CN102559897A - Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof - Google Patents
Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof Download PDFInfo
- Publication number
- CN102559897A CN102559897A CN2012100114111A CN201210011411A CN102559897A CN 102559897 A CN102559897 A CN 102559897A CN 2012100114111 A CN2012100114111 A CN 2012100114111A CN 201210011411 A CN201210011411 A CN 201210011411A CN 102559897 A CN102559897 A CN 102559897A
- Authority
- CN
- China
- Prior art keywords
- primer
- nptii gene
- test kit
- bip
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer group for NPT(Noctumal Penile Tumescence)II gene detection, which consists of an outer primer F3, an outer primer B3, an FIP (Forward Inner Primer) and a BIP (Backward Inner Primer); nucleotide sequences of the outer primer F3, the outer primer B3, the FIP and the BIP are respectively shown by SEQ (Sequence) ID (Identity) No. 1-4 or SEQ ID No. 5-9. The primer group has the beneficial effects that whether a target substance exists or not can be judged according to whether to amplify or not, and the specificity is high. The invention also discloses a reagent kit for detecting a NPTII gene, which comprises two pairs of primers, i.e. an FIP/BIP and an outer primer F3/B3, which takes the NPTII gene as a target gene and is designed based on a loop-mediated isothermal amplification technology. The reagent kit has the beneficial effects that the NPTII gene can be quickly detected, the amplification can be carried out only by one constant temperature, a special reagent or equipment is not required, the detection cost is low, and moreover, the sensitivity and the specificity are high. Meanwhile, the invention also discloses a use method of the reagent kit.
Description
Technical field
The present invention relates to biological detection reagent, be specifically related to a kind of NPTII gene test with primer sets, reagent corresponding box and method of use thereof.
Background technology
The NPTII gene is widely used in transgenic crops such as transgenic corns, rape as neomycin phosphotransferase gene.
In order to strengthen supervision and management to transgenic product, developed multiple transgene component detection method at present, from based on proteinic ELISA detection technique to based on the polymerase chain reaction (PCR) of nucleic acid technology and fast-developing biochip technology.Wherein, The PCR detection technique is with its susceptibility, specificity, high efficiency and the most general; This technology is identified through detecting the exogenous nucleic acid fragment that contains in the gene prod; Along with the appearance of fluorescence real-time quantitative polymerase chain projection (real time PCR), not only can carry out the qualitative evaluation of transgenic product, and can carry out quantitatively transgene component.
Also there are some problems in the transgenic product detection technique that with the round pcr is representative in practical application, the instrument special like the regular-PCR Technology Need, and have the shortcoming of easy crossed contamination and complex operation.Though and Real time round pcr has solved the problem of crossed contamination preferably, and simplify operating process, needed more complicated quantitatively determined instrument, therefore be not suitable for field quick detection.And in the real-time quantitative polymerase chain reaction PCR technology, the cost of fluorescent probe is higher, has strengthened the difficulty of applying.Biochip technology can realize quick and high-throughout detection, yet costs an arm and a leg, and it is high to detect cost.Even so the newest fruits of utilization biotech development is significant to the unbroken noodles that satisfies transgenic product detection requirement.Wherein, Isothermal duplication (Isothermal Amplification) nucleic acid Fast Detection Technique is the rapid progress on the transgenic product detection technique; The loop-mediated isothermal amplification technique of at present having set up (loop-mediated isothermal amplication of DNA; Be called for short LAMP), have a lot of meliority, and do not see also that at present useful loop-mediated isothermal amplification technique detects genetically modified crops NPTII gene quick detection kit.
Summary of the invention
The objective of the invention is to solve the weak point of prior art and provide a kind of loop-mediated isothermal amplification technique that can be used for to detect the NPTII gene, and said NPTII gene is had higher specific detection use primer sets.
Another object of the present invention is to provide that a kind of detection cost is low, detection speed is fast, easy to use, the test kit that specificity is high based on the detection NPTII gene of loop-mediated isothermal amplification technique; Simultaneously, the present invention also provides a kind of method of use of said test kit.
The object of the invention can be realized through following technical measures: a kind of NPTII gene test use the said primer sets of primer sets with the NPTII gene as target gene, design based on loop-mediated isothermal amplification technique; Said primer sets is made up of outer primer F3, outer primer B3, inner primer FIP and inner primer BIP, and the nucleotide sequence of each primer is respectively:
Outer primer F3 (1):
GCTGGATCGTTTCGCATGA
Outer primer B3 (1):
GCAGTTCATTCAGGGCACC
Inner primer FIP (1):
GCCCAGTCATAGCCGAATAGCCTTTTGAACAAGATGGATTGCACGC
Inner primer BIP (1):
GACAATCGGCTGCTCTGATGCCTTTTGGACAGGTCGGTCTTGACA
Or
Outer primer F3 (2):
CTGTTCGCCAGGCTCAAG
Outer primer B3 (2):
CGCCAAGCTCTTCAGCAATA
Inner primer FIP (2):
GAAAAGCGGCCATTTTCCACCATTTTGCGAGGATCTCGTCGTGA
Inner primer BIP (2):
GGATTCATCGACTGTGGCCGGTTTTGGTAGCCAACGCTATGTCC。
Primer sets is used in NPTII gene test of the present invention; Be based on loop-mediated isothermal amplification technique; According to NPTII gene order in disclosed transgenic crop and the converted products thereof, choose the specific sequence of NPTII gene in transgenic crop and the converted products thereof, analysis is designed then; The ability specificity is differentiated the Auele Specific Primer group of NPTII gene in transgenic crop and the converted products thereof, identifies the NPTII gene in transgenic crop and the converted products thereof through LAMP.
The present invention also provides a kind of test kit of the NPTII of detection gene, the test kit of said detection NPTII gene comprise with the NPTII gene be target gene, based on two pairs of primers of loop-mediated isothermal amplification technique design: inner primer FIP/BIP and outer primer F3/B3.
As the preferred implementation that detects the test kit of NPTII gene according to the invention, the nucleotide sequence of described two pairs of primers is respectively:
Outer primer F3 (1):
GCTGGATCGTTTCGCATGA
Outer primer B3 (1):
GCAGTTCATTCAGGGCACC
Inner primer FIP (1):
GCCCAGTCATAGCCGAATAGCCTTTTGAACAAGATGGATTGCACGC
Inner primer BIP (1):
GACAATCGGCTGCTCTGATGCCTTTTGGACAGGTCGGTCTTGACA
Or
Outer primer F3 (2):
CTGTTCGCCAGGCTCAAG
Outer primer B3 (2):
CGCCAAGCTCTTCAGCAATA
Inner primer FIP (2):
GAAAAGCGGCCATTTTCCACCATTTTGCGAGGATCTCGTCGTGA
Inner primer BIP (2):
GGATTCATCGACTGTGGCCGGTTTTGGTAGCCAACGCTATGTCC。
As the preferred implementation that detects the test kit of NPTII gene according to the invention, said test kit also comprises BstDNA polysaccharase, reaction solution, stable liquid, colour developing liquid and positive control solution.
The production technique of the test kit of detection NPTII gene according to the invention is:
(1) with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
(2) reaction solution is aseptic subpackaged, and confirm the quality inspection of sampling with carrying out concentration according to experiment;
(3) stable liquid is aseptic subpackaged, the sampling quality inspection;
(4) with the positive control sample preparations, packing, sampling quality inspection;
(5) assembling test kit.
As the preferred embodiment that detects the test kit of NPTII gene according to the invention, described reaction solution is: every 1L reaction solution contains 1.6~2mmol dNTP, 20~25mmol Tris-Cl, 10~12.5mmol Repone K, 10~12.5mmol ammonium sulfate, 8~10mmol sal epsom, 1~1.25ml TritonX-100,0.8~1mol trimethyl-glycine, each 1.6~2mol of inner primer FIP/BIP and each 0.2~0.25mol of outer primer F3/B3;
Described stable liquid is Yellow Protopet 2A;
Described colour developing liquid is SYBR Green I or Eva Green;
Described positive control is the NPTII gene DNA fragment.
As the most preferred embodiment that detects the test kit of NPTII gene according to the invention, described reaction solution is: contain 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol Repone K, 12.5mmol ammonium sulfate, 10mmol sal epsom, 1.25ml TritonX-100,1mol trimethyl-glycine, each 2mol of inner primer FIP/BIP and each 0.25mol of outer primer F3/B3 in every 1L reaction solution.
As the preferred implementation that detects the test kit of NPTII gene according to the invention; The test kit of said detection NPTII gene also comprises reaction tubes; Described reaction tubes covers two portions by body with pipe to be formed, and the bottom of tube cavity is provided with the dividing plate of the longitudinal extension that is divided into A, two cavitys of B.
As the more preferably embodiment that detects the test kit of NPTII gene according to the invention; Working fluid or colour developing liquid are housed respectively in described A, two cavitys of B; Seal up for safekeeping by stable liquid on liquid upper strata in two cavitys, and said working fluid is mixing of reaction solution and BstDNA polysaccharase.
Loop-mediated isothermal amplification technique (LAMP) be a kind of fast, sensitive, detection of nucleic acids mode accurately, its amplification efficiency is stronger, shows two aspects: what (1) remolding sensitivity PCR exceeded is the difference of the order of magnitude; (2) the DNA quantity of amplified production also exceeds too much than PCR product, can reach several μ g; But too sensitive and product amount is huge; Make LAMP pollute very easily easily, especially behind the LAMP amplified reaction, need the reaction tubes adding developer of uncapping, occur aerosol easily and pollute.And the aerosol pollution can make the detected result false positive rate high, and pollutes other samples, and the pollution detection zone also is difficult to remove simultaneously.Reaction tubes of the present invention is through the design of dividing plate and stable liquid; To develop the color effectively liquid and working fluid separated, and can not only guarantee the closure that in storage and transport process, is kept perfectly relatively, and need not to open the pipe lid; Just can realize coupling reaction, reduce aerocolloidal pollution greatly.
The present invention also provides a kind of method of using the test kit that detects the NPTII gene, and this method may further comprise the steps:
(1) preparation testing sample DNA;
(2) in reaction tubes, add reaction solution 38~40 volume %, BstDNA polysaccharase 0.9~1.8 volume %, stable liquid 52~54.5 volume %, sample template DNA4.5~9 volume %, isothermal reaction;
(3) in above-mentioned reaction tubes and positive controls, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative;
Reaction solution in the said step (2) contain with the NPTII gene be target gene, based on two pairs of primers of loop-mediated isothermal amplification technique design: inner primer FIP/BIP and outer primer F3/B3.
Use the preferred implementation of the method for the test kit that detects the NPTII gene as the present invention, in the said step (2), the temperature of said isothermal reaction is 63~65 ℃, and the reaction times is 45~90min.
In the method for the test kit of use detection NPTII gene according to the invention; Said step (1) preparation testing sample DNA is: the extraction of DNA and assay are carried out by the regulation among the GB GB/T 19495.3-2004 in the testing sample; When sample is carried out DNA extraction; Guarantee quality and the steady concentration of DNA, to guarantee the repeatability of LAMP reaction, the dna fragmentation of guaranteeing to extract is greater than amplified fragments; Volume % in the said step (2) is meant the volume percent that accounts for four component TVs.
According to the invention based on loop-mediated isothermal amplification technique (loop-mediated isothermal amplication of DNA; Abbreviation LAMP) method of rapid detection NPTII gene; It is the special inside and outside primer (being inner primer FIP/BIP and outer primer F3/B3) of two couples that utilizes the BstDNA polysaccharase and design according to target-gene sequence; Six isolated areas on the specific recognition target sequence; Start the endless chain replacement(metathesis)reaction, start complementary strand in target DNA district synthetic, and result's complementary sequence on same chain goes round and begins again and is formed with the very stem of polycyclic Cauliflower structure-circular DNA mixture.In the LAMP reaction process, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product---Pyrophosphate phosphohydrolase milky white precipitate, can be through the visual inspection result of determination.The LAMP reaction is under constant temperature (63~65 ℃) condition, to accomplish in 45~90 minutes.This comparatively gentle temperature condition and do not have temperature cycle that required instrument is oversimplified, overcome conventional P CR inherent detection time long, pollute easily and detect shortcoming such as cost height.In addition, this detection method is lower to testing staff's technical quality requirement, and actually operating is very easy, does not need special test kit plant and instrument, helps setting up rapid screening system with low cost.The LAMP method be a kind of simple, fast, the gene amplification method of high degree of specificity.The constant temperature gene amplification technology is compared with round pcr (comprising fluorescence real-time quantitative PCR); Can find and technology on methodology indexs such as sensitivity, specificity and sensing range, to be equivalent to or to be superior to round pcr; And do not rely on any special plant and instrument and can realize on-the-spot high-throughput rapid detection, and detect cost far below fluorescent quantitative PCR technique.
The present invention compared with prior art has following beneficial effect: 1, the test kit of detection NPTII gene of the present invention, only need just ability amplified reaction of a steady temperature, and do not need special reagent and equipment, it is low to detect cost; 2, the test kit of detection according to the invention NPTII gene is used six sections, four primers, and whether the existence that can judge target substance according to whether increasing to be, therefore has high specific; 3, the test kit of detection of the present invention NPTII gene, amplification fast and efficient can accomplish amplification less than one hour, and productive rate are high; 4, the test kit of detection of the present invention NPTII gene is highly sensitive, and amplification template only needs 10 copies or still less; 5, the test kit of detection of the present invention NPTII gene identify easy, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product---the magnesium pyrophosphate deposition, can identify through visual inspection, and after adding colour developing liquid, yin and yang attribute structure coloring significant difference, the checking rate is high, and is more obviously reliable.
Embodiment
For the object of the invention, technical scheme and advantage better are described, the present invention is done further elaboration below in conjunction with specific embodiment.
Embodiment 1 detects the preparation of the test kit of NPTII gene
(1) synthesize the oligodeoxynucleotide primer by following sequence through dna synthesizer:
Outer primer F3 (1): (SEQ ID NO 1)
GCTGGATCGTTTCGCATGA
Outer primer B3 (1): (SEQ ID NO 2)
GCAGTTCATTCAGGGCACC
Inner primer FIP (1): (SEQ ID NO 3)
GCCCAGTCATAGCCGAATAGCCTTTTGAACAAGATGGATTGCACGC
Inner primer BIP (1): (SEQ ID NO 4)
GACAATCGGCTGCTCTGATGCCTTTTGGACAGGTCGGTCTTGACA
(2) purchase archaeal dna polymerase: BstDNApolymerase (big fragment) places container;
(3) preparation reaction solution: the prescription of reaction solution contains each 0.25mol preparation of 2mmoldNTP, 25mmolTris-Cl, 12.5mmol Repone K, 12.5mmol ammonium sulfate, 10mmol sal epsom, 1.25ml TritonX-100,1mol trimethyl-glycine, each 2mol of inner primer FIP/BIP and outer primer F3/B3 according to every 1L solution, places container;
(4) purchase stable liquid: Yellow Protopet 2A places container;
(5) purchase colour developing liquid: SYB Green I places container;
(6) extract positive control: preparation NPTII gene DNA fragment places container respectively;
(7) above-mentioned 5 containers are dressed up test kit, encapsulation.
Preparation technology is summarized as follows:
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, reaction solution is aseptic subpackaged, and confirm the quality inspection of sampling with carrying out concentration according to experiment;
3, with the stable liquid packing, the sampling quality inspection;
4, with the positive control sample preparations, packing, sampling quality inspection;
5, assembling test kit.
Embodiment 2 detects the preparation of the test kit of NPTII gene
Reaction solution places container by containing each 0.2mol preparation of 1.6mmoldNTP, 20mmol Tris-Cl, 10mmol Repone K, 10mmol ammonium sulfate, 8mmol sal epsom, 1ml TritonX-100,0.8mol trimethyl-glycine, each 1.6mol of inner primer FIP/BIP and outer primer F3/B3 among every 1L.
Colour developing liquid is Eva Green.
Other are with embodiment 1.
Embodiment 3 detects the preparation of the test kit of NPTII gene
Other conditions are identical with embodiment 1, and its difference only is that the primer in the step (1) is:
Outer primer F3 (2): (SEQ ID NO 5)
CTGTTCGCCAGGCTCAAG
Outer primer B3 (2): (SEQ ID NO 6)
CGCCAAGCTCTTCAGCAATA
Inner primer FIP (2): (SEQ ID NO 7)
GAAAAGCGGCCATTTTCCACCATTTTGCGAGGATCTCGTCGTGA
Inner primer BIP (2): (SEQ ID NO 8)
GGATTCATCGACTGTGGCCGGTTTTGGTAGCCAACGCTATGTCC。
Embodiment 4 detects the application of the test kit of NPTII gene
Present embodiment adopts the detection NPTII kit gene of embodiment 1 preparation to carry out the detection of NPTII gene in the testing sample.
1, sample preparation (template DNA extraction)
(1) with 100mg through pretreated sample, the last adding 700 μ LCTAB of in liquid nitrogen, fully pulverizing extract among the damping fluid I (sample that need not grind directly adds), vibration back mixing, 65 ℃ of insulation 30min light and slow frequently put upside down mixing 2-3 time therebetween;
(2) add 700 μ L trichloromethane-primary isoamyl alcohol, light and slowly put upside down mixing solution 2-3 time, the centrifugal 5min of 12000g is to phase-splitting;
(3) supernatant is transferred in the clean centrifuge tube, adds the Virahol of 4 ℃ of precoolings of 0.6 times of volume, leave standstill 5min, the centrifugal 5min of 12000g in-20 ℃;
(4) abandon supernatant, add 1000 μ L70% ethanol, rotate centrifuge tube gently, 4 ℃ of centrifugal 1min of following 8000g, abandon supernatant after, add 20 μ L Rnase A enzymes (10 μ g/ μ L) again, 37 ℃ of temperature are bathed 30min;
(5) add 600 μ L sodium chloride solutions, 65 ℃ of temperature are bathed 10min, add the saturated phenol of 600 μ L trichloromethane-Tris, put upside down mixing after, the centrifugal 5min of 12000g shifts supernatant to the 1.5ml centrifuge tube;
(6) add the Virahol of 4 ℃ of precoolings of 0.6 times of volume of people, leave standstill 30min, the centrifugal 10min of 12000g, abandoning supernatant in 4 ℃;
(7) add 4 ℃ of precooling 70% ethanol of 1000 μ L, rotate centrifuge tube gently, 4 ℃ of centrifugal 10min of following 12000g abandon supernatant; Repeat single job, volatilised liq under the room temperature;
(8) after the deposition drying, add the abundant dissolving DNA of 50 μ L TE damping fluids ,-20 ℃ of preservations are subsequent use.
2, the reaction process of loop-mediated isothermal amplification technique
(1) in 200 μ L reaction tubess preparation reaction system: reaction solution 22 μ L, Bst archaeal dna polymerase 0.5 μ L (4U), template DNA 2.5 μ L;
(2) with the reaction tubes for preparing in 64 ℃ of isothermal reaction 1h.
3, post-reaction treatment
In above-mentioned PCR reaction product, add 2 μ L SYBR Green I mixings, if the same shows green with control tube of reaction tubes is then positive, if reaction tubes manifests orange then negative.
Embodiment 5 adopts the detection NPTII kit gene of reaction tubes
The detection NPTII kit gene of present embodiment; The test kit primer that adopts is identical with embodiment 3; Test kit also comprises reaction tubes, and reaction tubes covers two portions by body with pipe to be formed, and the bottom of tube cavity is provided with the dividing plate of the longitudinal extension that is divided into A, two cavitys of B; Wherein: the LAMP reaction solution of 22.0 μ L and the BstDNA polysaccharase of 0.5 μ L are housed in the cavity A, and the liquid upper strata is sealed up for safekeeping by paraffin; The LAMP reaction solution liquid of 2.0 μ L is housed in the cavity B, and the liquid upper strata is also sealed up for safekeeping by paraffin, with this reaction tubes-20 ℃ preservation.
Present embodiment adopts reaction tubes as container, the NPTII gene is carried out LAMP detect, and is provided with positive controls and negative control group simultaneously, specifically comprises the steps:
Get three of the reaction tubess of above-mentioned preparation; Adopt liquid-transfering gun to add each 2.5 μ L of negative control sample, detected sample and positive control sample respectively, rifle head pierce through the protection liquid layer during application of sample, sample adds in the reaction tubes A chamber; Tight pipe lid of lid and marked move to reaction zone.
With above-mentioned reaction tubes all in 65 ℃ of isothermal reaction 1h.
Reaction finishes, and reaction tubes is inverted whipping 1 time, is just putting whipping again 1 time, and working fluid and colour developing liquid thorough mixing are evenly observed the back.
If the same shows green with the positive control pipe of reaction tubes is then positive, as if reaction tubes the same with the negative control pipe manifest orange then negative.
In the LAMP reaction process, colour developing liquid and working fluid sealed state is good, not have to take place situation about revealing mutually, and the later stage is during coupling reaction, is inverted the whipping operation and makes colour developing liquid and working fluid mixing, and the result that develops the color is clear.
Embodiment 6 detects the specificity checking of NPTII kit gene
Present embodiment adopts the test kit of the embodiment 1 and the detection NPTII gene of embodiment 3 preparations to carry out the specificity checking of test kit.
Adopt the test kit of the embodiment 1 and the detection NPTII gene of embodiment 3 preparations, respectively to soybean non-transgenic sample W794, rice non-transgenic sample W818, rape non-transgenic sample W2194, rape transgenic sample W375, Semen Brassicae campestris transgenic sample W574, corn gene sample W968 and ddH
2O increases, and each sample is provided with 2 repetitions.
Reaction system is: reaction solution 22 μ L, BstDNA polysaccharase 0.5 μ L, stable liquid 30 μ L and dna profiling 2.5 μ L.
Response procedures: in the metal bath 65 ℃, 1 hour.
After finishing, reaction adds colour developing liquid 2.0 μ L, observations, and as shown in table 1.
Table 1 test kit specific detection result
In the above-mentioned table 1, P representative amplification is positive, and N representative amplification is negative.
Can find out from the result of table 1; In the reaction that contains rape transgenic sample W375 DNA, Semen Brassicae campestris transgenic sample W574 DNA, corn gene sample W968 DNA, can amplify the product of target gene; It is positive to present amplification, and is containing soybean non-transgenic sample W794 DNA, rice non-transgenic sample W818 DNA, rape non-transgenic sample W2194 DNA and ddH
2All can not amplify product among the O, it is negative to present amplification, explanation thus, the test kit of detection NPTII gene of the present invention has high specific, can be correct identify the transgenic sample that contains the NPTII gene.
Last institute should be noted that; Above embodiment is only in order to technical scheme of the present invention to be described but not to the restriction of protection domain of the present invention; Although the present invention has been done detailed description with reference to preferred embodiment; Those of ordinary skill in the art should be appreciated that and can make amendment or be equal to replacement technical scheme of the present invention, and do not break away from the essence and the scope of technical scheme of the present invention.
Claims (10)
1. primer sets is used in a NPTII gene test; It is characterized in that; Said primer sets is target gene, designs based on loop-mediated isothermal amplification technique with the NPTII gene; Said primer sets is made up of outer primer F3, outer primer B3, inner primer FIP and inner primer BIP, and the nucleotide sequence of each primer is respectively:
Outer primer F3 (1):
GCTGGATCGTTTCGCATGA
Outer primer B3 (1):
GCAGTTCATTCAGGGCACC
Inner primer FIP (1):
GCCCAGTCATAGCCGAATAGCCTTTTGAACAAGATGGATTGCACGC
Inner primer BIP (1):
GACAATCGGCTGCTCTGATGCCTTTTGGACAGGTCGGTCTTGACA
Or
Outer primer F3 (2):
CTGTTCGCCAGGCTCAAG
Outer primer B3 (2):
CGCCAAGCTCTTCAGCAATA
Inner primer FIP (2):
GAAAAGCGGCCATTTTCCACCATTTTGCGAGGATCTCGTCGTGA
Inner primer BIP (2):
GGATTCATCGACTGTGGCCGGTTTTGGTAGCCAACGCTATGTCC。
2. a test kit that detects the NPTII gene is characterized in that, the test kit of said detection NPTII gene comprise with the NPTII gene be target gene, based on two pairs of primers of loop-mediated isothermal amplification technique design: inner primer FIP/BIP and outer primer F3/B3.
3. the test kit of detection NPTII gene as claimed in claim 2 is characterized in that the nucleotide sequence of described two pairs of primers is respectively:
Outer primer F3 (1):
GCTGGATCGTTTCGCATGA
Outer primer B3 (1):
GCAGTTCATTCAGGGCACC
Inner primer FIP (1):
GCCCAGTCATAGCCGAATAGCCTTTTGAACAAGATGGATTGCACGC
Inner primer BIP (1):
GACAATCGGCTGCTCTGATGCCTTTTGGACAGGTCGGTCTTGACA
Or
Outer primer F3 (2):
CTGTTCGCCAGGCTCAAG
Outer primer B3 (2):
CGCCAAGCTCTTCAGCAATA
Inner primer FIP (2):
GAAAAGCGGCCATTTTCCACCATTTTGCGAGGATCTCGTCGTGA
Inner primer BIP (2):
GGATTCATCGACTGTGGCCGGTTTTGGTAGCCAACGCTATGTCC。
4. the test kit of detection NPTII gene as claimed in claim 2 is characterized in that said test kit also comprises BstDNA polysaccharase, reaction solution, stable liquid, colour developing liquid and positive control solution.
5. the test kit of detection NPTII gene as claimed in claim 4 is characterized in that,
Described reaction solution is: every 1L reaction solution contains 1.6~2mmol dNTP, 20~25mmol Tris-Cl, 10~12.5mmol Repone K, 10~12.5mmol ammonium sulfate, 8~10mmol sal epsom, 1~1.25mlTritonX-100,0.8~1mol trimethyl-glycine, each 1.6~2mol of inner primer FIP/BIP and each 0.2~0.25mol of outer primer F3/B3;
Described stable liquid is Yellow Protopet 2A;
Described colour developing liquid is SYBR Green I or Eva Green;
Described positive control is the NPTII gene DNA fragment.
6. the test kit of detection NPTII gene as claimed in claim 5; It is characterized in that described reaction solution is: contain 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol Repone K, 12.5mmol ammonium sulfate, 10mmol sal epsom, 1.25ml TritonX-100,1mol trimethyl-glycine, each 2mol of inner primer FIP/BIP and each 0.25mol of outer primer F3/B3 in every 1L reaction solution.
7. like claim 4, the 5 or 6 described test kits that detect the NPTII genes; It is characterized in that; The test kit of said detection NPTII gene also comprises reaction tubes; Described reaction tubes covers two portions by body with pipe to be formed, and the bottom of tube cavity is provided with the dividing plate of the longitudinal extension that is divided into A, two cavitys of B.
8. the test kit of detection NPTII gene as claimed in claim 7; It is characterized in that; Working fluid or colour developing liquid are housed respectively in described A, two cavitys of B, and seal up for safekeeping by stable liquid on the liquid upper strata in two cavitys, and said working fluid is mixing of reaction solution and BstDNA polysaccharase.
9. the method for use like the said test kit of claim 4 is characterized in that, may further comprise the steps:
(1) preparation testing sample DNA;
(2) in reaction tubes, add reaction solution 38~40 volume %, BstDNA polysaccharase 0.9~1.8 volume %, stable liquid 52~54.5 volume %, sample template DNA4.5~9 volume %, isothermal reaction;
(3) in above-mentioned reaction tubes and positive controls, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative;
Reaction solution in the said step (2) contain with the NPTII gene be target gene, based on two pairs of primers of loop-mediated isothermal amplification technique design: inner primer FIP/BIP and outer primer F3/B3.
10. the method for use of test kit as claimed in claim 9 is characterized in that, in the step (2), the temperature of said isothermal reaction is 63~65 ℃, and the reaction times is 45~90min.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201210011411 CN102559897B (en) | 2012-01-13 | 2012-01-13 | Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201210011411 CN102559897B (en) | 2012-01-13 | 2012-01-13 | Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102559897A true CN102559897A (en) | 2012-07-11 |
CN102559897B CN102559897B (en) | 2013-07-10 |
Family
ID=46406497
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201210011411 Active CN102559897B (en) | 2012-01-13 | 2012-01-13 | Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102559897B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103436599A (en) * | 2013-04-29 | 2013-12-11 | 唐食明 | LAMP detection primer group of NPT II marker screening gene, kit and detection method |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1470649A (en) * | 2002-07-26 | 2004-01-28 | 深圳市匹基生物工程股份有限公司 | Primer sequence for NptII gene containing transgenic crop nucleic acid amplification |
CN101260440A (en) * | 2008-04-25 | 2008-09-10 | 山东出入境检验检疫局检验检疫技术中心 | Sensor detecting method for neomycin phosphoric acid transferase gene in transgene plants |
CN101712924A (en) * | 2009-12-18 | 2010-05-26 | 广州华峰生物科技有限公司 | Reaction tube used in loop-mediated isothermal amplification technique and use method thereof |
CN101838685A (en) * | 2009-12-18 | 2010-09-22 | 广州华峰生物科技有限公司 | Primer group for testing Roundup Ready transgenic soy bean EPSPS gene, rapid diagnosis kit and testing method thereof |
CN102286620A (en) * | 2011-07-27 | 2011-12-21 | 广州华峰生物科技有限公司 | Enterohemorrhagic E. coli stx2 gene detection kit and using method thereof |
-
2012
- 2012-01-13 CN CN 201210011411 patent/CN102559897B/en active Active
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1470649A (en) * | 2002-07-26 | 2004-01-28 | 深圳市匹基生物工程股份有限公司 | Primer sequence for NptII gene containing transgenic crop nucleic acid amplification |
CN101260440A (en) * | 2008-04-25 | 2008-09-10 | 山东出入境检验检疫局检验检疫技术中心 | Sensor detecting method for neomycin phosphoric acid transferase gene in transgene plants |
CN101712924A (en) * | 2009-12-18 | 2010-05-26 | 广州华峰生物科技有限公司 | Reaction tube used in loop-mediated isothermal amplification technique and use method thereof |
CN101838685A (en) * | 2009-12-18 | 2010-09-22 | 广州华峰生物科技有限公司 | Primer group for testing Roundup Ready transgenic soy bean EPSPS gene, rapid diagnosis kit and testing method thereof |
CN102286620A (en) * | 2011-07-27 | 2011-12-21 | 广州华峰生物科技有限公司 | Enterohemorrhagic E. coli stx2 gene detection kit and using method thereof |
Non-Patent Citations (2)
Title |
---|
TSUGUNORI NOTOMI ET AL.: "Loop-mediated isothermal amplification of DNA", 《NUCLEIC ACIDS RESEARCH》 * |
王永等: "转基因作物外源转基因成分环介导等温扩增技术检测方法的建立及应用", 《中国农业科学》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103436599A (en) * | 2013-04-29 | 2013-12-11 | 唐食明 | LAMP detection primer group of NPT II marker screening gene, kit and detection method |
CN103436599B (en) * | 2013-04-29 | 2015-05-20 | 唐食明 | LAMP detection primer group of NPT II marker screening gene, kit and detection method |
Also Published As
Publication number | Publication date |
---|---|
CN102559897B (en) | 2013-07-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101892300B (en) | Klebsiella pneumoniae detection kit and use method thereof | |
CN101935693B (en) | Mycobacterium tuberculosis detection kit and use method thereof | |
CN101660005B (en) | Rapid diagnostic kit based on loop-mediated isothermal amplification technique for hepatitis A virus genes and detection method thereof | |
CN101654706B (en) | Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof | |
CN101942508B (en) | Escherichia coli detection kit and use method thereof | |
CN102094090A (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
CN101403001A (en) | Rapid diagnosis reagent kit and detection method for pseudomonas aeruginosa gene | |
CN101307356A (en) | Rapid diagnosis kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
CN102140516B (en) | Primer for detecting CAMV35S genes, relevant kit and detecting method | |
CN102559897B (en) | Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof | |
CN101979660B (en) | Brucella detection kit and using method thereof | |
CN107988327A (en) | The dry powdered LAMP quick detection kits of Shigella | |
CN101892299B (en) | Clostridium perfringen detection kit and user method thereof | |
CN102719548B (en) | Kit for detecting brucella and use method thereof | |
CN102154517A (en) | Mulberry silkworm pebrine test kit and using method thereof | |
CN102827944B (en) | Mycobacterium detection kit and using method thereof | |
CN101824482A (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
CN101403005B (en) | Rapid diagnosis reagent kit and detection method for cholera vibrio gene | |
CN103602725B (en) | Loop-mediated isothermal amplification primer for sesame component, kit and applications of the primer | |
CN103484456B (en) | Loop-mediated isothermal amplification primer and kit for detecting apium graveolens ingredients and application of loop-mediated isothermal amplification primer | |
CN102146470B (en) | Bacillus anthracis detection kit and using method of kit | |
CN106480015A (en) | A kind of method of extracellular dna in high efficiency extraction deposit | |
CN102031302A (en) | Method for quickly detecting pathogen of skin ulcerative syndrome in Apostichopus japonicus on site and kit thereof | |
CN101403004B (en) | Rapid diagnosis reagent kit and detection method for vibrio vulnficus gene | |
CN101403003B (en) | Rapid diagnosis reagent kit and detection method for staphylococcus epidermidis gene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20120711 Assignee: Guangzhou caino Biological Technology Co. Ltd. Assignor: Guangzhou Huafeng Biotech Co., Ltd. Contract record no.: 2015440000869 Denomination of invention: Primer set for detecting NPT II gene, corresponding reagent box and using method thereof Granted publication date: 20130710 License type: Exclusive License Record date: 20151224 |
|
LICC | Enforcement, change and cancellation of record of contracts on the licence for exploitation of a patent or utility model |