CN102827944B - Mycobacterium detection kit and using method thereof - Google Patents
Mycobacterium detection kit and using method thereof Download PDFInfo
- Publication number
- CN102827944B CN102827944B CN201210352230.5A CN201210352230A CN102827944B CN 102827944 B CN102827944 B CN 102827944B CN 201210352230 A CN201210352230 A CN 201210352230A CN 102827944 B CN102827944 B CN 102827944B
- Authority
- CN
- China
- Prior art keywords
- mycobacterium
- detection kit
- primer
- bip
- mycobacterium detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a mycobacterium detection kit which comprises two pairs of primers including internal primer FIP/ BIP and external primer F3/ B3; and the primers take mycobacterium hsp65 as a target gene and are designed based on a loop-mediated isothermal amplification technology. The mycobacterium detection kit is more comprehensive in detection effect and low in undetected rate.
Description
Technical field
The present invention relates to biological detection reagent, be specifically related to a kind of Mycobacterium detection kit and using method thereof.
Background technology
Mycobacterium (Mycobacterium) is the elongated slightly crooked bacillus of a class, has the trend of minute branch growth, thereby gains the name.This Pseudomonas kind is more, can be divided into mycobacterium tuberculosis complex, non-tuberculous mycobacteria and Mycobacterium leprae three classes.
Mycobacterium tuberculosis (M.tuberculosis), is commonly called as tubercule bacillus or tubercule bacillus, is to cause pathogenic bacteria lungy.Tuberculosis is the serious infectious diseases that threaten the mankind and animal health.The World Health Organization (WHO) has issued global Control strategy specially, and being decided to be the World Tuberculosis Prevention and Cure Day on annual March 24.
Corresponding with mycobacterium tuberculosis complex is various non-tuberculous mycobacterias, has found at present to be extensively present in soil, environment, animal hundreds of.2000 the 4th time national tuberculosis epidemiological random sampling survey report shows, the existing active tuberculosis patient 4,510,000 of China, bacterium sun lunger 1,960,000.Mycobacterium is cultivated in positive, and mycobacterium tuberculosis accounts for 86.4%, and mycobacterium tuberculosis var bovis accounts for 2.5%, and non-tuberculous mycobacteria accounts for 11.1%.And nineteen ninety Third National tuberculosis stream timing non-tuberculous mycobacteria only account for 4.9%, as can be seen here, the ratio of non-tuberculous mycobacteria obviously increases before.Non-tuberculous mycobacteria patient, to most of line antitubercular agent resistances, adopts the chemotherapy regimen of current standard to fail to respond to any medical treatment.Traditional mycobacteria strain identification and drug sensitivity experimental technique is based upon to be cultivated on basis, loaded down with trivial details, time-consuming, need 1～2 month, can not meet the clinical early stage effectively needs of chemotherapy of carrying out, make non-tuberculous mycobacteria patient through long-term rule chemotherapy and unsatisfactory curative effect, extend the course for the treatment of, becomes refractory, controls patient again, and bacterium may be sent out in part.Therefore, the Rapid identification of Mycobacterium is propagated and is had extremely important meaning the early diagnosis of tuberculosis and Nontuberculous mycobacterial infections, differential diagnosis, effective chemotherapy and control.
Tradition mycobacterium detection method, because the shortcomings such as its sense cycle is long, program is complicated, required reagent is various can not meet modern measure requirement far away.There are in actual applications some problems in the cause of disease nucleic acid detection technique that polymerase chain reaction (PCR) technology of take is representative, as the special instrument of Common Polymerase Chain Reaction (PCR) Technology Need, and there is easy crossed contamination and the loaded down with trivial details shortcoming of operating process.And Fluorescence quantitative real-time polymerase chain reaction (real time PCR) has been although technology has solved the problem of crossed contamination preferably, and simplify operating process, needed more complicated quantitative assay instrument, be not therefore suitable for field quick detection.And in real-time quantitative polymerase chain reaction PCR technology, the cost of fluorescent probe is higher, has strengthened the difficulty of applying.Immunology detection technology is fast and convenient with low cost, but requires the monoclonal antibody of high quality high stability, otherwise because accuracy is inadequate, can only be auxiliary detection means at present.So the newest fruits of using in time biotech development is significant to improving constantly of meeting that the pathogenic microorganism examination requires.Wherein constant-temperature amplification (Isothermal Amplification) nucleic acid Fast Detection Technique is the rapid progress on cause of disease nucleic acid detection technique, and the loop-mediated isothermal amplification technology of now having set up (LAMP) has a lot of superiority.
Therefore, need a kind of detect effect more comprehensively, specificity is high, loss is low Mycobacterium detection kit and using method thereof to be to address the above problem.
Summary of the invention
The object of the invention is to solve the deficiencies in the prior art part and provide a kind of detect effect more comprehensively, specificity is high, loss is low Mycobacterium detection kit.
Object of the present invention can realize by following technical measures: a kind of Mycobacterium detection kit, described Mycobacterium detection kit comprises that take the hsp65 gene of Mycobacterium is target gene, two pairs of primers based on loop-mediated isothermal amplification technology design: inner primer FIP/BIP and outer primer F3/B3, two pairs of described primers are
Outer primer F3:(SEQ ID NO 1)
TCATCACCGTCGAGGAGTC
Outer primer B3:(SEQ ID NO 2)
CGGCTCCGATGACCTTCTC
Inner primer FIP:(SEQ ID NO 3)
GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC
Inner primer BIP:(SEQ ID NO 4)
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG；
Or
Outer primer F3 ': (SEQ ID NO 5)
AGTCCATCGGTGACCTGATC
Outer primer B3 ': (SEQ ID NO 6)
AGGACCGCCTCCTGAC
Inner primer FIP ': (SEQ ID NO 7)
GGTGTTGGACTCCTCGACGGGCCGAGGCGATGGACAA
Inner primer BIP ': (SEQ ID NO 8)
GCAGCTCGAGCTCACCGAGCGGGTCGGTCACGAAGT；
Or
Outer primer F3 ": (SEQ ID NO 1)
TCATCACCGTCGAGGAGTC
Outer primer B3 ": (SEQ ID NO 9)
AGCGGCAGCAGRTCCT
Inner primer FIP ": (SEQ ID NO 10)
CGGTCACGAAGTACCCCGAGATCTGCAGCTCGAGCTCACC
Inner primer BIP ": (SEQ ID NO 4)
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG；
Wherein, V represents A/C/G, and R represents A/G.
The present invention is directed to the hsp65 gene design primer of Mycobacterium, described hsp65 gene is 65kDa heat shock protein(HSP) (heat shock protein) gene, because this gene high conservative is also extensively present in each Mycobacterium bacterial classification, therefore its primer can increase and detect mycobacterium tuberculosis complex and all bacterial classifications of non-tuberculous mycobacteria, comprising: mycobacterium tuberculosis (M.tuberculosis), mycobacterium microti (M.microti), mycobacterium africanum (M.africanum), Mycobacterium bovis (M.bovis), mycobacterium kansasii (M.kansasii), Mycobacterium intracellulare (M.intracellulare), Mycobacterium chelonei (M.chelonae), mycobacterium fortutitum (M.fortuitum), mycobacterium gordonae (M.gordonae), Mycobacterium marinum (M.marinum), M. smegmatics (M.smegmatis), mycobacterium terrae (M.terrae), mycobacterium avium (M.avium), Mycobacterium phlei (M.phlei), scrofula mycobacterium (M.scrofulaceum), mycobacterium abscessus (M.abscessus), mycobacterium buruli (M.ulcerans), Amur mycobacterium (M.shimoidei), Asia mycobacterium (M.asiaticum), mycobacterium xenopi (M.xenopi), mycobacterium gastri (M.gastri).
As the preferred implementation of Mycobacterium detection kit of the present invention, described Mycobacterium detection kit also comprises BstDNA polysaccharase, reaction solution, stable liquid, sample pretreatment liquid, nitrite ion and positive control solution.
As the more preferably embodiment of Mycobacterium detection kit of the present invention,
Described BstDNA polysaccharase: enzyme concn 4-10U/ μ L;
Described reaction solution contains: 1.6～2mmol/L dNTP, 20～25mmol/L Tris-HCl, 10～12.5mmol/L KCl, 10～12.5mmol/L(NH
4)
2sO
4, 8～10mmol/L MgSO
4, 0.1～0.125 volume %TritonX-100,0.8～1mol/L trimethyl-glycine;
Described sample pretreatment liquid contains: the Tris-HCl of 10～20mmol/L pH 8.0,1～2mmol/LEDTA and 1～1.2 volume %Triton X-100;
Described nitrite ion is SYBR Green I or Eva Green;
Described stable liquid is paraffin oil;
Described positive control is BCG genomic dna;
Described inner primer FIP/BIP is respectively 0.2～0.25 μ mol/L, and the concentration of outer primer F3/B3 is respectively 1.2～2.0 μ mol/L.
As the most preferred embodiment of Mycobacterium detection kit of the present invention,
Described BstDNA polysaccharase: enzyme concn 8U/ μ L;
Described reaction solution contains: 2mmol/L dNTP, 25mmol/L Tris-HCl, 12.5mmol/L KCl, 12.5mmol/L(NH
4)
2sO
4, 10mmol/L MgSO
4, 0.125 volume %TritonX-100,1mol/L trimethyl-glycine;
Described sample pretreatment liquid contains: the Tris-HCl of 20mmol/L pH 8.0,2mmol/L EDTA and 1.2 volume %Triton X-100;
Described nitrite ion is SYBR Green I;
The concentration of described inner primer FIP/BIP is 0.2 μ mol/L;
The concentration of described outer primer F3/B3 is 1.6 μ mol/L.
Preferred implementation as Mycobacterium detection kit of the present invention, described Mycobacterium detection kit also comprises reaction tubes, described reaction tubes covers two portions by body and pipe and forms, and the bottom of tube cavity is provided with the dividing plate extending longitudinally that is divided into A, two cavitys of B.
More preferably embodiment as Mycobacterium detection kit of the present invention, in described A, two cavitys of B, working fluid or nitrite ion are housed respectively, seal up for safekeeping by stable liquid on liquid upper strata in two cavitys, and described working fluid is mixing of reaction solution and BstDNA polysaccharase.
Loop-mediated isothermal amplification technology (LAMP) is a kind of quick, sensitive, detection of nucleic acids mode accurately, and its amplification efficiency is superpower, shows two aspects: what (1) remolding sensitivity PCR exceeded is the difference of the order of magnitude; (2) the DNA quantity of amplified production, also exceeds too much than PCR product, can reach several μ g, but too sensitive and product amount is huge, LAMP is extremely easily polluted, especially after LAMP amplified reaction, need reaction tubes to uncap and add developer, easily occur Aerosol Pollution.And Aerosol Pollution can make detected result false positive rate high, and pollute other samples, pollution detection region is also difficult to remove simultaneously.Reaction tubes of the present invention is by the design of dividing plate and stable liquid, effectively nitrite ion and working fluid are separated, can not only be guaranteed relatively to keep complete closure in storage and transport process, and without opening pipe lid, just can realize color reaction, greatly reduce aerocolloidal pollution.
The present invention also provides a kind of using method of Mycobacterium detection kit, and the method comprises the steps:
(1) testing sample is centrifugal, remove supernatant, be precipitated;
(2) precipitation of step (1) is added to sample pretreatment liquid, mix, cooled on ice after boiling water bath deactivation, high speed centrifugation, supernatant is sample template DNA;
(3) in reaction vessel, add Bst archaeal dna polymerase 0.9～1.8 volume parts, reaction solution 38 ~ 40 volume parts, stable liquid 52～54.5 volume parts, sample template DNA 4.5 ~ 9 volume parts, each 2 volume parts of inner primer FIP/BIP, each 4 volume parts of outer primer F3/B3, isothermal reaction;
(4) in above-mentioned reaction vessel and positive control, add respectively nitrite ion, mix, sample sets colour developing is identical with control group positive, otherwise negative;
Inner primer FIP/BIP in described step (3) and outer primer F3/B3 are target gene, two pairs of primers based on loop-mediated isothermal amplification technology design for take the hsp65 gene of Mycobacterium.
As the present invention, use the preferred implementation of the method for Mycobacterium detection kit, in step (3), the reaction conditions of isothermal reaction is 63～65 ℃ of temperature, reaction times 45～90min.
The present invention is said based on loop-mediated isothermal amplification technology (loop-mediated isothermal amplication of DNA, abbreviation LAMP) method of rapid detection Mycobacterium, be utilize BstDNA polysaccharase and according to two couple of target-gene sequence design special in, outer primer (being inner primer FIP/BIP and outer primer F3/B3), six isolated areas on specific recognition target sequence, start endless chain replacement(metathesis)reaction, in target DNA district, start complementary strand synthetic, go round and begin again stem-circular DNA mixture of the Cauliflower structure that is formed with a lot of rings of result complementary sequence on same chain.In LAMP reaction process, the pyrophosphate ion of separating out from dNTP and the Mg reaction soln
2+in conjunction with, produce by product---magnesium pyrophosphate milky white precipitate, can be by visual inspection result of determination.LAMP reaction is in 45～90 minutes, to complete under constant temperature (63～65 ℃) condition.This comparatively gentle temperature condition and do not have temperature cycle that required instrument is simplified, overcome normal PCR intrinsic detection time long, easily pollute and the shortcoming such as testing cost height.In addition, this detection method requires lower to testing staff's technical quality, and actually operating is very easy, does not need special reagent and plant and instrument, is conducive to set up rapid screening system with low cost.LAMP method is a kind of gene amplification method of easy, quick, high degree of specificity.Constant temperature gene amplification technology and round pcr (comprising fluorescence real-time quantitative PCR technology) are compared, can find that this technology is equivalent to or is better than round pcr in the methodology indexs such as sensitivity, specificity and sensing range, and do not rely on any special plant and instrument and can realize on-the-spot high-throughput rapid detection, and testing cost is far below fluorescent quantitative PCR technique.In national standard, take microorganism separation and Culture and Morphological Identification at present as master, in conjunction with the passing method of biochemical analysis and serological typing evaluation, and preliminary evaluation needs 2～3 days, completes probation report and needs 10～15 days; Adopt detection kit of the present invention only to need 2 hours.And, in reaction system of the present invention, having added nitrite ion, qualification result is more visual and clear.
Compared with prior art, the present invention has following beneficial effect: 1. detection kit of the present invention only needs just energy amplified reaction of a steady temperature, does not need special reagent and equipment, and testing cost is low; 2. six sections of gene quick diagnosis kit of the present invention application, whether four primers, just can judge the existence of target substance, so have high specific according to whether increasing; 3. detection kit of the present invention amplification fast and efficient, can complete amplification less than 1 hour, and productive rate is high; 4. detection kit of the present invention is highly sensitive, and amplification template only needs 10 copies or still less; 5. gene quick diagnosis kit evaluation of the present invention is easy, the pyrophosphate ion of separating out from dNTP and the Mg reaction soln
2+in conjunction with, produce by product---magnesium pyrophosphate precipitation, can identify by visual inspection, and add after nitrite ion, yin and yang attribute result colour development difference is remarkable, and checking rate is high, more obviously reliable; 6. owing to having selected the hsp65 gene of high conservative property to design primer as target gene, make the accuracy rate of detection kit detection Mycobacterium of the present invention higher; 7. in detection kit of the present invention, adopt special reaction tubes, reduced the possibility of Aerosol Pollution, simultaneously handled easily.
Embodiment
For making the present invention easier to understand, will further set forth specific embodiments of the invention below.
Following shortenings is applicable to the present invention:
LAMP:loop-mediated isothermal amplification, loop-mediated isothermal amplification dNTP:deoxyribonucleoside triphosphate, deoxynucleoside triphosphate
Bst enzyme: Bst DNA polymerase (large fragment), Bst archaeal dna polymerase (large fragment)
EDTA:ethylenediamine tetraacetic acid, ethylenediamine tetraacetic acid (EDTA)
DNA:deoxyribonucleic acid, thymus nucleic acid
Betaine: trimethyl-glycine
Triton X-100: Triton X-100
Hsp65:65kDa heat shock protein(HSP)
BCG: bacille Calmette-Guerin vaccine
The preparation of embodiment 1 test kit
(1) in the following sequence through the synthetic oligomerization picodna primer of DNA synthesizer:
Outer primer F3:(SEQ ID NO 1)
TCATCACCGTCGAGGAGTC
Outer primer B3:(SEQ ID NO 2)
CGGCTCCGATGACCTTCTC
Inner primer FIP:(SEQ ID NO 3)
GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC
Inner primer BIP:(SEQ ID NO 4)
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG
(V represents A/C/G)
(2) purchase archaeal dna polymerase: BstDNA polysaccharase is placed in container;
(3) preparation reaction solution and primer: reaction solution contains 2mmol/LdNTP, 25mmol/L Tris-Cl, 12.5mmol/L KCl, 12.5mmol/L(NH
4)
2sO
4, 10mmol/L MgSO
4, each 0.2 μ mol/L of 0.125 volume %TritonX-100,1mol/L trimethyl-glycine, inner primer FIP/BIP and each 0.25 μ mol/L of outer primer F3/B3, be placed in container;
(4) preparation sample pretreatment liquid: sample pretreatment liquid contains 20mmol/L Tris-HCl(pH 8.0), 2mmol/L EDTA and 1.2 volume %Triton X-100, be placed in container;
(5) purchase stable liquid: paraffin oil, is placed in container;
(6) purchase nitrite ion: SYBR Green I, is placed in container;
(7) extract positive control: extract BCG genomic dna, be placed in container;
(8) above-mentioned 7 containers are dressed up to test kit, encapsulation.
Preparation technology is summarized as follows:
1, by after inner primer FIP/BIP and outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, sampling quality inspection;
2, by the liquid asepsis packing of above-mentioned (2) ~ (4) step preparation, and according to experiment, with carrying out concentration, determine sampling quality inspection;
3, by stable liquid packing, sampling quality inspection;
4, by the preparation of positive control sample, packing, sampling quality inspection;
5, assembling test kit.
The preparation of embodiment 2 test kits
(1) in the following sequence through the synthetic oligomerization picodna primer of DNA synthesizer:
Outer primer F3:(SEQ ID NO 1)
TCATCACCGTCGAGGAGTC
Outer primer B3:(SEQ ID NO 2)
CGGCTCCGATGACCTTCTC
Inner primer FIP:(SEQ ID NO 3)
GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC
Inner primer BIP:(SEQ ID NO 4)
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG
(V represents A/C/G)
(2) purchase archaeal dna polymerase: BstDNA polysaccharase is placed in container;
(3) preparation reaction solution and primer: reaction solution contains 1.6mmol/LdNTP, 20mmol/L Tris-Cl, 10mmol/L KCl, 10mmol/L(NH
4)
2sO
4, 8mmol/L MgSO
4, each 0.2 μ mol/L of 0.1 volume %TritonX-100,0.8mol/L trimethyl-glycine, inner primer FIP/BIP and each 0.25 μ mol/L of outer primer F3/B3, be placed in container;
(4) preparation sample pretreatment liquid: sample pretreatment liquid contains 10mmol/L Tris-HCl(pH 8.0), 1mmol/L EDTA and 1.0 volume %Triton X-100, be placed in container;
(5) purchase stable liquid: paraffin oil, is placed in container;
(6) purchase nitrite ion: EVA Green I, is placed in container;
(7) extract positive control: extract BCG genomic dna, be placed in container;
(8) above-mentioned 7 containers are dressed up to test kit, encapsulation.
Other are with embodiment 1.
The preparation of embodiment 3 test kits
Other conditions are identical with embodiment 1, and its difference is only that the primer in step (1) is:
Outer primer F3 ': (SEQ ID NO 5)
AGTCCATCGGTGACCTGATC
Outer primer B3 ': (SEQ ID NO 6)
AGGACCGCCTCCTGAC
Inner primer FIP ': (SEQ ID NO 7)
GGTGTTGGACTCCTCGACGGGCCGAGGCGATGGACAA
Inner primer BIP ': (SEQ ID NO 8)
GCAGCTCGAGCTCACCGAGCGGGTCGGTCACGAAGT
The preparation of embodiment 4 test kits
Other conditions are identical with embodiment 1, and its difference is only that the primer in step (1) is:
Outer primer F3 ": (SEQ ID NO 1)
TCATCACCGTCGAGGAGTC
Outer primer B3 ": (SEQ ID NO 9)
AGCGGCAGCAGRTCCT
Inner primer FIP ": (SEQ ID NO 10)
CGGTCACGAAGTACCCCGAGATCTGCAGCTCGAGCTCACC
Inner primer BIP ": (SEQ ID NO 4)
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG
(V represents A/C/G, and R represents A/G)
The application of embodiment 5 Mycobacterium detection kit
One, method and material
1, bacterial strain
The present invention adopts bacterial strain to have 29 strains, is mainly derived from the biological product of USS collecting center, Nat'l Pharmaceutical & Biological Products Control Institute.Refer to table 1.
Table 1 strain name and source
2, sample preparation (template DNA extraction)
(1) draw and cultivate bacterium liquid 1mL, the centrifugal 2min of 12000rpm, obtains bacterial sediment;
(2) in above-mentioned bacterial sediment, add 100 μ L DNA extraction liquid I, boiling water bath 10min, adds 12.5 μ LDNA extracting solution II, slightly mixes; The centrifugal 2min of 12000rpm, supernatant is sample template DNA.
3, the reaction process of loop-mediated isothermal amplification technology
(1) in 200 μ L reaction tubes preparation reaction systems: reaction solution and primer be totally 22 μ L, BstDNA polysaccharase 0.5 μ L(4U), stable liquid 30 μ L, template DNA 2.5 μ L.
(2) by the reaction tubes preparing in 65 ℃ of isothermal reactions 1 hour.
4, post-reaction treatment
In above-mentioned reaction product, add 2 μ L SYBR Green I, mix, also in heliotropism control tube (BCG genomic dna) and negative control pipe (deionized water), add SYBR Green I to mix simultaneously, if reaction tubes shows green the same as positive control pipe is positive, if reaction tubes the same with negative control pipe manifest orange negative.
5, electrophoresis
Prepare 0.2% agarose gel electrophoresis.The SYBR Green I of usining carries out color reaction observations as dyestuff.
6, specific degree test
Pure bacterial strain LAMP detects and by LAMP method, 29 strain bacteriums is increased, according to color reaction observations, green positive, orange feminine gender, verification method specificity.
7, sensitivity test
M.bovis BCG essence is carried to nucleic acid, with TE, do 10 times of multiple proportions continuous gradients and be diluted to 10
-10, carry out LAMP detection.
8, the test of replica test specific degree and sensitivity test repeat respectively 2 times.
Two, result
1, specific degree test
4 strain mycobacterium tuberculosis complex detected results are positive, and 17 strain non-tuberculous mycobacteria detected results are positive, and Vaccinum Calmette-Guerini BCG is positive, and the non-branch bacillus of 7 strain is all negative, as shown in table 2.Result visualizingre agent box has high specific.
Table 2 detected result
| Detect sample | Result |
| M.tuberculosis H37Rv（ATCC 27294） | Positive |
| M.microti（ATCC 19422） | Positive |
| M.africanum（ATCC 25420） | Positive |
| M.bovis（ATCC 19210） | Positive |
| M.kansassi （ATCC 12478） | Positive |
| M.intracellulare（ATCC 13950） | Positive |
| M.chelonae（ATCC 14472） | Positive |
| M.fortuitum（ATCC 6481） | Positive |
| M.gordonae（ATCC 14470） | Positive |
| M.marinum（ATCC 927） | Positive |
| M.smegmatis（ATCC 19420） | Positive |
| M.terrae（ATCC 19619） | Positive |
| M.avium（ATCC 25291） | Positive |
| M.phlei（ATCC 11758） | Positive |
| M.scrofulaceum（ATCC 19981） | Positive |
| M.abscessus（ATCC 19977） | Positive |
| M.ulcerans（ATCC 19423） | Positive |
| M.shimoidei（ATCC 27962） | Positive |
| M.asiaticum（ATCC 25276） | Positive |
| M.xenopi（ATCC 19250） | Positive |
| M.gastri（ATCC 15754） | Positive |
| M.bovis BCG | Positive |
| Streptococcus aureus | Negative |
| Shigellae | Negative |
| Vibrio parahaemolyticus | Negative |
| Salmonellas | Negative |
| Listeria monocytogenes | Negative |
| Yersinia entero-colitica | Negative |
| Beta hemolysis suis | Negative |
| Positive control | Positive |
| Negative control | Negative |
2, sensitivity test
Bacterium original liquid concentration is 1.26 * 10
6cFU/mL, LAMP method can detect the 4th extent of dilution, is 1.26 * 10
2cFU/mL.
Electrophoresis result also meets the above results.
3, replica test
Specific degree test repeats twice, and result is consistent.Sensitivity test repeats twice, order-of-magnitude agreement.
Embodiment 6 adopts the Mycobacterium detection kit of reaction tubes
The Mycobacterium detection kit of the present embodiment, the reagent and the primer that adopt are identical with embodiment 1, test kit also comprises reaction tubes, reaction tubes covers two portions by body and pipe and forms, the bottom of tube cavity is provided with the dividing plate extending longitudinally that is divided into A, two cavitys of B, wherein: the LAMP reaction solution of 22.0 μ L and the BstDNA polysaccharase of 0.5 μ L are housed in cavity A, and liquid upper strata is sealed up for safekeeping by paraffin; The LAMP reaction solution liquid that 2.0 μ L are housed in cavity B, liquid upper strata is also sealed up for safekeeping by paraffin, by ℃ preservation of these reaction tubes-20.
The present embodiment adopts reaction tubes as container, and Mycobacterium is carried out to LAMP detection, is provided with positive controls and negative control group simultaneously, specifically comprises the steps:
Get three of the reaction tubess of above-mentioned preparation; adopt liquid-transfering gun to add respectively each 2.5 μ L of negative control sample, detected sample and positive control sample, rifle head pierce through the protection liquid layer during application of sample, sample adds in reaction tubes A chamber; cover tightly pipe and cover and carry out mark, move to reaction zone.
By above-mentioned reaction tubes all in 65 ℃ of isothermal reaction 1h.
Reaction finishes, and reaction tubes is inverted to whipping 1 time, is more just putting whipping 1 time, makes working fluid fully mix rear observation with nitrite ion.
If reaction tubes shows green the same as positive control pipe is positive, if reaction tubes the same with negative control pipe manifest orange negative.
In LAMP reaction process, nitrite ion and working fluid sealed state are good, there is no to occur situation about revealing mutually, and the later stage during color reaction, is inverted whipping operation nitrite ion and working fluid are mixed, and colour developing result is clear.
Last institute should be noted that; above embodiment is only in order to illustrate technical scheme of the present invention but not limiting the scope of the invention; although the present invention is explained in detail with reference to preferred embodiment; those of ordinary skill in the art is to be understood that; can modify or be equal to replacement technical scheme of the present invention, and not depart from essence and the scope of technical solution of the present invention.
Claims (6)
1. a Mycobacterium detection kit, it is characterized in that, described Mycobacterium detection kit comprises that take the hsp65 gene of Mycobacterium is target gene, two pairs of primers based on loop-mediated isothermal amplification technology design: inner primer FIP/BIP and outer primer F3/B3, two pairs of described primers are
Outer primer F3:
TCATCACCGTCGAGGAGTC
Outer primer B3:
CGGCTCCGATGACCTTCTC
Inner primer FIP:
GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC
Inner primer BIP:
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG；
Wherein, V represents A/C/G.
2. Mycobacterium detection kit according to claim 1, is characterized in that, described Mycobacterium detection kit also comprises BstDNA polysaccharase, reaction solution, stable liquid, sample pretreatment liquid, nitrite ion and positive control solution.
3. Mycobacterium detection kit according to claim 2, is characterized in that,
Described BstDNA polysaccharase: enzyme concn 4-10U/ μ L;
Described reaction solution contains: 1.6～2mmol/LdNTP, 20～25mmol/LTris-HCl, 10～12.5mmol/LKCl, 10～12.5mmol/L(NH
4)
2sO
4, 8～10mmol/LMgSO
4, 0.1～0.125 volume %TritonX-100,0.8～1mol/L trimethyl-glycine;
Described sample pretreatment liquid contains: the Tris-HCl of 10～20mmol/LpH8.0,1～2mmol/LEDTA and 1～1.2 volume %TritonX-100;
Described nitrite ion is SYBRGreenI or EvaGreen;
Described stable liquid is paraffin oil;
Described positive control is BCG genomic dna;
Described inner primer FIP/BIP is respectively 0.2～0.25 μ mol/L, and the concentration of outer primer F3/B3 is respectively 1.2～2.0 μ mol/L.
4. Mycobacterium detection kit according to claim 3, is characterized in that,
Described BstDNA polysaccharase: enzyme concn 8U/ μ L;
Described reaction solution contains: 2mmol/LdNTP, 25mmol/LTris-HCl, 12.5mmol/LKCl, 12.5mmol/L(NH
4)
2sO
4, 10mmol/LMgSO
4, 0.125 volume %TritonX-100,1mol/L trimethyl-glycine;
Described sample pretreatment liquid contains: the Tris-HCl of 20mmol/LpH8.0,2mmol/LEDTA and 1.2 volume %TritonX-100;
Described nitrite ion is SYBRGreenI;
The concentration of described inner primer FIP/BIP is respectively 0.2 μ mol/L;
The concentration of described outer primer F3/B3 is respectively 1.6 μ mol/L.
5. according to the Mycobacterium detection kit described in claim 2,3 or 4, it is characterized in that, described Mycobacterium detection kit also comprises reaction tubes, described reaction tubes covers two portions by body and pipe and forms, and the bottom of tube cavity is provided with the dividing plate extending longitudinally that is divided into A, two cavitys of B.
6. Mycobacterium detection kit according to claim 5, it is characterized in that, in described A, two cavitys of B, working fluid or nitrite ion are housed respectively, seal up for safekeeping by stable liquid on the liquid upper strata in two cavitys, and described working fluid is mixing of reaction solution and BstDNA polysaccharase.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310426393.8A CN103451309B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
| CN201210352230.5A CN102827944B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
| PCT/CN2013/083310 WO2014044142A1 (en) | 2012-09-19 | 2013-09-11 | Mycobacterium detection kit and method of use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210352230.5A CN102827944B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310426393.8A Division CN103451309B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102827944A CN102827944A (en) | 2012-12-19 |
| CN102827944B true CN102827944B (en) | 2014-07-23 |
Family
ID=47331251
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210352230.5A Active CN102827944B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
| CN201310426393.8A Active CN103451309B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310426393.8A Active CN103451309B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (2) | CN102827944B (en) |
| WO (1) | WO2014044142A1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102827944B (en) * | 2012-09-19 | 2014-07-23 | 广州华峰生物科技有限公司 | Mycobacterium detection kit and using method thereof |
| CN103088139B (en) * | 2013-01-28 | 2015-04-22 | 清华大学 | Primer pair and standard substance for detecting mycobacteria and application thereof |
| CN116287324B (en) * | 2022-09-20 | 2023-09-22 | 北京理工大学 | Primer and kit for detecting bacillus spatially and application of primer and kit |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101157954A (en) * | 2007-09-13 | 2008-04-09 | 中华人民共和国徐州出入境检验检疫局 | Concretion mycobacterium nucleic acid screening method based on loop-mediated isothermal amplification technique |
| CN101935693B (en) * | 2010-01-18 | 2012-03-28 | 广州华峰生物科技有限公司 | Mycobacterium tuberculosis detection kit and use method thereof |
| CN101942508B (en) * | 2010-05-18 | 2012-11-14 | 广州华峰生物科技有限公司 | Escherichia coli detection kit and use method thereof |
| CN102827944B (en) * | 2012-09-19 | 2014-07-23 | 广州华峰生物科技有限公司 | Mycobacterium detection kit and using method thereof |
-
2012
- 2012-09-19 CN CN201210352230.5A patent/CN102827944B/en active Active
- 2012-09-19 CN CN201310426393.8A patent/CN103451309B/en active Active
-
2013
- 2013-09-11 WO PCT/CN2013/083310 patent/WO2014044142A1/en active Application Filing
Non-Patent Citations (10)
| Title |
|---|
| AMALIO TELENTI,et al.Rapid Identification of Mycobacteria to the Species Level by Polymerase Chain Reaction and Restriction Enzyme Analysis.《JOURNAL OF CLINICAL MICROBIOLOGY》.1993,第31卷(第2期),175-178. |
| cation ofMycobacteriumspeciesbycomparative analysisof thednaA gene.《Tetsu Mukai》.2006,第254卷232–239. * |
| cent * |
| FRANCESCA BRUNELLO et al.Identification of 54 Mycobacterial Species by PCR-Restriction Fragment Length Polymorphism Analysis of the hsp65 Gene.《JOURNAL OF CLINICAL MICROBIOLOGY》.2001,第39卷(第8期),2799–2806. |
| Identification of 54 Mycobacterial Species by PCR-Restriction Fragment Length Polymorphism Analysis of the hsp65 Gene;FRANCESCA BRUNELLO et al;《JOURNAL OF CLINICAL MICROBIOLOGY》;20010831;第39卷(第8期);2799–2806 * |
| Rapid Identification of Mycobacteria to the Species Level by Polymerase Chain Reaction and Restriction Enzyme Analysis;AMALIO TELENTI,et al;《JOURNAL OF CLINICAL MICROBIOLOGY》;19930228;第31卷(第2期);175-178 * |
| Tetsu Mukai et al.Identi& * |
| Tetsu Mukai et al.Identi¢ |
| Ting-Shu Wu ，et al.Current Situations on Identification of Nontuberculous Mycobacteria.《J Biomed Lab Sci》.2009,第21卷(第1期),1－6. |
| Ting-Shu Wu,et al.Current Situations on Identification of Nontuberculous Mycobacteria.《J Biomed Lab Sci》.2009,第21卷(第1期),1-6. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103451309B (en) | 2015-11-18 |
| WO2014044142A1 (en) | 2014-03-27 |
| CN103451309A (en) | 2013-12-18 |
| CN102827944A (en) | 2012-12-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Miller et al. | Evaluation of Gen-Probe Amplified Mycobacterium Tuberculosis Direct Test and PCR for direct detection of Mycobacterium tuberculosis in clinical specimens | |
| CN101935693B (en) | Mycobacterium tuberculosis detection kit and use method thereof | |
| CN102373273B (en) | Kit for detecting nucleic acid of mycobacterium tuberculosis | |
| Shinnick et al. | Molecular approaches to the diagnosis of tuberculosis | |
| Luo et al. | Rapid direct drug susceptibility testing of Mycobacterium tuberculosis based on culture droplet digital polymerase chain reaction | |
| CN101942508B (en) | Escherichia coli detection kit and use method thereof | |
| CN102827944B (en) | Mycobacterium detection kit and using method thereof | |
| CN102094090A (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN101565753B (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| Phetsuksiri et al. | Comparison of loop-mediated isothermal amplification, microscopy, culture, and PCR for diagnosis of pulmonary tuberculosis | |
| Tabibnejad et al. | The optimization of molecular detection of clinical isolates of Brucella in blood cultures by eryD transcriptase gene for confirmation of culture-negative samples | |
| CN101555529B (en) | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof | |
| Foongladda et al. | Multi-probe real-time PCR identification of common Mycobacterium species in blood culture broth | |
| CN102719548B (en) | Kit for detecting brucella and use method thereof | |
| CN101979660B (en) | Brucella detection kit and using method thereof | |
| CN102251044A (en) | Enterorrhagia colibacillus stx1 gene detection kit and application method thereof | |
| CN102286620A (en) | Enterohemorrhagic E. coli stx2 gene detection kit and using method thereof | |
| Muhumuza et al. | Introduction of an in-house PCR for routine identification of M. tuberculosis in a low-income country | |
| KR20110130327A (en) | Methods for identification and detection of mycobacterium tuberculosis complex and nontuberculous mycobacteria using duplex polymerase chain reaction | |
| Ramezani et al. | Development of sensitive and rapid RNA transcription-based isothermal amplification method for detection of Mycobacterium tuberculosis | |
| CN102146470B (en) | Bacillus anthracis detection kit and using method of kit | |
| KR101523877B1 (en) | Methods for identification and detection of mycobacterium using real time polymerase chain reaction and melting curve analysis | |
| KR101426119B1 (en) | Methods for identification and detection of mycobacterium using real time polymerase chain reaction and melting curve analysis | |
| CN102277440A (en) | Kit and method for quickly detecting mycobacterium tuberculosis and nontuberculous mycobacteria | |
| Maugein et al. | Diagnostic microbiologique de la tuberculose et intérêt de la PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |