036A (en) | Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology | |
| CN101942508B (en) | Escherichia coli detection kit and use method thereof | |
| CN101008039A (en) | EB virus gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology | |
| CN101403001B (en) | Rapid diagnosis reagent kit and detection method for pseudomonas aeruginosa gene | |
| CN101368204B (en) | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique | |
| CN101368203A (en) | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection | |
| CN101824468A (en) | Primer group for detecting Yersinia pestis, rapid diagnosis kit and detection method | |
| CN101979660B (en) | Brucella detection kit and using method thereof | |
| CN102251044A (en) | Enterorrhagia colibacillus stx1 gene detection kit and application method thereof | |
| CN102719548B (en) | Kit for detecting brucella and use method thereof | |
| CN101824482B (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| CN102286620A (en) | Enterohemorrhagic E. coli stx2 gene detection kit and using method thereof | |
| CN100478674C (en) | Salmonella gene rapid diagnosis reagent kit based on annular mediated isothermal amplification technology | |
| CN102146470B (en) | Bacillus anthracis detection kit and using method of kit | |
| CN101403005B (en) | Rapid diagnosis reagent kit and detection method for cholera vibrio gene | |
| CN101338345A (en) | H5 avian influenza viral gene rapid diagnosis kit based on ring mediating isothermal amplification technology and detecting process thereof | |
| CN101403004B (en) | Rapid diagnosis reagent kit and detection method for vibrio vulnficus gene | |
| CN101403003B (en) | Rapid diagnosis reagent kit and detection method for staphylococcus epidermidis gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |