CN101935693B - Mycobacterium tuberculosis detection kit and use method thereof - Google Patents
Mycobacterium tuberculosis detection kit and use method thereof Download PDFInfo
- Publication number
- CN101935693B CN101935693B CN2010100194545A CN201010019454A CN101935693B CN 101935693 B CN101935693 B CN 101935693B CN 2010100194545 A CN2010100194545 A CN 2010100194545A CN 201010019454 A CN201010019454 A CN 201010019454A CN 101935693 B CN101935693 B CN 101935693B
- Authority
- CN
- China
- Prior art keywords
- mycobacterium tuberculosis
- detection kit
- primer
- lysate
- bip
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a mycobacterium tuberculosis detection kit which comprises the following two pairs of primers: inner primers FIP/BIP and outer primers F3/B3, wherein the two pairs of primer takes a gyrB gene of a mycobacterium tuberculosis composite group as a target gene and are designed on the basis of loop-mediated isothermal amplification (LAMP) technology. The mycobacterium tuberculosis detection kit has more comprehensive detection effect and low omission ratio.
Description
Technical field
The present invention relates to biological detection reagent, be specifically related to a kind of mycobacterium tuberculosis detection kit and method of use thereof.
Background technology
With polymerase chain reaction (PCR) technology is that the cause of disease nucleic acid detection technique of representative exists some problems in practical application; Like the special instrument of common polymerase chain reaction (PCR) Technology Need, and there are easy crossed contamination and the loaded down with trivial details shortcoming of operating process.And fluorescence real-time quantitative polymerase chain reaction (real timePCR) and simplified operating process though technology has solved the problem of crossed contamination preferably, needs more complicated quantitatively determined instrument, therefore is not suitable for field quick detection.And the cost of fluorescent probe is higher in the real-time quantitative polymerase chain reaction PCR technology, has strengthened the difficulty of applying.The immunology detection technology is fast and convenient with low cost, but requires the monoclonal antibody of high quality high stability, otherwise because of accuracy is not enough, can only be the auxiliary detection means at present.So in time use the newest fruits of biotech development significant to satisfying improving constantly of pathogenic micro-organism detection requirement.Wherein constant-temperature amplification (IsothermalAmplification) nucleic acid Fast Detection Technique is the rapid progress on the cause of disease nucleic acid detection technique, and the loop-mediated isothermal amplification technology of at present having set up (LAMP) has a lot of meliority.
Fast Detection Technique for mycobacterium tuberculosis also has certain research, for example Chinese ZL200810028441.7 patent of invention " based on the mycobacterium tuberculosis gene rapid diagnostic kit and the detection method thereof of loop-mediated isothermal amplification technique ".This patent detects to the repeated factor insertion sequence 6110 of mycobacterium tuberculosis.Repeatability factor insertion sequence is one section ability is carried out swivel base on karyomit(e) a gene; Generally on karyomit(e), there are a plurality of copies; As 6110 are insertion sequences in middle discovery; The length of this factor is 1361, is a functional transposable element, and there is homology in 3 families of its sequence and enterobacteriaceae.Different oligonucleotide increase as primer in the selection 6110, and finding to have only has amplified band in the crowd, and its copy number not of the same race is also different, and 10～20 copies are arranged in the Bacillus tuberculosis.Have only 1 copy in the mycobacterium bovis BCG, 10～20 copies are arranged in the mycobacterium microti.The target sequence of high copy number helps improving the sensitivity of amplified reaction, and has reported and in some Bacillus tuberculosis that Vietnam and south east asia are separated to, lack this factor.Therefore, as tubercle mycobaterium target sequence widely, might make its result that omission is arranged with repeated factor insertion sequence 6110.
Therefore, need a kind of detect effect more comprehensively, the low mycobacterium tuberculosis detection kit of loss and method of use thereof to be to address the above problem.
Summary of the invention
The objective of the invention is to solve the weak point of prior art and provide a kind of detect effect more comprehensively, mycobacterium tuberculosis detection kit that loss is low.
The object of the invention can be realized through following technical measures: a kind of mycobacterium tuberculosis detection kit, described mycobacterium tuberculosis detection kit comprise the gyrB gene with mycobacterium tuberculosis complex be target gene, based on two pairs of primers of loop-mediated isothermal amplification technology design: inner primer FIP/BIP and outer primer F3/B3.
The gyrB of single copy is the gene that is prevalent in coding gyrase B subunit in the bacterium, and this gene evolution speed is fast, and per 1,000,000 years average base replacement rate is 0.7%～0.8%.This section gene can to pseudomonas, genus bacillus, vibrios, enterobacteria, mycobacterium, Aeromonas, milk-acid bacteria etc. do not belong to together or section in sibling species distinguish evaluation, also can through the design species-specific primer carry out quantitative PCR or restriction fragment analysis.The gyrB that the present invention is directed to mycobacterium tuberculosis complex (is the B subunit protein of dna gyrase; Its being numbered on NCBI: GQ247736.1) gene design primer, owing to this gene high conservative also extensively is present in each mycobacterium tuberculosis bacterial classification, so its primer can increase and detect all bacterial classifications of mycobacterium tuberculosis complex; Comprise M.tuberculosis; M.microti, M.africanum, M.bovis.
As the preferred implementation of mycobacterium tuberculosis detection kit of the present invention, described two pairs of primers do
Outer primer F3: (SEQ ID NO 1)
ACCACGGAATACGACTTCGA
Outer primer B3: (SEQ ID NO 2)
AGTGAAAGGTGCGGCTCT
Inner primer FIP: (SEQ ID NO 3)
GGTCACCCTCTCGTCGGTCAttttGCAAGAGATGGCGTTCCTC
Inner primer BIP: (SEQ ID NO 4)
GAAGTGGTCAGCGACGTCGCttttTAACTTTGTGCGGTGCAGTG
Or
Outer primer F3 ': (SEQ ID NO 5)
GGGTACGAGTGGTCTCAGG
Outer primer B3 ': (SEQ ID NO 6)
CGTCTTGGGTCACCCTCT
Inner primer FIP ': (SEQ ID NO 7)
ACCGTTGACCCCGTCTTCTTGttttAGAAGTCGGAACCCCTGG
Inner primer BIP ': (SEQ ID NO 8)
ATACGACTTCGAAACCGTCGCCttttGGTCAGCCCCTTGTTGAG；
Or
Outer primer F3 ": (SEQ ID NO 1)
ACCACGGAATACGACTTCGA
Outer primer B3 ": (SEQ ID NO 2)
AGTGAAAGGTGCGGCTCT
Inner primer FIP ": (SEQ ID NO 9)
GGTCACCCTCTCGTCGGTCAGCAAGAGATGGCGTTCCTC
Inner primer BIP ": (SEQ ID NO 10)
GAAGTGGTCAGCGACGTCGCTAACTTTGTGCGGTGCAGTG；
Or
Outer primer F3 " ': (SEQ ID NO 5)
GGGTACGAGTGGTCTCAGG
Outer primer B3 " ': (SEQ ID NO 6)
CGTCTTGGGTCACCCTCT
Inner primer FIP " ': (SEQ ID NO 11)
ACCGTTGACCCCGTCTTCTTGAGAAGTCGGAACCCCTGG
Inner primer BIP " ': (SEQ ID NO 12)
ATACGACTTCGAAACCGTCGCCGGTCAGCCCCTTGTTGAG。
As the preferred implementation of mycobacterium tuberculosis detection kit of the present invention, described mycobacterium tuberculosis detection kit also comprises Bst archaeal dna polymerase, lysate 1, lysate 2, lysate 3, stable liquid, reaction solution, colour developing liquid and positive control solution.
As the more preferably embodiment of mycobacterium tuberculosis detection kit of the present invention, contain 1.6～2mmol dNTP, 20～25mmol Tris-Cl, 10～12.5mmol Repone K, 10～12.5mmol ammonium sulfate, 8～10mmol sal epsom, 1～1.25mL TritonX-100,0.8～1mol trimethyl-glycine, each 1.6～2mol of inner primer FIP/BIP and each 0.2～0.25mol of outer primer F3/B3 among the every 1L of described reaction solution;
Contain 0.1-0.2mol NaOH, 5～10mL Triton X-100 among described lysate 1 every 1L;
Described lysate 2 is a Proteinase K;
The 0.5-1mol Tris-HCl that contains pH7.5 among described lysate 3 every 1L;
Described colour developing liquid is SYBR Green I or Eva Green;
Said stable liquid is Yellow Protopet 2A;
Described positive control is the mycobacterium tuberculosis genomic dna.
As the most preferred embodiment of mycobacterium tuberculosis detection kit of the present invention, contain 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol Repone K, 12.5mmol ammonium sulfate, 10mmol sal epsom, 1.25mL TritonX-100,1mol trimethyl-glycine, each 2mol of inner primer FIP/BIP and each 0.25mol of outer primer F3/B3 among the every 1L of described reaction solution;
The NaOH and the 5mL Titon X-100 that contain 0.1mol pH9.5 among described lysate 1 every 1L;
The Tris-HCl that contains 1mol pH7.5 among described lysate 3 every 1L.
Preferred implementation as mycobacterium tuberculosis detection kit of the present invention; Described mycobacterium tuberculosis detection kit also comprises reaction tubes; Described reaction tubes covers two portions by body with pipe to be formed, and the bottom of tube cavity is provided with the dividing plate of the longitudinal extension that is divided into A, two cavitys of B.
More preferably embodiment as mycobacterium tuberculosis detection kit of the present invention; Working fluid or colour developing liquid are housed respectively in described A, two cavitys of B; Seal up for safekeeping by stable liquid on liquid upper strata in two cavitys, and said working fluid is mixing of reaction solution and Bst archaeal dna polymerase.
Loop-mediated isothermal amplification technology (LAMP) be a kind of fast, sensitive, detection of nucleic acids mode accurately, its amplification efficiency is superpower, shows two aspects: what (1) remolding sensitivity PCR exceeded is the difference of the order of magnitude; (2) the DNA quantity of amplified production also exceeds too much than PCR product, can reach several μ g; But too sensitive and product amount is huge; Make LAMP pollute very easily easily, especially behind the LAMP amplified reaction, need the reaction tubes adding developer of uncapping, occur aerosol easily and pollute.And the aerosol pollution can make the detected result false positive rate high, and pollutes other samples, and the pollution detection zone also is difficult to remove simultaneously.Reaction tubes of the present invention is through the design of dividing plate and stable liquid; To develop the color effectively liquid and working fluid separated, and can not only guarantee the closure that in storage and transport process, is kept perfectly relatively, and need not to open the pipe lid; Just can realize coupling reaction, reduce aerocolloidal pollution greatly.
The present invention also provides a kind of method of using the mycobacterium tuberculosis detection kit, and this method comprises the steps:
(1) sputum sample article liquefaction to be measured back is centrifugal in centrifuge tube, remove supernatant, collecting precipitation; Saline water washing precipitation 2 times is removed supernatant, collecting precipitation;
(2) in lysate 1, add lysate 2, behind the piping and druming mixing, add in the above-mentioned deposition, after temperature is bathed, the boiling water bath cracking, it is centrifugal to add lysate 3 mixings then, and supernatant is the sample template DNA;
(3) in reaction vessel, add reaction solution 38～40 volume %, Bst archaeal dna polymerase 0.9～1.8 volume %, stable liquid 52～54.5 volume %, sample template DNA 4.5～9 volume %, isothermal reaction; Said volume percent is meant the volume percent that accounts for four component TVs;
(4) in above-mentioned reaction vessel and positive control, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative;
It is target gene that reaction solution in the said step (3) contains gyrB gene with mycobacterium tuberculosis complex, based on two pairs of primers of loop-mediated isothermal amplification technology design: inner primer FIP/BIP and outer primer F3/B3.
Use the preferred implementation of the method for mycobacterium tuberculosis detection kit as the present invention, the liquefaction in the said step (1) is liquefied to sputum sample for adding mass percent 4%NaOH solution or pancreatin.
Use the preferred implementation of the method for mycobacterium tuberculosis detection kit as the present invention, in the said step (2), warm bath temperature is 56～60 ℃, and the warm bath time is 30min～300min.The boiling water cracking temperature is 95～100 ℃, and the cracking time is 10～20min; In the step (3), the reaction conditions of isothermal reaction is 63～65 ℃ of temperature, reaction times 45～90min.
The present invention is said based on loop-mediated isothermal amplification technology (loop-mediated isothermal amplication of DNA; Abbreviation LAMP) method of rapid detection mycobacterium tuberculosis; It is the special inside and outside primer (being inner primer FIP/BIP and outer primer F3/B3) of two couples that utilizes the Bst archaeal dna polymerase and design according to target-gene sequence; Six isolated areas on the specific recognition target sequence; Start the endless chain replacement(metathesis)reaction, start complementary strand in target DNA district synthetic, and result's complementary sequence on same chain goes round and begins again and is formed with the very stem of polycyclic Cauliflower structure-circular DNA mixture.In the LAMP reaction process, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product---magnesium pyrophosphate milky white precipitate, can be through the visual inspection result of determination.The LAMP reaction is under constant temperature (63～65 ℃) condition, to accomplish in 45～90 minutes.This comparatively gentle temperature condition and do not have temperature cycle that required instrument is oversimplified, overcome conventional P CR inherent detection time long, pollute easily and detect shortcoming such as cost height.In addition, this detection method is lower to testing staff's technical quality requirement, and actually operating is very easy, does not need special reagent and plant and instrument, helps setting up rapid screening system with low cost.The LAMP method is a kind of gene amplification method of easy, quick, high degree of specificity.Constant temperature gene amplification technology and round pcr (comprising the fluorescence real-time quantitative PCR technology) are compared; Can find and technology on methodology indexs such as sensitivity, specificity and sensing range, to be equivalent to or to be superior to round pcr; And do not rely on any special plant and instrument and can realize on-the-spot high-throughput rapid detection, and detect cost far below fluorescent quantitative PCR technique.Be accredited as passing method main, that combine biochemical analysis and serological typing to identify with mikrobe separation and Culture and morphology in the national standard at present, preliminary evaluation needs 2～3 days, accomplishes probation report and needs 10～15 days; Adopt detection kit of the present invention only to need 2 hours.And, having added colour developing liquid in the reaction system of the present invention, qualification result is visual and clear more.
Compared with prior art, the present invention has following beneficial effect: 1. detection kit of the present invention only needs just ability amplified reaction of a steady temperature, does not need special reagent and equipment, and it is low to detect cost; 2. gene quick diagnosis kit of the present invention is used six sections, four primers, and whether the existence that just can judge target substance according to whether increasing to be, so has high specific; 3. detection kit of the present invention amplification fast and efficient can accomplish amplification less than 1 hour, and productive rate is high; 4. detection kit of the present invention is highly sensitive, and amplification template only needs 10 copies or still less; 5. gene quick diagnosis kit of the present invention is identified easy, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product---the magnesium pyrophosphate deposition, can identify through visual inspection, and after adding colour developing liquid, yin and yang attribute colour development difference as a result is remarkable, the checking rate is high, and is more obviously reliable; 6. owing to selected the gyrB gene of high conservative property to design primer, make that the accuracy rate of detection kit detection mycobacterium tuberculosis of the present invention is higher as target gene; 7. in detection kit of the present invention, adopt special reaction tubes, reduced the aerosol contamination of heavy, simultaneously handled easily.
Embodiment
For making the present invention be more prone to understand, will further set forth specific embodiment of the present invention below.
The preparation of embodiment 1 test kit
(1) synthesize oligomerization picodna primer by following sequence through dna synthesizer:
Outer primer F3: (SEQ ID NO 1)
ACCACGGAATACGACTTCGA
Outer primer B3: (SEQ ID NO 2)
AGTGAAAGGTGCGGCTCT
Inner primer FIP: (SEQ ID NO 3)
GGTCACCCTCTCGTCGGTCAttttGCAAGAGATGGCGTTCCTC
Inner primer BIP: (SEQ ID NO 4)
GAAGTGGTCAGCGACGTCGCttttTAACTTTGTGCGGTGCAGTG
(2) purchase archaeal dna polymerase: the Bst archaeal dna polymerase places container;
(3) preparation reaction solution: reaction solution places container by containing each 0.25mol preparation of 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol Repone K, 12.5mmol ammonium sulfate, 10mmol sal epsom, 1.25mL TritonX-100,1mol trimethyl-glycine, each 2mol of inner primer FIP/BIP and outer primer F3/B3 among every 1L;
(4) preparation lysate 1: lysate 1 is by containing 0.1-0.2mol NaOH, 5～10mL Triton X-100 in every 1L lysate 1;
(5) the above-mentioned lysate 2 of preparation: lysate 2 contains the preparation of 50 μ g Proteinase Ks by 1mL;
(6) preparation lysate 3: lysate 3 is by the 0.5-1molTris-HCl that contains pH7.5 in every 1L lysate 3;
(7) purchase stable liquid: Yellow Protopet 2A places container;
(8) purchase colour developing liquid: SYBR Green I places container;
(9) extract positive control: the mycobacterium tuberculosis genomic dna places container;
(10) above-mentioned 8 containers are dressed up test kit, encapsulation;
Preparation technology is summarized as follows:
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, reaction solution is aseptic subpackaged, and confirm the quality inspection of sampling with carrying out concentration according to experiment;
3, with the stable liquid packing, the sampling quality inspection;
4, with the positive control sample preparations, packing, sampling quality inspection;
5, assembling test kit.
The preparation of embodiment 2 test kits
Reaction solution places container by containing each 0.2mol preparation of 1.6mmol dNTP, 20mmol Tris-Cl, 10mmol Repone K, 10mmol ammonium sulfate, 8mmol sal epsom, 1mL TritonX-100,0.8mol trimethyl-glycine, each 1.6mol of inner primer FIP/BIP and outer primer F3/B3 among every 1L.
The 0.5-1mol Tris-HCl that contains pH7.5 in above-mentioned every 1L lysate 3.
Colour developing liquid is EvaGreen.
Other are with embodiment 1.
The preparation of embodiment 3 test kits
Other conditions are identical with embodiment 1, and its difference only is that the primer in the step (1) is:
Outer primer F3 ': (SEQ ID NO 5)
GGGTACGAGTGGTCTCAGG
Outer primer B3 ': (SEQ ID NO 6)
CGTCTTGGGTCACCCTCT
Inner primer FIP ': (SEQ ID NO 7)
ACCGTTGACCCCGTCTTCTTGttttAGAAGTCGGAACCCCTGG
Inner primer BIP ': (SEQ ID NO 8)
ATACGACTTCGAAACCGTCGCCttttGGTCAGCCCCTTGTTGAG。
In other embodiments of the invention, can obtain other primer according to the design of primers principle design of LAMP technology to the gyrB gene of mycobacterium tuberculosis complex.
The preparation of embodiment 4 test kits
Other conditions are identical with embodiment 1, and its difference only is that the primer in the step (1) is:
Outer primer F3 ": (SEQ ID NO 1)
ACCACGGAATACGACTTCGA
Outer primer B3 ": (SEQ ID NO 2)
AGTGAAAGGTGCGGCTCT
Inner primer FIP ": (SEQ ID NO 9)
GGTCACCCTCTCGTCGGTCAGCAAGAGATGGCGTTCCTC
Inner primer BIP ": (SEQ ID NO 10)
GAAGTGGTCAGCGACGTCGCTAACTTTGTGCGGTGCAGTG。
The preparation of embodiment 5 test kits
Other conditions are identical with embodiment 1, and its difference only is that the primer in the step (1) is:
Outer primer F3 " ': (SEQ ID NO 5)
GGGTACGAGTGGTCTCAGG
Outer primer B3 " ': (SEQ ID NO 6)
CGTCTTGGGTCACCCTCT
Inner primer FIP " ': (SEQ ID NO 11)
ACCGTTGACCCCGTCTTCTTGAGAAGTCGGAACCCCTGG
Inner primer BIP " ': (SEQ ID NO 12)
ATACGACTTCGAAACCGTCGCCGGTCAGCCCCTTGTTGAG。
The application of embodiment 6 mycobacterium tuberculosis detection kit
One, method and material
1, bacterial strain
This research bacterial strain uses therefor has 30 strains, is mainly derived from the biological article of USS collecting center, Nat'l Pharmaceutical & Biological Products Control Institute.See table 1 for details.
Table 1 strain name and source
Bacterium source bacterial strain and numbering
M.tuberculosis?H37Rv(27294)、M.kansassi
(12478)、M.intracellulare(13950)、M.chelonae
(14472)、M.fortuitum(6481)、M.gordonae
(14470)、M.aurum(23366)、M.neoaurum
(25795)、M.marinum(927)、M.gilvum(43909)、
M.aichiense(27280)、M.microti(19422)、
The biological article M.smegmatis (19420) of USS, M.parofortuitum (19686),
The M.terrae of collecting center (ATCC) (19619), M.nonchromogenicum
(19530)、M.vaccae(15483)、M.avium
(25291)、M.phlei(11758)、M.scrofulaceum
(19981)、M.gastri(15754)、M.triviale(23292)、
M.xenopi(19250)、M.abscessus(19977)、
M.africanum(25420)、M.ulcerans(19423)、
M.bovis(19210)、M.malmoense(29571)；
Other M.bovis BCG
2, sample preparation (template DNA extraction)
(1) draw culture bacteria liquid 1mL, the centrifugal 2min of 12000rpm obtains bacterial sediment;
(2) in above-mentioned bacterial sediment, add 100 μ L DNA extraction liquid I, boiling water bath 10min adds 12.5 μ LDNA extracting solution II, mixings slightly; The centrifugal 2min of 12000r/min, supernatant is the sample template DNA.
3, the reaction process of loop-mediated isothermal amplification technology
(1) in 200 μ L reaction tubess preparation reaction system: reaction solution 22 μ L, Bst archaeal dna polymerase 0.5 μ L (4U), stable liquid 30 μ L, template DNA 2.5 μ L.
(2) with the reaction tubes for preparing in 65 ℃ of isothermal reaction 1h.
4, post-reaction treatment
In above-mentioned reaction product, add 2 μ L SYBR Green I, mixing also adds SYBR Green I mixing in the heliotropism control tube, simultaneously if the same shows green with control tube of reaction tubes is then positive, if reaction tubes manifests orange then negative.
5, specific degree test
Pure bacterial strain LAMP detects and with the LAMP method 30 strain bacterial strains increased, and is green positive according to the coupling reaction observations, orange feminine gender, verification method specificity.
6, sensitivity test is carried nucleic acid with M.tuberculosis H37Rv (27294) essence, is diluted to 10-12 with 10 times of multiple proportions continuous gradients of TE, carries out LAMP and detects.
7, test of replica test specific degree and sensitivity test repeat respectively 2 times.
Two, result
1, specific degree is tested this and is detected sample totally 32 examples, wherein ATCC reference culture 30 strains, 1 Vaccinum Calmette-Guerini BCG, 1 pure water.M.tuberculosis H37RV (27294) detected result is positive, and 3 strain mycobacterium tuberculosis complexs are positive, and BCG is positive, and 27 strain non-tuberculous mycobacterias are all negative.Detected result such as table 2.
Table 2 detected result
| Test sample | The result |
| M.tuberculosis?H37Rv(27294) | Positive |
| Vaccinum Calmette-Guerini BCG | Positive |
| Pure water | Negative |
| M.kansassi(12478) | Negative |
| M.intracellulare(13950) | Negative |
| M.chelonae(14472) | Negative |
| M.fortuitum(6481) | Negative |
| M.gordonae(14470) | Negative |
| M.aurum(23366) | Negative |
| M.neoaurum(25795) | Negative |
| M.marinum(927) | Negative |
| M.gilvum(43909) | Negative |
| M.aichiense(27280) | Negative |
| M.microti(19422) | Positive |
| M.smegmatis(19420) | Negative |
| M.parofortuitum(19686) | Negative |
| M.terrae(19619) | Negative |
| M.nonchromogenicum(19530) | Negative |
| M.vaccae(15483) | Negative |
| M.phlei(11758) | Negative |
| M.scrofulaceum(19981) | Negative |
| M.gastri(15754) | Negative |
| M.triviale(23292) | Negative |
| M.avium(25291) | Negative |
| M.xenopi(19250) | Negative |
| M.abscessus(19977) | Negative |
| M.africanum(25420) | Positive |
| M.bovis(19210) | Positive |
| M.ulcerans(19423) | Negative |
| M.malmoense(29571) | Negative |
| H7 | Negative |
2, sensitivity test
Through quantitative fluorescent PCR contrast counting, the LAMP method can detect the 8th extent of dilution, and reckoning is 10
2Copy/test.
3, replica test
Specific degree test repetition twice, the result is consistent.Sensitivity test repeats twice, order-of-magnitude agreement.
Embodiment 7 adopts the mycobacterium tuberculosis detection kit of reaction tubes
The mycobacterium tuberculosis detection kit of present embodiment; The reagent that adopts is identical with embodiment 1 with primer; Test kit also comprises reaction tubes, and reaction tubes covers two portions by body with pipe to be formed, and the bottom of tube cavity is provided with the dividing plate of the longitudinal extension that is divided into A, two cavitys of B; Wherein: the LAMP reaction solution of 22.0 μ L and the Bst archaeal dna polymerase of 0.5 μ L are housed in the cavity A, and the liquid upper strata is sealed up for safekeeping by paraffin; The LAMP reaction solution liquid of 2.0 μ L is housed in the cavity B, and the liquid upper strata is also sealed up for safekeeping by paraffin, with this reaction tubes-20 ℃ preservation.
Present embodiment adopts reaction tubes as container, mycobacterium tuberculosis is carried out LAMP detect, and is provided with positive controls and negative control group simultaneously, specifically comprises the steps:
Get three of the reaction tubess of above-mentioned preparation; Adopt liquid-transfering gun to add each 2.5 μ L of negative control sample, detected sample and positive control sample respectively, rifle head pierce through the protection liquid layer during application of sample, sample adds in the reaction tubes A chamber; Tight pipe lid of lid and marked move to reaction zone.
With above-mentioned reaction tubes all in 65 ℃ of isothermal reaction 1h.
Reaction finishes, and reaction tubes is inverted whipping 1 time, is just putting whipping again 1 time, and working fluid and colour developing liquid thorough mixing are evenly observed the back.
If the same shows green with the positive control pipe of reaction tubes is then positive, as if reaction tubes the same with the negative control pipe manifest orange then negative.
In the LAMP reaction process, colour developing liquid and working fluid sealed state is good, not have to take place situation about revealing mutually, and the later stage is during coupling reaction, is inverted the whipping operation and makes colour developing liquid and working fluid mixing, and the result that develops the color is clear.
Last institute should be noted that; Above embodiment is only in order to technical scheme of the present invention to be described but not to the restriction of protection domain of the present invention; Although the present invention has been done detailed description with reference to preferred embodiment; Those of ordinary skill in the art should be appreciated that and can make amendment or be equal to replacement technical scheme of the present invention, and do not break away from the essence and the scope of technical scheme of the present invention.
SEQUENCE?LISTING
< 110>Guangzhou Huafeng Biotech Co., Ltd.
< 120>mycobacterium tuberculosis detection kit and method of use thereof
<160>12
<170>PatentIn?version?3.3
<210>1
<211>20
<212>DNA
< 213>synthetic
<400>1
accacggaat?acgacttcga 20
<210>2
<211>18
<212>DNA
< 213>synthetic
<400>2
agtgaaaggt?gcggctct 18
<210>3
<211>43
<212>DNA
< 213>synthetic
<400>3
ggtcaccctc?tcgtcggtca?ttttgcaaga?gatggcgttc?ctc 43
<210>4
<211>44
<212>DNA
< 213>synthetic
<400>4
gaagtggtca?gcgacgtcgc?tttttaactt?tgtgcggtgc?agtg 44
<210>5
<211>19
<212>DNA
< 213>synthetic
<400>5
gggtacgagt?ggtctcagg 19
<210>6
<211>18
<212>DNA
< 213>synthetic
<400>6
cgtcttgggt?caccctct 18
<210>7
<211>43
<212>DNA
< 213>synthetic
<400>7
accgttgacc?ccgtcttctt?gttttagaag?tcggaacccc?tgg 43
<210>8
<211>44
<212>DNA
< 213>synthetic
<400>8
atacgacttc?gaaaccgtcg?ccttttggtc?agccccttgt?tgag 44
<210>9
<211>39
<212>DNA
< 213>synthetic
<400>9
ggtcaccctc?tcgtcggtca?gcaagagatg?gcgttcctc 39
<210>10
<211>40
<212>DNA
< 213>synthetic
<400>10
gaagtggtca?gcgacgtcgc?taactttgtg?cggtgcagtg 40
<210>11
<211>39
<212>DNA
< 213>synthetic
<400>11
accgttgacc?ccgtcttctt?gagaagtcgg?aacccctgg 39
<210>12
<211>40
<212>DNA
< 213>synthetic
<400>12
atacgacttc?gaaaccgtcg?ccggtcagcc?ccttgttgag 40
Claims (6)
1. mycobacterium tuberculosis detection kit; It is characterized in that; Described mycobacterium tuberculosis detection kit comprise the gyrB gene with mycobacterium tuberculosis complex be target gene, based on two pairs of primers of loop-mediated isothermal amplification technology design: inner primer FIP/BIP and outer primer F3/B3, its sequence does
Outer primer F3:
ACCACGGAATACGACTTCGA
Outer primer B3:
AGTGAAAGGTGCGGCTCT
Inner primer FIP:
GGTCACCCTCTCGTCGGTCAttttGCAAGAGATGGCGTTCCTC
Inner primer BIP:
GAAGTGGTCAGCGACGTCGCttttTAACTTTGTGCGGTGCAGTG；
Or
Outer primer F3 ':
GGGTACGAGTGGTCTCAGG
Outer primer B3 ':
CGTCTTGGGTCACCCTCT
Inner primer FIP ':
ACCGTTGACCCCGTCTTCTTGttttAGAAGTCGGAACCCCTGG
Inner primer BIP ':
ATACGACTTCGAAACCGTCGCCttttGGTCAGCCCCTTGTTGAG；
Or
Outer primer F3 ":
ACCACGGAATACGACTTCGA
Outer primer B3 ":
AGTGAAAGGTGCGGCTCT
Inner primer FIP ":
GGTCACCCTCTCGTCGGTCAGCAAGAGATGGCGTTCCTC
Inner primer BIP ":
GAAGTGGTCAGCGACGTCGCTAACTTTGTGCGGTGCAGTG；
Or
Outer primer F3 ' ":
GGGTACGAGTGGTCTCAGG
Outer primer B3 ' ":
CGTCTTGGGTCACCCTCT
Inner primer FIP ' ":
ACCGTTGACCCCGTCTTCTTGAGAAGTCGGAACCCCTGG
Inner primer BIP ' ":
ATACGACTTCGAAACCGTCGCCGGTCAGCCCCTTGTTGAG。
2. mycobacterium tuberculosis detection kit according to claim 1; It is characterized in that described mycobacterium tuberculosis detection kit also comprises Bst archaeal dna polymerase, lysate 1, lysate 2, lysate 3, stable liquid, reaction solution, colour developing liquid and positive control solution;
Contain 0.1-0.2mol NaOH, 5～10mL Triton X-100 among described lysate 1 every 1L;
Described lysate 2 is a Proteinase K;
The 0.5-1mol Tris-HCl that contains pH7.5 among described lysate 3 every 1L.
3. mycobacterium tuberculosis detection kit according to claim 2 is characterized in that,
Contain 1.6～2mmol dNTP, 20～25mmol Tris-Cl, 10～12.5mmol Repone K, 10～12.5mmol ammonium sulfate, 8～10mmol sal epsom, 1～1.25mL Trit onX-100,0.8～1mol trimethyl-glycine, each 1.6～2mol of inner primer FIP/BIP and each 0.2～0.25mol of outer primer F3/B3 among the every 1L of described reaction solution;
Described colour developing liquid is SYBR Green I or Eva Green;
Said stable liquid is Yellow Protopet 2A;
Described positive control is the mycobacterium tuberculosis genomic dna.
4. mycobacterium tuberculosis detection kit according to claim 3 is characterized in that,
Contain 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol Repone K, 12.5mmol ammonium sulfate, 10mmol sal epsom, 1.25mL TritonX-100,1mol trimethyl-glycine, each 2mol of inner primer FIP/BIP and each 0.25mol of outer primer F3/B3 among the every 1L of described reaction solution;
The NaOH and the 5mL Triton X-100 that contain 0.1mol pH9.5 among described lysate 1 every 1L;
The Tris-HCl that contains 1mol pH7.5 among described lysate 3 every 1L.
5. according to claim 2,3 or 4 described mycobacterium tuberculosis detection kit; It is characterized in that; Described mycobacterium tuberculosis detection kit also comprises reaction tubes; Described reaction tubes covers two portions by body with pipe to be formed, and the bottom of tube cavity is provided with the dividing plate of the longitudinal extension that is divided into A, two cavitys of B.
6. mycobacterium tuberculosis detection kit according to claim 5; It is characterized in that; Working fluid or colour developing liquid are housed respectively in described A, two cavitys of B, and seal up for safekeeping by stable liquid on the liquid upper strata in two cavitys, and said working fluid is mixing of reaction solution and Bst archaeal dna polymerase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010100194545A CN101935693B (en) | 2010-01-18 | 2010-01-18 | Mycobacterium tuberculosis detection kit and use method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010100194545A CN101935693B (en) | 2010-01-18 | 2010-01-18 | Mycobacterium tuberculosis detection kit and use method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101935693A CN101935693A (en) | 2011-01-05 |
| CN101935693B true CN101935693B (en) | 2012-03-28 |
Family
ID=43389262
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010100194545A Active CN101935693B (en) | 2010-01-18 | 2010-01-18 | Mycobacterium tuberculosis detection kit and use method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101935693B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732601B (en) * | 2011-04-13 | 2014-03-12 | 中国人民解放军第三〇九医院 | Kit for diagnosis of tuberculosis based on isothermal nucleic acid amplification technique |
| CN102286623A (en) * | 2011-08-25 | 2011-12-21 | 广东省结核病控制中心 | Method for quickly identifying life or death of Mycobacterium tuberculosis |
| CN102888455B (en) * | 2012-09-14 | 2014-11-19 | 珠海市银科医学工程有限公司 | Kit for detecting mycobacterium tuberculosis based on loop-mediated isothermal amplification, and primers |
| CN103451309B (en) * | 2012-09-19 | 2015-11-18 | 广州华峰生物科技有限公司 | Mycobacterium detection kit and using method thereof |
| CN103483434A (en) * | 2013-09-18 | 2014-01-01 | 中国科学院微生物研究所 | Mycobacterium tuberculosis secretory antigen Mce3E and application thereof |
| CN103937666B (en) * | 2014-05-04 | 2016-08-24 | 青岛汉唐生物科技有限公司 | Concretion mycobacterium nucleic acid quick detection kit and detection method |
| CN107058517B (en) * | 2017-03-13 | 2021-05-28 | 新乡医学院第一附属医院 | Kit for detecting mycobacterium tuberculosis infection and detection method |
| CN107099601B (en) * | 2017-05-27 | 2020-10-23 | 中国人民解放军联勤保障部队第九八〇医院 | Primer composition for detecting live mycobacterium tuberculosis by RT-LAMP (reverse transcription loop-mediated isothermal amplification), corresponding kit and detection method |
| CN111876511A (en) * | 2020-09-17 | 2020-11-03 | 西藏自治区人民政府驻成都办事处医院(四川大学华西医院西藏成办分院) | LAMP (loop-mediated isothermal amplification) rapid detection kit and method for mycobacterium tuberculosis complex |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101157954A (en) * | 2007-09-13 | 2008-04-09 | 中华人民共和国徐州出入境检验检疫局 | Concretion mycobacterium nucleic acid screening method based on loop-mediated isothermal amplification technique |
-
2010
- 2010-01-18 CN CN2010100194545A patent/CN101935693B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101157954A (en) * | 2007-09-13 | 2008-04-09 | 中华人民共和国徐州出入境检验检疫局 | Concretion mycobacterium nucleic acid screening method based on loop-mediated isothermal amplification technique |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101935693A (en) | 2011-01-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101935693B (en) | Mycobacterium tuberculosis detection kit and use method thereof | |
| CN101892300B (en) | Klebsiella pneumoniae detection kit and use method thereof | |
| CN101570795B (en) | Mycobacterium tuberculosis gene rapid diagnostic primer based on loop-mediated isothermal amplification technology and use in preparing rapid diagnostic kit | |
| CN101654706B (en) | Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof | |
| CN101942508B (en) | Escherichia coli detection kit and use method thereof | |
| CN102094090B (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN101565753B (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN101555529B (en) | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof | |
| CN102827944B (en) | Mycobacterium detection kit and using method thereof | |
| CN101979660B (en) | Brucella detection kit and using method thereof | |
| CN102719548B (en) | Kit for detecting brucella and use method thereof | |
| CN102251044A (en) | Enterorrhagia colibacillus stx1 gene detection kit and application method thereof | |
| CN102286620A (en) | Enterohemorrhagic E. coli stx2 gene detection kit and using method thereof | |
| CN101892299B (en) | Clostridium perfringen detection kit and user method thereof | |
| CN102146470B (en) | Bacillus anthracis detection kit and using method of kit | |
| CN101824482B (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| CN102154517A (en) | Mulberry silkworm pebrine test kit and using method thereof | |
| CN101403005B (en) | Rapid diagnosis reagent kit and detection method for cholera vibrio gene | |
| CN101824483B (en) | Detection kit for vibrio cholerae O139 group and detection method thereof | |
| CN101403003B (en) | Rapid diagnosis reagent kit and detection method for staphylococcus epidermidis gene | |
| Chitra et al. | Diagnostic Performance of Polymerase Chain Reaction Targeting Insertion Sequence (IS6110) for the Detection of Extra Pulmonary Tuberculosis | |
| CN101418342A (en) | Rapid diagnosis kit of enterocolitis yersinia genus gene based on loop-mediated isothermal amplification technique | |
| CN102559897A (en) | Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof | |
| RU2554842C2 (en) | OLIGONUCLEOTIDE PRIMERS AND METHOD OF IDENTIFICATION OF DNA OF Mycobacterium avium BY METHOD OF POLYMERASE CHAIN REACTION | |
| CN101403002A (en) | Rapid diagnosis reagent kit and detection method for campylobacter jejuni gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |