CN102827944A - Mycobacterium detection kit and using method thereof - Google Patents
Mycobacterium detection kit and using method thereof Download PDFInfo
- Publication number
- CN102827944A CN102827944A CN2012103522305A CN201210352230A CN102827944A CN 102827944 A CN102827944 A CN 102827944A CN 2012103522305 A CN2012103522305 A CN 2012103522305A CN 201210352230 A CN201210352230 A CN 201210352230A CN 102827944 A CN102827944 A CN 102827944A
- Authority
- CN
- China
- Prior art keywords
- mycobacterium
- detection kit
- reaction
- primer
- bip
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a mycobacterium detection kit which comprises two pairs of primers including internal primer FIP/ BIP and external primer F3/ B3; and the primers take mycobacterium hsp65 as a target gene and are designed based on a loop-mediated isothermal amplification technology. The mycobacterium detection kit is more comprehensive in detection effect and low in undetected rate.
Description
Technical field
The present invention relates to biological detection reagent, be specifically related to a kind of Mycobacterium detection kit and method of use thereof.
Background technology
Mycobacterium (Mycobacterium) is one type of elongated bacillus that has a little bending, the trend of branch branch growth is arranged, thereby gain the name.This Pseudomonas kind is more, can be divided into three types of mycobacterium tuberculosis complex, non-tuberculous mycobacteria and Mycobacterium lepraes.
Mycobacterium tuberculosis (M.tuberculosis) is commonly called as tubercule bacillus or tubercule bacillus, is to cause pathogenic bacteria lungy.White plaque is the serious infectious diseases that threaten the mankind and animal health.The World Health Organization (WHO) has issued global tuberculosis control strategy specially, and being decided to be the World Tuberculosis Prevention and Cure Day annual March 24.
Corresponding with mycobacterium tuberculosis complex is various non-tuberculous mycobacterias, has found at present extensively to be present in soil, environment, the animal hundreds of.2000 the 4th time national tuberculosis epidemiological random sampling survey report shows that China has active tuberculosis patient 4,510,000 now, bacterium sun lunger 1,960,000.Mycobacterium is cultivated among the positive person, and mycobacterium tuberculosis accounts for 86.4%, and mycobacterium tuberculosis var bovis accounts for 2.5%, and non-tuberculous mycobacteria accounts for 11.1%.And nineteen ninety national for the third time white plaque stream timing non-tuberculous mycobacteria only account for 4.9%, this shows the more preceding obvious increase of the ratio of non-tuberculous mycobacteria.The non-tuberculous mycobacteria patient adopts the chemotherapy regimen of present standard to fail to respond to any medical treatment to most of line antitubercular agent resistances.Traditional mycobacteria strain is identified and the drug sensitive experiment method is based upon on the cultivation basis; Loaded down with trivial details, time-consuming, need 1～2 month, can not satisfy the clinical early stage effectively needs of chemotherapy of carrying out; Make the non-tuberculous mycobacteria patient through the long-term rule chemotherapy and unsatisfactory curative effect; Prolong the course of treatment, becomes refractory, controls the patient again, and bacterium possibly sent out in the part.Therefore, the Rapid identification of Mycobacterium all has extremely important meaning to white plaque and sick early diagnosis, differential diagnosis, effective chemotherapy and the control propagation of non-tuberculous mycobacteria.
Tradition mycobacterium detection method, shortcoming can not satisfy the modern requirement that detects far away because its sense cycle is long, program is complicated, required reagent is various etc.With polymerase chain reaction (PCR) technology is that the cause of disease nucleic acid detection technique of representative exists some problems in practical application; Like the special instrument of common polymerase chain reaction (PCR) Technology Need, and there are easy crossed contamination and the loaded down with trivial details shortcoming of operating process.And fluorescence real-time quantitative polymerase chain reaction (real time PCR) and simplified operating process though technology has solved the problem of crossed contamination preferably, needs more complicated quantitatively determined instrument, therefore is not suitable for field quick detection.And the cost of fluorescent probe is higher in the real-time quantitative polymerase chain reaction PCR technology, has strengthened the difficulty of applying.The immunology detection technology is fast and convenient with low cost, but requires the monoclonal antibody of high quality high stability, otherwise because of accuracy is not enough, can only be the auxiliary detection means at present.So in time use the newest fruits of biotech development significant to satisfying improving constantly of pathogenic micro-organism detection requirement.Wherein constant-temperature amplification (Isothermal Amplification) nucleic acid Fast Detection Technique is the rapid progress on the cause of disease nucleic acid detection technique, and the loop-mediated isothermal amplification technology of at present having set up (LAMP) has a lot of meliority.
Therefore, need a kind of detect effect more comprehensively, specificity is high, loss is low Mycobacterium detection kit and method of use thereof to be to address the above problem.
Summary of the invention
The objective of the invention is to solve the weak point of prior art and provide a kind of detect effect more comprehensively, specificity is high, loss is low Mycobacterium detection kit.
The object of the invention can be realized through following technical measures: a kind of Mycobacterium detection kit; Described Mycobacterium detection kit comprise the hsp65 gene with Mycobacterium be target gene, based on two pairs of primers of loop-mediated isothermal amplification technology design: inner primer FIP/BIP and outer primer F3/B3, described two pairs of primers do
Outer primer F3: (SEQ ID NO 1)
TCATCACCGTCGAGGAGTC
Outer primer B3: (SEQ ID NO 2)
CGGCTCCGATGACCTTCTC
Inner primer FIP: (SEQ ID NO 3)
GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC
Inner primer BIP: (SEQ ID NO 4)
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG；
Or
Outer primer F3 ': (SEQ ID NO 5)
AGTCCATCGGTGACCTGATC
Outer primer B3 ': (SEQ ID NO 6)
AGGACCGCCTCCTGAC
Inner primer FIP ': (SEQ ID NO 7)
GGTGTTGGACTCCTCGACGGGCCGAGGCGATGGACAA
Inner primer BIP ': (SEQ ID NO 8)
GCAGCTCGAGCTCACCGAGCGGGTCGGTCACGAAGT；
Or
Outer primer F3 ": (SEQ ID NO 1)
TCATCACCGTCGAGGAGTC
Outer primer B3 ": (SEQ ID NO 9)
AGCGGCAGCAGRTCCT
Inner primer FIP ": (SEQ ID NO 10)
CGGTCACGAAGTACCCCGAGATCTGCAGCTCGAGCTCACC
Inner primer BIP ": (SEQ ID NO 4)
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG；
Wherein, V represents A/C/G, and R represents A/G.
The present invention is directed to the hsp65 gene design primer of Mycobacterium; Said hsp65 gene is 65kDa heat shock protein(HSP) (heat shock protein) gene; Because this gene high conservative also extensively is present in each Mycobacterium bacterial classification; Therefore its primer can increase and detect mycobacterium tuberculosis complex and all bacterial classifications of non-tuberculous mycobacteria, comprising: mycobacterium tuberculosis (M.tuberculosis), mycobacterium microti (M.microti), mycobacterium africanum (M.africanum), Mycobacterium bovis (M.bovis), mycobacterium kansasii (M.kansasii), Mycobacterium intracellulare (M.intracellulare), Mycobacterium chelonei (M.chelonae), mycobacterium fortutitum (M.fortuitum), mycobacterium gordonae (M.gordonae), Mycobacterium marinum (M.marinum), M. smegmatics (M.smegmatis), mycobacterium terrae (M.terrae), mycobacterium avium (M.avium), Mycobacterium phlei (M.phlei), scrofula mycobacterium (M.scrofulaceum), mycobacterium abscessus (M.abscessus), mycobacterium buruli (M.ulcerans), Shi Shi mycobacterium (M.shimoidei), Asia mycobacterium (M.asiaticum), mycobacterium xenopi (M.xenopi), mycobacterium gastri (M.gastri).
As the preferred implementation of Mycobacterium detection kit of the present invention, described Mycobacterium detection kit also comprises BstDNA polysaccharase, reaction solution, stable liquid, sample pretreatment liquid, colour developing liquid and positive control solution.
As the more preferably embodiment of Mycobacterium detection kit of the present invention,
Described BstDNA polysaccharase: enzyme concn 4-10U/ μ L;
Described reaction solution contains: 1.6～2mmol/L dNTP, 20～25mmol/L Tris-HCl, 10～12.5mmol/L KCl, 10～12.5mmol/L (NH
4)
2SO
4, 8～10mmol/L MgSO
4, 0.1～0.125 volume %TritonX-100,0.8～1mol/L trimethyl-glycine;
Described sample pretreatment liquid contains: the Tris-HCl of 10～20mmol/L pH 8.0,1～2mmol/LEDTA and 1～1.2 volume %Triton X-100;
Described colour developing liquid is SYBR Green I or Eva Green;
Said stable liquid is Yellow Protopet 2A;
Described positive control is the BCG genomic dna;
Described inner primer FIP/BIP respectively is 0.2～0.25 μ mol/L, and the concentration of outer primer F3/B3 respectively is 1.2～2.0 μ mol/L.
As the most preferred embodiment of Mycobacterium detection kit of the present invention,
Described BstDNA polysaccharase: enzyme concn 8U/ μ L;
Described reaction solution contains: 2mmol/L dNTP, 25mmol/L Tris-HCl, 12.5mmol/L KCl, 12.5mmol/L (NH
4)
2SO
4, 10mmol/L MgSO
4, 0.125 volume %TritonX-100,1mol/L trimethyl-glycine;
Described sample pretreatment liquid contains: the Tris-HCl of 20mmol/L pH 8.0,2mmol/L EDTA and 1.2 volume %Triton X-100;
Described colour developing liquid is SYBR Green I;
The concentration of described inner primer FIP/BIP is 0.2 μ mol/L;
The concentration of described outer primer F3/B3 is 1.6 μ mol/L.
Preferred implementation as Mycobacterium detection kit of the present invention; Described Mycobacterium detection kit also comprises reaction tubes; Described reaction tubes covers two portions by body with pipe to be formed, and the bottom of tube cavity is provided with the dividing plate of the longitudinal extension that is divided into A, two cavitys of B.
More preferably embodiment as Mycobacterium detection kit of the present invention; Working fluid or colour developing liquid are housed respectively in described A, two cavitys of B; Seal up for safekeeping by stable liquid on liquid upper strata in two cavitys, and said working fluid is mixing of reaction solution and BstDNA polysaccharase.
Loop-mediated isothermal amplification technology (LAMP) be a kind of fast, sensitive, detection of nucleic acids mode accurately, its amplification efficiency is superpower, shows two aspects: what (1) remolding sensitivity PCR exceeded is the difference of the order of magnitude; (2) the DNA quantity of amplified production also exceeds too much than PCR product, can reach several μ g; But too sensitive and product amount is huge; Make LAMP pollute extremely easily, especially behind the LAMP amplified reaction, need the reaction tubes adding developer of uncapping, occur aerosol easily and pollute.And the aerosol pollution can make the detected result false positive rate high, and pollutes other samples, and the pollution detection zone also is difficult to remove simultaneously.Reaction tubes of the present invention is through the design of dividing plate and stable liquid; To develop the color effectively liquid and working fluid separated, and can not only guarantee the closure that in storage and transport process, is kept perfectly relatively, and need not to open the pipe lid; Just can realize coupling reaction, reduce aerocolloidal pollution greatly.
The present invention also provides a kind of method of use of Mycobacterium detection kit, and this method comprises the steps:
(1) testing sample is centrifugal, remove supernatant, obtain deposition;
(2) deposition with step (1) adds sample pretreatment liquid, mix, and cooled on ice after the boiling water bath deactivation, high speed centrifugation, supernatant are the sample template DNA;
(3) in reaction vessel, add Bst archaeal dna polymerase 0.9～1.8 volume parts, reaction solution 38 ~ 40 volume parts, stable liquid 52～54.5 volume parts, sample template DNA 4.5 ~ 9 volume parts, each 2 volume parts of inner primer FIP/BIP, each 4 volume parts of outer primer F3/B3, isothermal reaction;
(4) in above-mentioned reaction vessel and positive control, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative;
Inner primer FIP/BIP in the said step (3) and outer primer F3/B3 for be target gene with the hsp65 gene of Mycobacterium, based on two pairs of primers of loop-mediated isothermal amplification technology design.
Use the preferred implementation of the method for Mycobacterium detection kit as the present invention, in the step (3), the reaction conditions of isothermal reaction is 63～65 ℃ of temperature, reaction times 45～90min.
The present invention is said based on loop-mediated isothermal amplification technology (loop-mediated isothermal amplication of DNA; Abbreviation LAMP) method of rapid detection Mycobacterium; It is the special inside and outside primer (being inner primer FIP/BIP and outer primer F3/B3) of two couples that utilizes the BstDNA polysaccharase and design according to target-gene sequence; Six isolated areas on the specific recognition target sequence; Start the endless chain replacement(metathesis)reaction, start complementary strand in target DNA district synthetic, and result's complementary sequence on same chain goes round and begins again and is formed with the very stem of polycyclic Cauliflower structure-circular DNA mixture.In the LAMP reaction process, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product---magnesium pyrophosphate milky white precipitate, can be through the visual inspection result of determination.The LAMP reaction is under constant temperature (63～65 ℃) condition, to accomplish in 45～90 minutes.This comparatively gentle temperature condition and do not have temperature cycle that required instrument is oversimplified, overcome conventional P CR inherent detection time long, pollute easily and detect shortcoming such as cost height.In addition, this detection method is lower to testing staff's technical quality requirement, and actually operating is very easy, does not need special reagent and plant and instrument, helps setting up rapid screening system with low cost.The LAMP method is a kind of gene amplification method of easy, quick, high degree of specificity.Constant temperature gene amplification technology and round pcr (comprising the fluorescence real-time quantitative PCR technology) are compared; Can find and technology on methodology indexs such as sensitivity, specificity and sensing range, to be equivalent to or to be superior to round pcr; And do not rely on any special plant and instrument and can realize on-the-spot high-throughput rapid detection, and detect cost far below fluorescent quantitative PCR technique.Be accredited as passing method main, that combine biochemical analysis and serological typing to identify with mikrobe separation and Culture and morphology in the national standard at present, preliminary evaluation needs 2～3 days, accomplishes probation report and needs 10～15 days; Adopt detection kit of the present invention only to need 2 hours.And, having added colour developing liquid in the reaction system of the present invention, qualification result is visual and clear more.
Compared with prior art, the present invention has following beneficial effect: 1. detection kit of the present invention only needs just ability amplified reaction of a steady temperature, does not need special reagent and equipment, and it is low to detect cost; 2. gene quick diagnosis kit of the present invention is used six sections, four primers, and whether the existence that just can judge target substance according to whether increasing to be, so has high specific; 3. detection kit of the present invention amplification fast and efficient can accomplish amplification less than 1 hour, and productive rate is high; 4. detection kit of the present invention is highly sensitive, and amplification template only needs 10 copies or still less; 5. gene quick diagnosis kit of the present invention is identified easy, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product---the magnesium pyrophosphate deposition, can identify through visual inspection, and after adding colour developing liquid, yin and yang attribute colour development difference as a result is remarkable, the checking rate is high, and is more obviously reliable; 6. owing to selected the hsp65 gene of high conservative property to design primer, make that the accuracy rate of detection kit detection Mycobacterium of the present invention is higher as target gene; 7. in detection kit of the present invention, adopt special reaction tubes, reduced the aerosol contamination of heavy, simultaneously handled easily.
Embodiment
For making the present invention be more prone to understand, will further set forth specific embodiment of the present invention below.
Following shortenings is applicable to the present invention:
LAMP:loop-mediated isothermal amplification, loop-mediated isothermal amplification dNTP:deoxyribonucleoside triphosphate, deoxynucleoside triphosphate
Bst enzyme: Bst DNA polymerase (large fragment), Bst archaeal dna polymerase (big fragment)
EDTA:ethylenediamine tetraacetic acid, YD 30
DNA:deoxyribonucleic acid, thymus nucleic acid
Betaine: trimethyl-glycine
Triton X-100: polyoxyethylene octyl phenyl ether
The hsp65:65kDa heat shock protein(HSP)
BCG: BCG-CWS
The preparation of embodiment 1 test kit
(1) synthesize oligomerization picodna primer by following sequence through dna synthesizer:
Outer primer F3: (SEQ ID NO 1)
TCATCACCGTCGAGGAGTC
Outer primer B3: (SEQ ID NO 2)
CGGCTCCGATGACCTTCTC
Inner primer FIP: (SEQ ID NO 3)
GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC
Inner primer BIP: (SEQ ID NO 4)
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG
(V represents A/C/G)
(2) purchase archaeal dna polymerase: the BstDNA polysaccharase places container;
(3) preparation reaction solution and primer: reaction solution contains 2mmol/LdNTP, 25mmol/L Tris-Cl, 12.5mmol/L KCl, 12.5mmol/L (NH
4)
2SO
4, 10mmol/L MgSO
4, each 0.2 μ mol/L of 0.125 volume %TritonX-100,1mol/L trimethyl-glycine, inner primer FIP/BIP and each 0.25 μ mol/L of outer primer F3/B3, place container;
(4) preparation sample pretreatment liquid: sample pretreatment liquid contains 20mmol/L Tris-HCl (pH 8.0), 2mmol/L EDTA and 1.2 volume %Triton X-100, places container;
(5) purchase stable liquid: Yellow Protopet 2A places container;
(6) purchase colour developing liquid: SYBR Green I places container;
(7) extract positive control: extract the BCG genomic dna, place container;
(8) above-mentioned 7 containers are dressed up test kit, encapsulation.
Preparation technology is summarized as follows:
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, confirm the quality inspection of sampling with carrying out concentration with the liquid asepsis packing of above-mentioned (2) ~ (4) step preparation, and according to experiment;
3, with the stable liquid packing, the sampling quality inspection;
4, with the positive control sample preparations, packing, sampling quality inspection;
5, assembling test kit.
The preparation of embodiment 2 test kits
(1) synthesize oligomerization picodna primer by following sequence through dna synthesizer:
Outer primer F3: (SEQ ID NO 1)
TCATCACCGTCGAGGAGTC
Outer primer B3: (SEQ ID NO 2)
CGGCTCCGATGACCTTCTC
Inner primer FIP: (SEQ ID NO 3)
GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC
Inner primer BIP: (SEQ ID NO 4)
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG
(V represents A/C/G)
(2) purchase archaeal dna polymerase: the BstDNA polysaccharase places container;
(3) preparation reaction solution and primer: reaction solution contains 1.6mmol/LdNTP, 20mmol/L Tris-Cl, 10mmol/L KCl, 10mmol/L (NH
4)
2SO
4, 8mmol/L MgSO
4, each 0.2 μ mol/L of 0.1 volume %TritonX-100,0.8mol/L trimethyl-glycine, inner primer FIP/BIP and each 0.25 μ mol/L of outer primer F3/B3, place container;
(4) preparation sample pretreatment liquid: sample pretreatment liquid contains 10mmol/L Tris-HCl (pH 8.0), 1mmol/L EDTA and 1.0 volume %Triton X-100, places container;
(5) purchase stable liquid: Yellow Protopet 2A places container;
(6) purchase colour developing liquid: EVA Green I places container;
(7) extract positive control: extract the BCG genomic dna, place container;
(8) above-mentioned 7 containers are dressed up test kit, encapsulation.
Other are with embodiment 1.
The preparation of embodiment 3 test kits
Other conditions are identical with embodiment 1, and its difference only is that the primer in the step (1) is:
Outer primer F3 ': (SEQ ID NO 5)
AGTCCATCGGTGACCTGATC
Outer primer B3 ': (SEQ ID NO 6)
AGGACCGCCTCCTGAC
Inner primer FIP ': (SEQ ID NO 7)
GGTGTTGGACTCCTCGACGGGCCGAGGCGATGGACAA
Inner primer BIP ': (SEQ ID NO 8)
GCAGCTCGAGCTCACCGAGCGGGTCGGTCACGAAGT
The preparation of embodiment 4 test kits
Other conditions are identical with embodiment 1, and its difference only is that the primer in the step (1) is:
Outer primer F3 ": (SEQ ID NO 1)
TCATCACCGTCGAGGAGTC
Outer primer B3 ": (SEQ ID NO 9)
AGCGGCAGCAGRTCCT
Inner primer FIP ": (SEQ ID NO 10)
CGGTCACGAAGTACCCCGAGATCTGCAGCTCGAGCTCACC
Inner primer BIP ": (SEQ ID NO 4)
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG
(V represents A/C/G, and R represents A/G)
The application of embodiment 5 Mycobacterium detection kit
One, method and material
1, bacterial strain
The present invention adopts bacterial strain that 29 strains are arranged, and is mainly derived from the biological article of USS collecting center, Nat'l Pharmaceutical & Biological Products Control Institute.See table 1 for details.
Table 1 strain name and source
2, sample preparation (template DNA extraction)
(1) draw culture bacteria liquid 1mL, the centrifugal 2min of 12000rpm obtains bacterial sediment;
(2) in above-mentioned bacterial sediment, add 100 μ L DNA extraction liquid I, boiling water bath 10min adds 12.5 μ LDNA extracting solution II, mixings slightly; The centrifugal 2min of 12000rpm, supernatant is the sample template DNA.
3, the reaction process of loop-mediated isothermal amplification technology
(1) in 200 μ L reaction tubess preparation reaction system: reaction solution and primer be totally 22 μ L, BstDNA polysaccharase 0.5 μ L (4U), stable liquid 30 μ L, template DNA 2.5 μ L.
(2) with the reaction tubes for preparing in 65 ℃ of isothermal reactions 1 hour.
4, post-reaction treatment
In above-mentioned reaction product, add 2 μ L SYBR Green I; Mixing; Also add SYBR Green I mixing in heliotropism control tube (BCG genomic dna) and the negative control pipe (deionized water) simultaneously; If the same shows green with the positive control pipe of reaction tubes is then positive, as if reaction tubes the same with the negative control pipe manifest orange then negative.
5, electrophoresis
Prepare 0.2% agarose gel electrophoresis.Carry out the coupling reaction observations with SYBR Green I as dyestuff.
6, specific degree test
Pure bacterial strain LAMP detects and with the LAMP method 29 strain bacteriums increased, and is green positive according to the coupling reaction observations, orange feminine gender, verification method specificity.
7, sensitivity test
M.bovis BCG essence is carried nucleic acid, do 10 times of multiple proportions continuous gradients with TE and be diluted to 10
-10, carry out LAMP and detect.
8, test of replica test specific degree and sensitivity test repeat respectively 2 times.
Two, result
1, specific degree test
4 strain mycobacterium tuberculosis complex detected results are positive, and 17 strain non-tuberculous mycobacteria detected results are positive, and Vaccinum Calmette-Guerini BCG is positive, and the non-mycobacterium of 7 strains is all negative, as shown in table 2.The visualizingre agent box has high specific as a result.
Table 2 detected result
| Test sample | The result |
| M.tuberculosis?H37Rv（ATCC?27294） | Positive |
| M.microti（ATCC?19422） | Positive |
| M.africanum（ATCC?25420） | Positive |
| M.bovis（ATCC?19210） | Positive |
| M.kansassi （ATCC?12478） | Positive |
| M.intracellulare（ATCC?13950） | Positive |
| M.chelonae（ATCC?14472） | Positive |
| M.fortuitum（ATCC?6481） | Positive |
| M.gordonae（ATCC?14470） | Positive |
| M.marinum（ATCC?927） | Positive |
| M.smegmatis（ATCC?19420） | Positive |
| M.terrae（ATCC?19619） | Positive |
| M.avium（ATCC?25291） | Positive |
| M.phlei（ATCC?11758） | Positive |
| M.scrofulaceum（ATCC?19981） | Positive |
| M.abscessus（ATCC?19977） | Positive |
| M.ulcerans（ATCC?19423） | Positive |
| ?M.shimoidei（ATCC?27962） | Positive |
| ?M.asiaticum（ATCC?25276） | Positive |
| ?M.xenopi（ATCC?19250） | Positive |
| ?M.gastri（ATCC?15754） | Positive |
| ?M.bovis?BCG | Positive |
| Streptococcus aureus | Negative |
| Shigellae | Negative |
| Vibrio parahaemolyticus | Negative |
| Salmonellas | Negative |
| Listeria monocytogenes | Negative |
| Yersinia entero-colitica | Negative |
| The beta hemolysis suis | Negative |
| Positive control | Positive |
| Negative control | Negative |
2, sensitivity test
The bacterium original liquid concentration is 1.26 * 10
6CFU/mL, the LAMP method can detect the 4th extent of dilution, is 1.26 * 10
2CFU/mL.
Electrophoresis result also meets The above results.
3, replica test
Specific degree test repetition twice, the result is consistent.Sensitivity test repeats twice, order-of-magnitude agreement.
Embodiment 6 adopts the Mycobacterium detection kit of reaction tubes
The Mycobacterium detection kit of present embodiment; The reagent that adopts is identical with embodiment 1 with primer; Test kit also comprises reaction tubes, and reaction tubes covers two portions by body with pipe to be formed, and the bottom of tube cavity is provided with the dividing plate of the longitudinal extension that is divided into A, two cavitys of B; Wherein: the LAMP reaction solution of 22.0 μ L and the BstDNA polysaccharase of 0.5 μ L are housed in the cavity A, and the liquid upper strata is sealed up for safekeeping by paraffin; The LAMP reaction solution liquid of 2.0 μ L is housed in the cavity B, and the liquid upper strata is also sealed up for safekeeping by paraffin, with this reaction tubes-20 ℃ preservation.
Present embodiment adopts reaction tubes as container, Mycobacterium is carried out LAMP detect, and is provided with positive controls and negative control group simultaneously, specifically comprises the steps:
Get three of the reaction tubess of above-mentioned preparation; Adopt liquid-transfering gun to add each 2.5 μ L of negative control sample, detected sample and positive control sample respectively, rifle head pierce through the protection liquid layer during application of sample, sample adds in the reaction tubes A chamber; Tight pipe lid of lid and marked move to reaction zone.
With above-mentioned reaction tubes all in 65 ℃ of isothermal reaction 1h.
Reaction finishes, and reaction tubes is inverted whipping 1 time, is just putting whipping again 1 time, and working fluid and colour developing liquid thorough mixing are evenly observed the back.
If the same shows green with the positive control pipe of reaction tubes is then positive, as if reaction tubes the same with the negative control pipe manifest orange then negative.
In the LAMP reaction process, colour developing liquid and working fluid sealed state is good, not have to take place situation about revealing mutually, and the later stage is during coupling reaction, is inverted the whipping operation and makes colour developing liquid and working fluid mixing, and the result that develops the color is clear.
Last institute should be noted that; Above embodiment is only in order to technical scheme of the present invention to be described but not to the restriction of protection domain of the present invention; Although the present invention has been done detailed description with reference to preferred embodiment; Those of ordinary skill in the art should be appreciated that and can make amendment or be equal to replacement technical scheme of the present invention, and do not break away from the essence and the scope of technical scheme of the present invention.
Claims (8)
1. Mycobacterium detection kit; It is characterized in that; Described Mycobacterium detection kit comprise the hsp65 gene with Mycobacterium be target gene, based on two pairs of primers of loop-mediated isothermal amplification technology design: inner primer FIP/BIP and outer primer F3/B3, described two pairs of primers do
Outer primer F3:
TCATCACCGTCGAGGAGTC
Outer primer B3:
CGGCTCCGATGACCTTCTC
Inner primer FIP:
GTCGGTCACGAAGTACCCCGAGCTGCAGCTCGAGCTCACC
Inner primer BIP:
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG；
Or
Outer primer F3 ':
AGTCCATCGGTGACCTGATC
Outer primer B3 ':
AGGACCGCCTCCTGAC
Inner primer FIP ':
GGTGTTGGACTCCTCGACGGGCCGAGGCGATGGACAA
Inner primer BIP ':
GCAGCTCGAGCTCACCGAGCGGGTCGGTCACGAAGT；
Or
Outer primer F3 ":
TCATCACCGTCGAGGAGTC
Outer primer B3 ":
AGCGGCAGCAGRTCCT
Inner primer FIP ":
CGGTCACGAAGTACCCCGAGATCTGCAGCTCGAGCTCACC
Inner primer BIP ":
AGCGTCAGGAGGCVGTCCTTGACAGTGGACACCTTGGAG；
Wherein, V represents A/C/G, and R represents A/G.
2. Mycobacterium detection kit according to claim 1 is characterized in that, described Mycobacterium detection kit also comprises BstDNA polysaccharase, reaction solution, stable liquid, sample pretreatment liquid, colour developing liquid and positive control solution.
3. Mycobacterium detection kit according to claim 2 is characterized in that,
Described BstDNA polysaccharase: enzyme concn 4-10U/ μ L;
Described reaction solution contains: 1.6～2mmol/L dNTP, 20～25mmol/L Tris-HCl, 10～12.5mmol/L KCl, 10～12.5mmol/L (NH
4)
2SO
4, 8～10mmol/L MgSO
4, 0.1～0.125 volume %TritonX-100,0.8～1mol/L trimethyl-glycine;
Described sample pretreatment liquid contains: the Tris-HCl of 10～20mmol/L pH 8.0,1～2mmol/LEDTA and 1～1.2 volume %Triton X-100;
Described colour developing liquid is SYBR Green I or Eva Green;
Said stable liquid is Yellow Protopet 2A;
Described positive control is the BCG genomic dna;
Described inner primer FIP/BIP respectively is 0.2～0.25 μ mol/L, and the concentration of outer primer F3/B3 respectively is 1.2～2.0 μ mol/L.
4. Mycobacterium detection kit according to claim 3 is characterized in that,
Described BstDNA polysaccharase: enzyme concn 8U/ μ L;
Described reaction solution contains: 2mmol/L dNTP, 25mmol/L Tris-HCl, 12.5mmol/L KCl, 12.5mmol/L (NH
4)
2SO
4, 10mmol/L MgSO
4, 0.125 volume %TritonX-100,1mol/L trimethyl-glycine;
Described sample pretreatment liquid contains: the Tris-HCl of 20mmol/L pH 8.0,2mmol/L EDTA and 1.2 volume %Triton X-100;
Described colour developing liquid is SYBR Green I;
The concentration of described inner primer FIP/BIP respectively is 0.2 μ mol/L;
The concentration of described outer primer F3/B3 respectively is 1.6 μ mol/L.
5. according to claim 2,3 or 4 described Mycobacterium detection kit; It is characterized in that; Described Mycobacterium detection kit also comprises reaction tubes; Described reaction tubes covers two portions by body with pipe to be formed, and the bottom of tube cavity is provided with the dividing plate of the longitudinal extension that is divided into A, two cavitys of B.
6. Mycobacterium detection kit according to claim 5; It is characterized in that; Working fluid or colour developing liquid are housed respectively in described A, two cavitys of B, and seal up for safekeeping by stable liquid on the liquid upper strata in two cavitys, and said working fluid is mixing of reaction solution and BstDNA polysaccharase.
7. a method of using Mycobacterium detection kit as claimed in claim 2 is characterized in that this method comprises the steps:
(1) testing sample is centrifugal, remove supernatant, obtain deposition;
(2) deposition with step (1) adds sample pretreatment liquid, mix, and cooled on ice after the boiling water bath deactivation, high speed centrifugation, supernatant are the sample template DNA;
(3) in reaction vessel, add Bst archaeal dna polymerase 0.9～1.8 volume parts, reaction solution 38 ~ 40 volume parts, stable liquid 52～54.5 volume parts, sample template DNA 4.5 ~ 9 volume parts, each 2 volume parts of inner primer FIP/BIP, each 4 volume parts of outer primer F3/B3, isothermal reaction;
(4) in above-mentioned reaction vessel and positive control, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative;
Inner primer FIP/BIP in the said step (3) and outer primer F3/B3 for be target gene with the hsp65 gene of Mycobacterium, based on two pairs of primers of loop-mediated isothermal amplification technology design.
8. the method for use Mycobacterium detection kit according to claim 7 is characterized in that, in the said step (3), the reaction conditions of isothermal reaction is 63～65 ℃ of temperature, reaction times 45～90min.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310426393.8A CN103451309B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
| CN201210352230.5A CN102827944B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
| PCT/CN2013/083310 WO2014044142A1 (en) | 2012-09-19 | 2013-09-11 | Mycobacterium detection kit and method of use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210352230.5A CN102827944B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310426393.8A Division CN103451309B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102827944A true CN102827944A (en) | 2012-12-19 |
| CN102827944B CN102827944B (en) | 2014-07-23 |
Family
ID=47331251
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210352230.5A Active CN102827944B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
| CN201310426393.8A Active CN103451309B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310426393.8A Active CN103451309B (en) | 2012-09-19 | 2012-09-19 | Mycobacterium detection kit and using method thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (2) | CN102827944B (en) |
| WO (1) | WO2014044142A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088139A (en) * | 2013-01-28 | 2013-05-08 | 清华大学 | Primer pair and standard substance for detecting mycobacteria and application thereof |
| WO2014044142A1 (en) * | 2012-09-19 | 2014-03-27 | 广州华峰生物科技有限公司 | Mycobacterium detection kit and method of use thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116287324B (en) * | 2022-09-20 | 2023-09-22 | 北京理工大学 | Primer and kit for detecting bacillus spatially and application of primer and kit |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101157954A (en) * | 2007-09-13 | 2008-04-09 | 中华人民共和国徐州出入境检验检疫局 | Concretion mycobacterium nucleic acid screening method based on loop-mediated isothermal amplification technique |
| CN101935693B (en) * | 2010-01-18 | 2012-03-28 | 广州华峰生物科技有限公司 | Mycobacterium tuberculosis detection kit and use method thereof |
| CN101942508B (en) * | 2010-05-18 | 2012-11-14 | 广州华峰生物科技有限公司 | Escherichia coli detection kit and use method thereof |
| CN102827944B (en) * | 2012-09-19 | 2014-07-23 | 广州华峰生物科技有限公司 | Mycobacterium detection kit and using method thereof |
-
2012
- 2012-09-19 CN CN201210352230.5A patent/CN102827944B/en active Active
- 2012-09-19 CN CN201310426393.8A patent/CN103451309B/en active Active
-
2013
- 2013-09-11 WO PCT/CN2013/083310 patent/WO2014044142A1/en active Application Filing
Non-Patent Citations (6)
| Title |
|---|
| 《Tetsu Mukai》 20061125 Tetsu Mukai et al Identi�cation ofMycobacteriumspeciesbycomparative analysisof thednaA gene 232-239 1－6 第254卷, * |
| AMALIO TELENTI,ET AL: "Rapid Identification of Mycobacteria to the Species Level by Polymerase Chain Reaction and Restriction Enzyme Analysis", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| FRANCESCA BRUNELLO ET AL: "Identification of 54 Mycobacterial Species by PCR-Restriction Fragment Length Polymorphism Analysis of the hsp65 Gene", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| TETSU MUKAI ET AL: "Identi¢cation ofMycobacteriumspeciesbycomparative analysisof thednaA gene", 《TETSU MUKAI》 * |
| TETSU MUKAI ET AL: "Identi¢cation ofMycobacteriumspeciesbycomparative analysisof thednaA gene", 《TETSU MUKAI》, vol. 254, 25 November 2006 (2006-11-25), pages 232 - 239 * |
| TING-SHU WU ，ET AL: "Current Situations on Identification of Nontuberculous Mycobacteria", 《J BIOMED LAB SCI》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014044142A1 (en) * | 2012-09-19 | 2014-03-27 | 广州华峰生物科技有限公司 | Mycobacterium detection kit and method of use thereof |
| CN103088139A (en) * | 2013-01-28 | 2013-05-08 | 清华大学 | Primer pair and standard substance for detecting mycobacteria and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102827944B (en) | 2014-07-23 |
| CN103451309B (en) | 2015-11-18 |
| WO2014044142A1 (en) | 2014-03-27 |
| CN103451309A (en) | 2013-12-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101935693B (en) | Mycobacterium tuberculosis detection kit and use method thereof | |
| Wilton et al. | Detection and identification of multiple mycobacterial pathogens by DNA amplification in a single tube. | |
| AU664050B2 (en) | Process for lysing mycobacteria | |
| CN101892300B (en) | Klebsiella pneumoniae detection kit and use method thereof | |
| CN101942508B (en) | Escherichia coli detection kit and use method thereof | |
| CN102373273A (en) | Kit for detecting nucleic acid of mycobacterium tuberculosis and method thereof | |
| Wu et al. | Evaluation of the RT‐LAMP and LAMP methods for detection of Mycobacterium tuberculosis | |
| CN102827944B (en) | Mycobacterium detection kit and using method thereof | |
| CN101565753B (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN102094090A (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN101979660B (en) | Brucella detection kit and using method thereof | |
| CN101555529B (en) | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof | |
| Tabibnejad et al. | The optimization of molecular detection of clinical isolates of Brucella in blood cultures by eryD transcriptase gene for confirmation of culture-negative samples | |
| CN102251044A (en) | Enterorrhagia colibacillus stx1 gene detection kit and application method thereof | |
| CN102719548B (en) | Kit for detecting brucella and use method thereof | |
| CN102286620A (en) | Enterohemorrhagic E. coli stx2 gene detection kit and using method thereof | |
| Foongladda et al. | Multi-probe real-time PCR identification of common Mycobacterium species in blood culture broth | |
| CN101892299B (en) | Clostridium perfringen detection kit and user method thereof | |
| Ramezani et al. | Development of sensitive and rapid RNA transcription-based isothermal amplification method for detection of Mycobacterium tuberculosis | |
| CN102146470B (en) | Bacillus anthracis detection kit and using method of kit | |
| CN115873930A (en) | Double-target-point drug-resistant salmonella detection method based on RPA-Cas12a | |
| KR101523877B1 (en) | Methods for identification and detection of mycobacterium using real time polymerase chain reaction and melting curve analysis | |
| CN101824482A (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| Chitra et al. | Diagnostic Performance of Polymerase Chain Reaction Targeting Insertion Sequence (IS6110) for the Detection of Extra Pulmonary Tuberculosis | |
| CN101824483B (en) | Detection kit for vibrio cholerae O139 group and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |