WO2014044142A1

WO2014044142A1 - Mycobacterium detection kit and method of use thereof

Info

Publication number: WO2014044142A1
Application number: PCT/CN2013/083310
Authority: WO
Inventors: 曹以诚; 茅莉娜; 陈振柳; 杜正平; 王静; 吕冰凌
Original assignee: 广州华峰生物科技有限公司
Priority date: 2012-09-19
Filing date: 2013-09-11
Publication date: 2014-03-27
Also published as: CN102827944B; CN102827944A; CN103451309B; CN103451309A

Abstract

Provided is a mycobacterium detection kit, the kit comprising two pairs of primers designed by using the hsp65 gene of the mycobacterium as a target gene based on a loop-mediated isothermal amplification technology: an inner primer FIP/BIP and an outer primer F3/B3. Also provided is a method of use for the mycobacterium detection kit.

Description

TECHNICAL FIELD The present invention relates to a biological detection reagent, and in particular to a Mycobacterium detection kit and a method of using the same. Background technique

Mycobacterium is a kind of slender, slightly curved bacillus with a tendency to grow branches, hence the name. There are many species of this genus, which can be divided into three groups: Mycobacterium tuberculosis complex, non-tuberculous mycobacteria and Mycobacterium leprae.

M. tuberculosis, commonly known as Mycobacterium tuberculosis or tuberculosis, is the causative agent of tuberculosis. Tuberculosis is a major infectious disease that threatens human and animal health. The World Health Organization (WHO) has issued a global TB control strategy and has designated March 24th as the World Tuberculosis Day.

Corresponding to the Mycobacterium tuberculosis complex is a variety of non-tuberculous mycobacteria, hundreds of species have been found, widely found in soil, environment, and animals. According to the fourth national tuberculosis epidemiological sampling survey in 2000, there were 4.51 million active tuberculosis patients and 1.96 million patients with pulmonary tuberculosis. Among the positive cultures of mycobacteria, Mycobacterium tuberculosis accounted for 86.4%, Bovine Mycobacterium tuberculosis accounted for 2.5%, and nontuberculous mycobacteria accounted for 11.1%. In the third national tuberculosis epidemic in 1990, only non-tuberculous mycobacteria accounted for only 4.9 percent. This shows that the proportion of non-tuberculous mycobacteria is significantly higher than before. Non-tuberculous mycobacteria patients are resistant to most first-line anti-tuberculosis drugs, and treatment with current standard chemotherapy regimens is ineffective. Traditional mycobacterial strain identification and drug sensitivity test methods are based on culture, which is cumbersome and time-consuming. It takes 1-2 months to meet the needs of clinically effective early chemotherapy, making non-tuberculous mycobacteria patients long-term. Regular chemotherapy is not effective, the course of treatment is prolonged, and patients become refractory and retreated. Bacteria may spread locally. Therefore, the rapid identification of Mycobacterium is extremely important for early diagnosis, differential diagnosis, effective chemotherapy and controlled transmission of tuberculosis and non-tuberculous mycobacterial diseases. The traditional mycobacterial detection method is far from meeting the modern detection requirements due to its short detection period, complicated procedures, and numerous reagents required. Pathogenic nucleic acid detection technology represented by polymerase chain reaction (PCR) technology has some problems in practical applications. For example, common polymerase chain reaction (PCR) technology requires specialized instruments, and there are easy cross-contamination and annoying operation. Trivial shortcomings. Fluorescence real-time quantitative polymerase chain reaction (real time PCR) technology solves the problem of cross-contamination and integrates the operation process, but it requires more complicated quantitative measurement instruments, so it is not suitable for rapid on-site detection. . Moreover, the cost of fluorescent probes in real-time quantitative polymerase chain reaction PCR technology is higher, which makes it more difficult to promote and apply. Immunological detection technology is fast and inexpensive, but requires high-quality and high-stability monoclonal antibodies. Otherwise, the accuracy is not enough. At present, it can only be an auxiliary detection method. Therefore, the timely application of the latest achievements in the development of biotechnology is of great significance to meet the continuous improvement of the requirements for detection of pathogenic microorganisms. Among them, the rapid detection technology of Isothermal Amplification is a great progress in the detection of pathogenic nucleic acid, and the ring-mediated constant temperature amplification technology (LAMP) has been established has many advantages. Therefore, there is a need for a Mycobacterium detection kit having a more comprehensive detection effect, a high specificity, and a low detection rate, and a method of using the same to solve the above problems. SUMMARY OF THE INVENTION An object of the present invention is to provide a Mycobacterium detection kit which is more comprehensive, has high specificity, and has a low detection rate, which solves the deficiencies of the prior art. The object of the present invention can be achieved by the following technical measures: A Mycobacterium detection kit, wherein the Mycobacterium detection kit comprises a hsp65 gene of Mycobacterium as a target gene, based on a loop-mediated constant temperature expansion Two pairs of primers designed by the technique: inner primer FIP/BIP and outer primer F3/B3, the two pairs of primers are

夕卜 Primer F3: ( SEQ ID NO 1 )

TCATCACCGTCGAGGAGTC External primer B3: ( SEQ ID NO 2 )

CGGCTCCGATGACCTTCTC

Internal primer FIP: ( SEQ ID NO 3 )

GTCGGTCACGAAGTACCC

Internal primer BIP: ( SEQ ID NO 4 )

AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG;

Or

External primer F3,: ( SEQ ID NO 5 )

AGTCCATCGGTGACCTGATC

External primer B3,: ( SEQ ID NO 6 )

AGGACCGCCTCCTGAC

Internal primer FIP,: ( SEQ ID NO 7 )

GGTGTTGGACTCCTCGACGGGCCGAGGCGATGGACAA

Internal primer BIP,: ( SEQ ID NO 8 )

GCAGCTCGAGCTCACCGAGCGGGTCGGTCACGAAGT;

Or

External primer F3": ( SEQ ID NO 1 )

TCATCACCGTCGAGGAGTC

External primer B3": ( SEQ ID NO 9 )

AGCGGCAGCAGRTCCT

Internal primer FIP": (SEQ ID NO 10 ) internal primer BIP": ( SEQ ID NO 4 )

AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG;

Among them, V generation ^ A / C / G, R represents A / G.

The present invention is directed to a primer designed for the hsp65 gene of the genus Mycobacterium, which is a 65 kDa heat shock protein gene, which is highly conserved and widely present in each branching rod. Among the species of the genus, the primers are capable of amplifying and detecting all the species of the Mycobacterium tuberculosis complex and the non-tuberculous mycobacteria, including: M. tuberculosis, M. variabilis (Μ· Microti ), M. africanum, M. bovis, Mycobacterium kansii

(M.kansasii), M. intracellulare, M. chelonae, M. fortuitum, M. gordonae, sea Mycobacterium

(M.marinum), M. smegmatis, M. terrae, M. avium, M. phlei, 瘰疠M. scrofulaceum, M. abscessus, M. ulcerans, Mycobacterium tuberculosis

(M. shimoidei), M. asiaticum, M. xenopi, M. gastri. As a preferred embodiment of the Mycobacterium detection kit of the present invention, the Mycobacterium test kit further comprises a DNA polymerase, a reaction solution, a stabilizing solution, a sample pretreatment solution, a color developing solution, and a positive control solution. As a more preferred embodiment of the Mycobacterium detection kit of the present invention,

The polymerase: enzyme concentration 4-10 υ / μΐ ^;

The reaction solution contains: 1.6 ~ 2mmol / L dNTP, 20 ~ 25mmol / L Tris-HCl, 10 ~ 12.5mmol / L KC1, 10 ~ 12.5mmol / L (NH ₄ ) ₂ S0 ₄ , 8 ~ lOmmol / L MgS0 ₄ , 0.1 ~ 0.125 vol% TritonX-100, 0.8 ~ lmol / L betaine;

The sample pretreatment liquid comprises: 10 - 20 mmol / L H 8.0 Tris-HCl, 1 ~ 2 mmol / L EDTA and 1 ~ 1.2 vol% Triton X-100;

The color developing solution is SYBR Green I or Eva Green;

The stabilizing liquid is paraffin oil;

The positive control is BCG genomic DNA;

The internal primers FIP/BIP are each 0.2 to 0.25 mol/L, and the external primers F3/B3 are each 1.2 to 2.0 mol/L. As a most preferred embodiment of the Mycobacterium detection kit of the present invention,

The fo DNA polymerase: enzyme concentration 8 U / L;

The reaction solution contains: 2 mmol/L dNTP, 25 mmol/L Tris-HCl, 12.5 mmol/L KC1, 12.5 mmol/L (NH ₄ ) ₂ S0 ₄ , 10 mmol/L MgS0 ₄ , 0.125 vol% Triton X-100, Lmol/L betaine;

The sample pretreatment liquid comprises: 20 mmol/L Tris-HC1, pH 8.0, 2 mmol/L EDTA and 1.2% by volume Triton X-100;

The color developing solution is SYBR Green I;

The concentration of the internal primer FIP/BIP is 0.2 mol/L;

The concentration of the external primer F3/B3 was 1.6 mol/L. As a preferred embodiment of the Mycobacterium detection kit of the present invention, the Mycobacterium detection kit further comprises a reaction tube, wherein the reaction tube is composed of a tube body and a tube cover, and the lower part of the tube body cavity A longitudinally extending partition is provided which divides it into two cavities A and B. As a more preferred embodiment of the Mycobacterium detection kit of the present invention, the two cavities A and B are respectively provided with a working liquid or a color developing liquid, and the upper layers of the liquid in both cavities are sealed by the stabilizing liquid. The working fluid is a mixture of a reaction solution and a fo DNA polymerase. Loop-mediated constant temperature amplification (LAMP) is a rapid, sensitive and accurate method for nucleic acid detection. Its amplification efficiency is super-excellent and manifests itself in two aspects: (1) Sensitivity is higher than PCR by an order of magnitude difference; (2) The amount of DNA of the amplified product is also much higher than that of the PCR product, which can reach several but too sensitive and the amount of the product is huge, making LAMP extremely susceptible to contamination, especially after the LAMP amplification reaction requires a reaction tube opening. Adding a developer to the cap is prone to aerosol contamination. Aerosol contamination can lead to high false positive rates and contaminate other samples, contaminate the detection area, and is difficult to remove. The reaction tube of the invention effectively separates the color developing liquid from the working liquid through the design of the partition plate and the stabilizing liquid, which not only ensures relatively complete sealing during storage and transportation, but also can be opened without opening the tube cover. Achieve color reaction, greatly reducing aerosol pollution. The invention also provides a method for using a Mycobacterium detection kit, the method comprising the following steps:

(1) centrifuging the sample to be tested, removing the supernatant to obtain a precipitate;

(2) adding the precipitate of step (1) to the sample pretreatment liquid, mixing and hooking, inactivation of the boiling water bath, cooling on ice, centrifugation at high speed, and the supernatant is the sample template DNA;

(3) Adding 0.9 to 1.8 parts by volume of Bst DNA polymerase, 38 to 40 parts by volume of the reaction solution, 52 to 54.5 parts by volume of the stable solution, 4.5-9 parts by volume of the sample template DNA, and FIP of the internal primer in the reaction vessel /BIP 2 parts by volume, 4 parts by volume of external primer F3/B3, constant temperature reaction;

(4) adding a coloring solution to the above reaction container and the positive control, respectively, and mixing, and the color of the sample group is positive as the control group, otherwise it is negative;

The inner primer FIP/BIP and the outer primer F3/B3 in the step (3) are two pairs of primers designed based on the hsp65 gene of Mycobacterium and designed based on loop-mediated constant temperature amplification technology. As a preferred embodiment of the method of using the Mycobacterium detection kit of the present invention, in the step (3), the reaction conditions of the constant temperature reaction are a temperature of 63 to 65 ° C and a reaction time of 45 to 90 min. The method for rapidly detecting mycobacteria based on loop-mediated isothermal amplication of DNA (LAMP) according to the present invention is to use fo DNA polymerase and two pairs designed according to target gene sequences. Special internal and external primers (ie, internal primer FIP/BIP and external primer F3/B3) specifically recognize six independent regions on the target sequence, initiate cyclical chain displacement reaction, and initiate complementary strand synthesis in the target DNA region. The complementary sequence on the same strand is repeatedly formed into a stem-loop DNA mixture of a 4-inch polycyclic broccoli structure. During the LAMP reaction, the pyrophosphate ion precipitated from the dNTP is combined with Mg ²⁺ in the reaction solution to produce a white precipitate of the magnesium pyrophosphate, which is a by-product, and the result can be visually observed. The LAMP reaction is completed within 45 to 90 minutes at a constant temperature (63 ~ 65 °C). This relatively mild temperature condition and the absence of temperature cycling simplify the required instrumentation, overcoming the shortcomings of traditional PCR, such as long detection time, easy contamination, and high detection cost. In addition, this kind of detection method has low requirements on the technical quality of the inspectors, and the actual operation is extremely convenient, and no special reagents and instruments are needed, which is conducive to establishing a low-cost rapid screening system. LAMP method is a kind of tube, fast Rapid, highly specific gene amplification method. Comparing the thermostatic gene amplification technology with PCR technology (including fluorescence real-time quantitative PCR), it can be found that the technology is equivalent to or superior to PCR technology in terms of sensitivity, specificity and detection range, and does not depend on any specialization. The instrumentation can achieve high-throughput rapid detection in the field, and the detection cost is much lower than that of the real-time PCR technology. At present, the national standard is based on microbial isolation culture and morphological identification, combined with biochemical analysis and serological typing. The preliminary identification takes 2 to 3 days, and the identification report takes 10 to 15 days. The detection reagent of the present invention is used. The box takes only 2 hours. Moreover, the color developing solution is added to the reaction system of the present invention, and the identification result is more intuitive and clear. Compared with the prior art, the invention has the following beneficial effects: 1. The detection kit of the invention can amplify the reaction only by a constant temperature, does not require special reagents and equipment, and has low detection cost; 2. The gene of the invention The rapid diagnostic kit uses six segments, four primers, to determine whether the target substance is present or not depending on whether it is amplified, and thus has high specificity; 3. The detection kit of the present invention is rapid and efficient in amplification, The amplification can be completed in 1 hour, and the yield is high; 4. The detection kit of the invention has high sensitivity, and the amplification template only needs 10 copies or less; 5. The gene rapid diagnostic kit of the invention identifies the cartridge, from The pyrophosphate ion precipitated by dNTP is combined with Mg ²⁺ in the reaction solution to produce a by-product, magnesium pyrophosphate precipitate, which can be identified by visual observation, and the color positive liquid has a significant difference in coloration after the addition of the color developing solution. High, more obvious and reliable; 6. Due to the selection of the highly conserved hsp65 gene as a target gene design primer, the detection kit of the present invention is more accurate in detecting Mycobacterium 7. The special reaction tube is used in the detection kit of the invention, which reduces the possibility of aerosol contamination and is convenient to operate. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS In order to make the present invention easier to understand, specific embodiments of the present invention will be further described below. The following abbreviations apply to the present invention:

LAMP: loop-mediated isothermal amplification, loop-mediated isothermal amplification

dNTP: deoxyribonucleoside triphosphate, deoxynucleoside triacate

Bst enzyme: Bst DNA polymerase (large fragment), Bst DNA polymerase (large fragment) EDTA: ethylenediamine tetraacetic acid, ethylenediaminetetraacetic acid

DNA: deoxyribonucleic acid, deoxyribonucleic acid

Betaine: Beet

Triton X-100: Polyethylene glycol octyl phenyl ether

Hsp65: 65 kDa heat shock protein

BCG: BCG vaccine Example 1 Preparation of kit

(1) Synthesis of oligodeoxynucleotide primers by DNA synthesizer according to the following sequence:

夕卜引器 F3: (SEQIDNO 1 )

TCATCACCGTCGAGGAGTC

External primer B3: (SEQIDNO 2)

CGGCTCCGATGACCTTCTC

Internal primer FIP: (SEQIDNO 3) Internal primer BIP: (SEQIDNO 4)

AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG

(V generation ^ A/C/G)

(2) purchasing DNA polymerase: fo DNA polymerase is placed in a container;

(3) Preparation of reaction solution and primer: The reaction solution contained 2 mmol/L dNTP, 25 mmol/L Tris-CK 12.5 mmol/L KC1, 12.5 mmol/L (NH ₄ ) ₂ S0 ₄ , 10 mmol/L MgS0 ₄ , 0.125 vol% TritonX -100, lmol/L betaine, internal primer FIP/BIP 0.2 mol/L and external primer F3/B3 each 0.25 mol/L, placed in a container;

(4) Preparing sample pretreatment liquid: The sample pretreatment liquid contains 20 mmol/L Tris-HC1 (pH 8.0), 2 mmol/L EDTA and 1.2% by volume Triton X-100, and placed in a container;

(5) Purchase stabilizer: paraffin oil, placed in a container;

(6) Purchase coloring solution: SYBRGreenl, placed in a container; (7) Extracting the positive control: extracting the BCG genomic DNA and placing it in a container;

(8) The above seven containers are packed into a kit and packaged.

The preparation process is as follows:

1. After the internal primer FIP/BIP and the external primer F3/B3 are synthesized and purified, quantitative preparation, concentration detection, and sampling quality inspection;

2. The liquid prepared in the above steps (2) to (4) is aseptically packaged, and the concentration is determined according to the experiment, and the sample quality inspection is performed;

3. Packing the stable liquid and sampling the quality inspection;

4. Prepare the positive control specimens, sub-package, and sample quality inspection;

5. Assemble the kit. Example 2 Preparation of the kit

夕卜引器 F3: (SEQIDNO 1 )

TCATCACCGTCGAGGAGTC

External primer B3: (SEQIDNO 2)

CGGCTCCGATGACCTTCTC

Internal primer FIP: (SEQIDNO 3) Internal primer BIP: (SEQIDNO 4)

AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG

(V generation ^ A/C/G)

(2) purchasing DNA polymerase: fo DNA polymerase is placed in a container;

(3) Preparation of reaction solution and primer: The reaction solution contains 1.6 mmol/L dNTP, 20 mmol/L Tris-Cl, 1 Ommol/L KCl, 1 Ommol/L (NH ₄ ) ₂ S0 ₄ , 8 mmol/L MgS0 ₄ , 0.1 volume % TritonX-100, 0.8 mol/L betaine, internal primer FIP/BIP 0.2 mol/L and external primer F3/B3 each 0.25 mol/L, placed in the valley; (4) Preparing sample pretreatment liquid: The sample pretreatment liquid contains 10 mmol/L Tris-HCl (pH 8.0), mmol/L EDTA and 1.0% by volume Triton X-100, and placed in a container;

(5) Purchase stabilizer: paraffin oil, placed in a container;

(6) Purchase coloring solution: EVAGreenl, placed in a container;

(7) Extracting the positive control: extracting the BCG genomic DNA and placing it in a container;

(8) The above seven containers are packed into a kit and packaged.

Others are the same as in the first embodiment. Example 3 Preparation of a kit

The other conditions are the same as in the first embodiment except that the primers in the step (1) are:

External primer F3,: ( SEQ ID NO 5 )

AGTCCATCGGTGACCTGATC

External primer B3,: ( SEQ ID NO 6 )

AGGACCGCCTCCTGAC

Internal primer FIP,: ( SEQ ID NO 7 )

GGTGTTGGACTCCTCGACGGGCCGAGGCGATGGACAA

Internal primer BIP,: ( SEQ ID NO 8 )

GCAGCTCGAGCTCACCGAGCGGGTCGGTCACGAAGT Example 4 Preparation of the kit

External primer F3": (SEQIDNO 1 )

TCATCACCGTCGAGGAGTC

External primer B3": (SEQIDNO 9)

AGCGGCAGCAGRTCCT

Internal primer FIP": (SEQIDNO 10) internal primer BIP": (SEQIDNO 4) AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG

(V generation ^ A/C/G, R stands for A/G) Example 5 Application of Mycobacterium detection kit I. Methods and materials

1. Strain

The invention adopts 29 strains, mainly from the American Standard Biological Collection Center and the China National Institute for the Control of Pharmaceutical and Biological Products. See Table 1 for details.

Table 1 Name and source of the strain

Strain source strain and number

American Standard Mycobacterium tuberculosis complex 4 strains

Biological products M.tuberculosis H37Rv ( ATCC 27294 ), M.microti ( ATCC 19422 ), Tibetan center M.africanum ( ATCC 25420 ), M.bovis ( ATCC 19210 )

(ATCC) non-tuberculous mycobacteria 17 strains

M.kansasii (ATCC 12478), M. intracellulare (ATCC 13950),

M.chelonae ( ATCC 14472 ), M.fortuitum ( ATCC 6841 ), M. gordonae ( ATCC 14470 ), M.marinum ( ATCC 927 ), M.smegmatis ( ATCC

19420 ), M.terrae ( ATCC 19619 ), M.avium ( ATCC 25291 ), M.phlei ( ATCC 11758 ), M.scrofulaceum ( ATCC 19981 ), M.abscessus ( ATCC 19977 ), M.ulcerans ( ATCC 19423 ) , M.shimoidei (ATCC

27962 ), M.asiaticum ( ATCC 25276 ), M.xenopi ( ATCC 19250 ),

M.gastri ( ATCC 15754 )

Chinese medicine

Biological products M.bovis BCG

Certification institute

Other strains of Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Salmonella, mononuclear hyperplasia Listeria monocytogenes, Yersinia enterocolitica, and one strain of Streptococcus hemolyticus.

2, sample processing (template DNA extraction)

(1) Aspirate the culture bacterial solution lmL, centrifuge at 12000 rpm for 2 min to obtain a bacterial cell pellet;

(2) Add ΙΟΟμΙ DNA extract I to the above-mentioned cell pellet, boil water bath for 10 min, add 12.5 μΙ^ DNA extract II, mix slightly; centrifuge at 12000 rpm for 2 min, the supernatant is the sample template DNA.

3. The reaction process of ring-mediated constant temperature amplification technology

(1) Prepare the reaction system in 20 (^L reaction tube: 22 L of reaction solution and primer, 0.5 μΙ (4U) of fo DNA polymerase, 30μΙ of stable solution, 2.5 L of template DNA.

(2) The prepared reaction tube was reacted at 65 ° C for 1 hour at a constant temperature.

4, post-reaction treatment

Add 2 L SYBR Green I to the above reaction product, mix, and also add S YBR Green I to the positive control tube (BCG genomic DNA) and the negative control tube (deionized water), if the reaction tube and the positive control If the tube appears green, it is positive. If the reaction tube is orange as the negative control tube, it is negative.

5, electrophoresis

Prepare 0.2% agarose gel electrophoresis. The color reaction was observed with SYBR Green I as a dye.

6, specificity test

Pure strain LAMP detection 29 strains of bacteria were amplified by the LAMP method. According to the results of the color reaction, green was positive, orange was negative, and the verification method was specific.

7, sensitivity test

The M. bovis BCG was extracted from the nucleic acid, and the LAMP assay was performed by serially diluting to 10· ¹⁽⁾ with a 10-fold ratio of TE. 8. The repeatability test specificity test and sensitivity test were repeated twice. Second, the results 1, specificity test

The results of 4 strains of Mycobacterium tuberculosis complex were positive, 17 strains of non-tuberculous mycobacteria were positive, tuberculosis vaccine BCG was positive, and 7 strains of non-mycobacteria were negative, as shown in Table 2. The results show that the kit has high specificity.

Table 2 test results

Test sample result

M.tuberculosis H37Rv ( ATCC 27294 ) positive

M.microti ( ATCC 19422 ) positive

M.africanum ( ATCC 25420 ) positive

M.bovis ( ATCC 19210 ) positive

M.kansassi ( ATCC 12478 ) positive

M.intracellulare ( ATCC 13950 ) positive

M.chelonae ( ATCC 14472 ) positive

M.fortuitum ( ATCC 6481 ) positive

M.gordonae ( ATCC 14470 ) positive

M.marinum ( ATCC 927 ) positive

M.smegmatis ( ATCC 19420 ) positive

M.terrae ( ATCC 19619 ) positive

M.avium ( ATCC 25291 ) positive

M.phlei ( ATCC 11758 ) positive

M.scrofulaceum ( ATCC 19981 ) positive

M.abscessus ( ATCC 19977 ) positive

M.ulcerans ( ATCC 19423 ) positive M.shimoidei ( ATCC 27962 ) positive

M.asiaticum ( ATCC 25276 ) positive

M.xenopi ( ATCC 19250 ) positive

M.gastri ( ATCC 15754 ) positive

M.bovis BCG positive

Staphylococcus aureus negative

Shigella negative

Deputy hemolytic bacterium

Salmonella negative

Listeria monocytogenes negative

Yersinia enterocolitica

Type B hemolytic streptococcus negative

Positive control

Negative control negative

2, sensitivity test

The concentration of the bacterial stock solution was 1.26× ^{10 6} CFU/mL, and the fourth dilution was detected by the LAMP method, which was 1.26×10 ² CFU/mL.

The electrophoresis results also met the above results.

3. Repeatability test

The specificity test was repeated twice and the results were consistent. The sensitivity test was repeated twice, in the same order of magnitude. Example 6 Mycobacterium detection kit using a reaction tube The Mycobacterium detection kit of the present embodiment has the same reagents and primers as in Example 1, and the reagent cartridge further includes a reaction tube, and the reaction tube is composed of a tube body and The tube cover is composed of two parts, and the lower part of the inner cavity of the tube is provided with a longitudinally extending partition which divides the two cavities into A and B, wherein: the cavity A is filled with 22.0μ The LAMP reaction solution and 0.5 μM of Bst DNA polymerase, the upper layer of the liquid is sealed by paraffin; the cavity B contains 2.0 μM of LAMP reaction coloring solution, and the upper liquid layer is also sealed by paraffin, and the reaction tube is stored at -20 ° C. . In this embodiment, the reaction tube is used as a container, and the LAMP test is performed on the Mycobacterium, and the positive control group and the negative control group are provided at the same time, and the following steps are specifically included: The three reaction tubes prepared above are taken, and the pipettes are respectively added to the negative cells. The control sample, the sample to be tested and the positive control sample each are 2.5μ. When the sample is applied, the tip of the sample penetrates the protective layer, and the sample is added into the cavity of the reaction tube. The tube cap is tightly covered and marked, and moved to the reaction zone. The above reaction tubes were all reacted at 65 ° C for 1 h. After the reaction was completed, the reaction tube was inverted and shaken once, and then placed upright once, and the working solution and the color developing solution were thoroughly mixed and observed. If the reaction tube is green as the positive control tube, it is positive, and if the reaction tube is orange as the negative control tube, it is negative. During the LAMP reaction process, the color developing solution and the working fluid are in a sealed state, and no mutual leakage occurs. In the later color reaction, the inverted turbulent operation causes the coloring liquid and the working fluid to be mixed, and the coloration result is clear.

It should be noted that the above embodiments are only intended to illustrate the technical solutions of the present invention, and are not intended to limit the scope of the present invention. The technical solutions of the present invention may be modified or equivalently substituted without departing from the spirit and scope of the technical solutions of the present invention. SEQUENCE LISTING

<110> Guangzhou Huafeng Biotechnology Co., Ltd.

<120> Mycobacterium detection kit and method of use thereof

<160> 10

<170> Patentln version 3.3

<210> 1

<211> 19

<212> DNA

<213> Synthetic

<400> 1

Tcatcaccgt cgaggagtc 19

<210> 2

<211> 19

<212> DNA

<213> Synthetic

<400> 2

Cggctccgat gaccttctc 19

<210> 3 Λ3Η21 <>

Gggggggacaac accattt gggg accac caccacc0ttt 4

02114 <> Gggg g accacaccrtt

<>

0 ggggggggaccccac 37ttt tt

<>

Gggg aacccc ccac 6tt 1 0064 <>

Ggg ggggggg ccacaaacccca accac caccacc0tttttt 4

00211 <>

Claims

Claim

A Mycobacterium detection kit, characterized in that the Mycobacterium detection kit comprises two molecules designed based on a loop-mediated constant temperature amplification technique using a hsp65 gene of Mycobacterium as a target gene. For primers: internal primer FIP/BIP and external primer F3/B3, the two pairs of primers are

External primer F3:

TCATCACCGTCGAGGAGTC

External primer B3:

CGGCTCCGATGACCTTCTC

Internal primer FIP: Internal primer BIP:

AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG;

Or

External primer F3':

AGTCCATCGGTGACCTGATC

External primer B3':

AGGACCGCCTCCTGAC

Internal primer FIP':

GGTGTTGGACTCCTCGACGGGCCGAGGCGATGGACAA

Internal primer ΒΙΡ':

GCAGCTCGAGCTCACCGAGCGGGTCGGTCACGAAGT;

Or

External primer F3":

TCATCACCGTCGAGGAGTC

External primer B3":

AGCGGCAGCAGRTCCT

Internal primer FIP": Internal primer BIP":

AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG;

Among them, V generation ^ A / C / G, R represents A / G.

The Mycobacterium detection kit according to claim 1, wherein the Mycobacterium detection kit further comprises a fo DNA polymerase, a reaction solution, a stabilizing solution, a sample pretreatment liquid, and a display Color solution and positive control solution.

The Mycobacterium detection kit according to claim 2, wherein

The fo DNA polymerase: the enzyme concentration is 4-10 Ό/μΙ;

The sample pretreatment liquid comprises: 10 ~ 20 mmol / L pH 8.0 Tris-HC1, 1 ~ 2 mmol / L EDTA and 1 ~ 1.2 vol% Triton X-100;

The color developing solution is SYBR Green I or Eva Green;

The stabilizing liquid is paraffin oil;

The positive control is BCG genomic DNA;

The internal primers FIP/BIP are each 0.2 to 0.25 mol/L, and the external primers F3/B3 are each 1.2 to 2.0 mol/L.

The Mycobacterium detection kit according to claim 3, wherein

The fo DNA polymerase: enzyme concentration 8 U / L;

The reaction solution contains: 2 mmol/L dNTP, 25 mmol/L Tris-HCl, 12.5 mmol/L KC1, 12.5 mmol/L (NH ₄ ) ₂ S0 ₄ , 10 mmol/L MgS0 ₄ , 0.125 vol% 13⁄4 01^- 100, lmol / L betaine;

The sample pretreatment liquid contains: 20 mmol/L Tris-HCl, pH 8.0, 2 mmol/L EDTA, and

1.2% by volume Triton X-100;

The color developing solution is SYBR Green I;

The concentration of the internal primers FIP/BIP is 0.2 mol/L;

The concentration of the external primer F3/B3 was 1.6 mol/L each.

The Mycobacterium detection kit according to claim 2, 3 or 4, wherein the Mycobacterium detection kit further comprises a reaction tube, and the reaction tube is composed of a tube and a tube The cover is composed of two parts, and the lower part of the inner cavity of the tube is provided with a longitudinally extending partition which divides it into two cavities A and B.

The Mycobacterium detection kit according to claim 5, wherein the two cavities A and B are respectively provided with a working fluid or a color developing liquid, and the liquid upper layer in the two cavities Both are sealed by a stabilizing liquid, which is a mixture of a reaction solution and Bst DNA polymerase.

A method of using the Mycobacterium detection kit according to claim 2, wherein the method comprises the steps of:

The inner primer FIP/BIP and the outer primer F3/B3 in the step (3) are two pairs of primers designed based on the hsp65 gene of Mycobacterium and designed based on loop-mediated constant temperature amplification technology.

The method according to claim 7, wherein in the step (3), the reaction condition of the constant temperature reaction is a temperature of 63 to 65 ° C, and a reaction time of 45 to 90 min. .