RU2435852C1 - OLIGONUCLEOTIDE PRIMERS AND METHOD OF DETECTING DNA OF Mycobacterium paratuberculosis THAT IS PARATUBERCULOSIS AGENT BY METHOD OF POLYMERASE CHAIN REACTION (PCR) - Google Patents
OLIGONUCLEOTIDE PRIMERS AND METHOD OF DETECTING DNA OF Mycobacterium paratuberculosis THAT IS PARATUBERCULOSIS AGENT BY METHOD OF POLYMERASE CHAIN REACTION (PCR) Download PDFInfo
- Publication number
- RU2435852C1 RU2435852C1 RU2010123200/10A RU2010123200A RU2435852C1 RU 2435852 C1 RU2435852 C1 RU 2435852C1 RU 2010123200/10 A RU2010123200/10 A RU 2010123200/10A RU 2010123200 A RU2010123200 A RU 2010123200A RU 2435852 C1 RU2435852 C1 RU 2435852C1
- Authority
- RU
- Russia
- Prior art keywords
- paratuberculosis
- dna
- seq
- pcr
- oligonucleotide primers
- Prior art date
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к биотехнологии, а именно к генетической инженерии, и может быть использовано для экспресс-диагностики паратуберкулезной инфекции, а также для решения научно-исследовательских задач по изучению полиморфизма Mycobacterium paratuberculosis (M.paratuberculosis).The invention relates to biotechnology, namely to genetic engineering, and can be used for rapid diagnosis of paratuberculosis infection, as well as for solving research problems to study the polymorphism of Mycobacterium paratuberculosis (M.paratuberculosis).
В настоящее время паратуберкулез в России остается менее изученным, чем другие хронические болезни. Представляют научный интерес механизмы взаимодействия возбудителя с макроорганизмом, особенности инфекционного и эпизоотического процессов, биологические свойства возбудителя, что связано с исключительными трудностями выделения и культивирования М. paratuberculosis на искусственных питательных средах, с воспроизводством модельной инфекции как на лабораторных, так и на восприимчивых животных (Овдиенко Н.П. Профилактика и меры борьбы с паратуберкулезом животных / Н.П.Овдиенко, А.Х.Найманов, Н.Г.Толстенко и др.// Ветеринария. - 2007. - №12, - с.3-7).Currently, paratuberculosis in Russia remains less studied than other chronic diseases. Of interest are the mechanisms of interaction of the pathogen with the macroorganism, the characteristics of the infectious and epizootic processes, the biological properties of the pathogen, which is associated with the exceptional difficulties in the isolation and cultivation of M. paratuberculosis in artificial nutrient media, with the reproduction of a model infection in both laboratory and susceptible animals (Ovdienko N.P. Prevention and control measures against animal paratuberculosis / N.P. Ovdienko, A.Kh. Naimanov, N.G. Tolstenko et al. // Veterinary medicine. - 2007. - No. 12, - p. 3-7) .
Известны стандартные процедуры выявления возбудителя паратуберкулеза, которые начинаются с микроскопических исследований биоматериала на наличие кислотоустойчивых микобактерий с последующим посевом материала и биохимическим тестированием выращенных на питательных средах микроорганизмов с целью идентификации вида обнаруженных микобактерий. По наличию M.paratuberculosis ставят диагноз наличия паратуберкулезного процесса (Benazzi S. Paratuberculosis in sheep flocks in Morocco: a serological, microscopical and cultural survey / S.Benazzi, M. el Hamidi, and Т. Schliesser // Zentbl. Veterinarmed. - 1996. - V.43. - P.213-219). Недостатком способа является длительность проведения анализа из-за медленного роста микобактерий. При этом получение культур M.paratuberculosis из заведомо инфицированного материала удается не всегда и при окрашивании мазков кроме M.paratuberculosis выявляется множество различных видов кислото-спирто-антиформиноустойчивых микроорганизмов. Известна также автоматизированная система ВАСТЕС MGIT (Becton Dickenson) и МВ/ВасТ (Organon Teknika) для выделения микобактерий на жидких средах, дающая возможность получить результаты, начиная с 4-го дня после поступления диагностического материала в 81% случаев. При этом необходимо отметить, что автоматизированные системы ВАСТЕС MGIT (Becton Dickenson) и МВ/ВасТ (Organon Teknika) импортного производства и дорогостоящие (Патент РФ №2163022 от 28.05.1999).Standard procedures for identifying the pathogen of paratuberculosis are known, which begin with microscopic studies of the biomaterial for the presence of acid-resistant mycobacteria with subsequent sowing of the material and biochemical testing of microorganisms grown on nutrient media in order to identify the type of mycobacteria found. The presence of M. paratuberculosis is diagnosed with the presence of a paratuberculosis process (Benazzi S. Paratuberculosis in sheep flocks in Morocco: a serological, microscopical and cultural survey / S. Benazzi, M. el Hamidi, and T. Schliesser // Zentbl. Veterinarmed. - 1996 . - V.43. - P.213-219). The disadvantage of this method is the duration of the analysis due to the slow growth of mycobacteria. Moreover, obtaining cultures of M. paratuberculosis from obviously infected material is not always possible, and when staining smears, apart from M. paratuberculosis, many different types of acid-alcohol-antiformin-resistant microorganisms are detected. Also known is the automated system WASTES MGIT (Becton Dickenson) and MB / Bash (Organon Teknika) for the isolation of mycobacteria on liquid media, which makes it possible to obtain results starting from the 4th day after receipt of diagnostic material in 81% of cases. It should be noted that the automated systems VASTES MGIT (Becton Dickenson) and MV / VasT (Organon Teknika) are imported and expensive (RF Patent No. 2163022 dated 05/28/1999).
Известны методы диагностики паратуберкулеза, основанные на использовании полимеразной цепной реакции (ПЦР). Принцип метода состоит в увеличении в 106-108 раз копий специфического участка ДНК (дезоксирибонуклеотиновая кислота) микроорганизма, активизируемого ДНК-полимеразой в автоматическом режиме. Это высокоспецифичный и чрезвычайно чувствительный тест, с помощью которого принципиально возможно идентифицировать в анализируемой пробе наличие даже одной-единственной молекулы ДНК возбудителя. В качестве маркера для выявления и идентификации возбудителя паратуберкулеза наиболее часто используется последовательность IS900, которая присутствует в количестве 14-16 копий в пределах генома M.paratuberculosis (Mobius P. Comparison of 13 singleround and nested PCR assays targeting IS900, ISMav 2, fa57 and locus 255 for detection of Mycobacterium avium subsp.paratuberculosis / P.Mobius, H.Hotzel, A.Rassbach et al // Vet. Microbiol. - 2008. - V.126. - PP.324-333).Known methods for the diagnosis of paratuberculosis, based on the use of polymerase chain reaction (PCR). The principle of the method is to increase by 106-108 times copies of a specific section of DNA (deoxyribonucleotinic acid) of a microorganism activated by DNA polymerase in an automatic mode. This is a highly specific and extremely sensitive test, with the help of which it is fundamentally possible to identify the presence of even a single DNA molecule of the pathogen in the analyzed sample. As a marker for identifying and identifying the causative agent of paratuberculosis, the most commonly used sequence is IS900, which is present in an amount of 14-16 copies within the genome of M. paratuberculosis (Mobius P. Comparison of 13 singleround and nested PCR assays targeting IS900, ISMav 2, fa57 and locus 255 for detection of Mycobacterium avium subsp.paratuberculosis / P. Mobius, H. Hotzel, A. Rassbach et al // Vet. Microbiol. - 2008. - V.126. - PP.324-333).
Прототипом данного изобретения являются праймеры и способ выявления ДНК возбудителя паратуберкулеза, основанный на полимеразной цепной реакции (ПЦР), включающий выделение ДНК M.paratuberculosis, синтез олигонуклеотидных праймеров на последовательность IS900, амплификацию ДНК в гнездовой ПЦР и идентификацию продуктов ПЦР с помощью электрофореза в 1,5% агарозном геле (Bull Т. J. Detection and verification of Mycobacterium avium subsp.paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn's disease / T.J.Bull, E.J.McMinn, K.Sidi-Boumedine et al // J Clin Microbiol. 2003 July; 41(7): 2915-2923). Способ включает детекцию ДНК M.paratuberculosis в исследуемом материале путем проведения двухэтапной ПЦР с использованием на первом этапе двух внешних праймеров и матрицы в виде участка ДНК с получением амплификата, а на втором этапе - двух внутренних праймеров и матрицы в виде полученного на первом этапе амплификата с последующим определением полученных на втором этапе продуктов амплификации методом горизонтального электрофореза в 1,5% агарозном геле. При этом используются наружные праймеры для первого раунда амплификации: SEQ ID NO:1 и SEQ ID NO:2. Внутренние праймеры для второго раунда амплификации: SEQ ID NO:3 и SEQ ID NO:4.The prototype of this invention are primers and a method for detecting paratuberculosis pathogen DNA based on a polymerase chain reaction (PCR), including M. paratuberculosis DNA isolation, synthesis of oligonucleotide primers for IS900 sequence, DNA amplification in nested PCR and identification of PCR products using electrophoresis in 1, 5% agarose gel (Bull T. J. Detection and verification of Mycobacterium avium subsp. paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn's disease / TJBull, EJMcMinn, K.Sidi-Boumedine et al // J Clin Microbiol. 2003 July; 41 (7): 2915-2923). The method involves the detection of M.paratuberculosis DNA in the test material by two-stage PCR using two external primers and a template in the form of a DNA region in the first stage, and two internal primers and a matrix in the form of the amplification obtained in the first stage with the subsequent determination of amplification products obtained in the second stage by the method of horizontal electrophoresis in 1.5% agarose gel. In this case, external primers for the first round of amplification are used: SEQ ID NO: 1 and SEQ ID NO: 2. Internal primers for the second round of amplification: SEQ ID NO: 3 and SEQ ID NO: 4.
К недостаткам данного способа можно отнести то, что он проводится методом гнездовой ПЦР и требует синтез двух пар праймеров (внутренних и наружных) и соответственно проведения реакции в два раунда.The disadvantages of this method include the fact that it is carried out by the method of nested PCR and requires the synthesis of two pairs of primers (internal and external) and, accordingly, the reaction in two rounds.
Задача изобретения заключается в расширении способов выявления возбудителя паратуберкулеза в исследуемом материале с использованием молекулярно-биологических методов, в частности одностадийной полимеразной цепной реакции.The objective of the invention is to expand the methods for identifying the causative agent of paratuberculosis in the test material using molecular biological methods, in particular a one-stage polymerase chain reaction.
Поставленная задача решается тем, что синтезируются олигонуклеотидные праймеры, комплементарные специфичной для M.paratuberculosis области генома IS900, использующиеся для выявления ДНК Mycobacterium paratuberculosis - возбудителя паратуберкулеза, имеющие следующий нуклеотидный состав:The problem is solved in that oligonucleotide primers are synthesized that are complementary to the specific region of the IS900 genome specific for M. paratuberculosis and are used to detect DNA of Mycobacterium paratuberculosis, the causative agent of paratuberculosis, having the following nucleotide composition:
(SEQ ID NO:5) gaagggtgttcggggccgtcgcttagg(SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg
(SEQ ID NO:6) ggcgttgaggtcgatcgcccacgtgac.(SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac.
Задача решается также тем, что в способе выявления ДНК Mycobacterium paratuberculosis - возбудителя паратуберкулеза методом полимеразной цепной реакции (ПЦР), включающем выделение ДНК, амплификацию ДНК M.paratuberculosis на олигонуклеотидных праймерах, перенос продукта амплификации на гель и оценку проведения реакции, согласно изобретению праймеры имеют нуклеотидные последовательности (SEQ ID NO:5) и (SEQ ID NO:6), в случае положительной реакции синтезируется фрагмент, соответствующий размеру 413 п.н.The problem is also solved by the fact that in the method for detecting DNA of Mycobacterium paratuberculosis - the causative agent of paratuberculosis by polymerase chain reaction (PCR), including DNA extraction, amplification of M. paratuberculosis DNA on oligonucleotide primers, transfer of the amplification product to the gel and evaluation of the reaction, according to the invention, the primers nucleotide sequences (SEQ ID NO: 5) and (SEQ ID NO: 6); in the case of a positive reaction, a fragment corresponding to a size of 413 bp is synthesized.
Задача решается также тем, что ПЦР проводится в 1 раунд.The problem is also solved by the fact that PCR is carried out in 1 round.
Изобретение иллюстрируется следующими примерами:The invention is illustrated by the following examples:
Пример 1. Получение олигонуклеотидных праймеров. Получение праймеров осуществляют на основе известных последовательностей штаммов M.paratuberculosis, представленных в базе данных GenBank (http://www.ncbi.nim.nih.gov/ Genbank/GenbankOverview.html), при помощи программного обеспечения «Lasergen». Полученные последовательности нескольких пар праймеров тестируют на специфичность с помощью моделирования ПЦР в программе «Vector NTI Suit».Example 1. Obtaining oligonucleotide primers. Primers are prepared on the basis of known sequences of M. paratuberculosis strains presented in the GenBank database (http://www.ncbi.nim.nih.gov/ Genbank / Genbank Overview.html) using the Lasergen software. The obtained sequences of several pairs of primers are tested for specificity using PCR simulation in the Vector NTI Suit program.
В результате выбраны олигонуклеотидные праймеры (SEQ ID NO:5) и (SEQ ID NO:6), специфичные для M.paratuberculosis.As a result, oligonucleotide primers (SEQ ID NO: 5) and (SEQ ID NO: 6) specific for M. paratuberculosis were selected.
Химический синтез праймеров осуществляется по нашему заказу в ООО «Лаборатория Медиген», там же определяется концентрация олигонуклеотидов в маточном растворе.The chemical synthesis of primers is carried out by our order in LLC Laboratory Medigen, where the concentration of oligonucleotides in the mother liquor is also determined.
Пример 2. Выделение ДНК и постановка ПЦР. ДНК M.paratuberculosis выделяют с использованием набора ДНК-сорб-В (ЦНИИЭ) согласно прилагаемой инструкции. Отработку условий амплификации для данной пары праймеров проводят с использованием музейного штамма М. paratuberculosis, который включает в себя: отработку времени денатурации при 94°С - 30 сек - 1 мин, температуру отжига праймеров 58°С, 59°С, 60°С, 61°С, концентрацию ионов Mg2+ - от 0,8 до 2,5 mM, время циклов каждой стадии амплификации от 30 сек до 1 мин и количество циклов для каждой стадии от 20 до 35. Критерием правильности выбранного режима для каждого этапа проводимой реакции служит показательность результата - наличие или отсутствие искомого фрагмента ДНК определенного размера на электрофореграмме.Example 2. DNA isolation and PCR. M. paratuberculosis DNA was isolated using the DNA sorb-B kit (CNIIE) according to the attached instructions. The amplification conditions for this pair of primers are tested using a museum strain of M. paratuberculosis, which includes: working out the denaturation time at 94 ° C - 30 sec - 1 min, annealing temperature of the primers 58 ° C, 59 ° C, 60 ° C, 61 ° C, the concentration of Mg 2+ ions is from 0.8 to 2.5 mM, the cycle time of each stage of amplification is from 30 seconds to 1 min and the number of cycles for each stage is from 20 to 35. The criterion for the correctness of the selected mode for each stage carried out the reaction is indicative of the result - the presence or absence of the desired DNA fragment unit size on the electrophoregram.
Для ПЦР применяют готовую ПЦР-смесь GenPack PCR Universal, a также готовят инкубационную смесь конечным объемом 50 мкл, которая содержит 10 мМ Mg-буфер, 10 мМ dNTP, 2 мкл праймеров, 5 мкл ДНК-матрицы, 1ед. ДНК-полимеразы, оставшийся объем вода. Поверх смеси наслаивают 25 мкл минерального масла. В качестве матрицы используют ДНК стандартизированного штамма M.paratuberculosis (Центрально-Любинского), выделенную из биоматериала зараженных животных и из музейной культуры. Для идентификации ДНК M.paratuberculosis используют праймеры (SEQ ID NO: 5) и (SEQ ID NO: 6), гомологичные участку IS900, специфичному для M.paratuberculosis. Выбран следующий режим амплификации: денатурация при 94°С - 1 минута, затем 30 циклов, каждый из которых состоял из денатурации при 93°С - 30 секунд, отжига при 58°С - 1 минута, синтеза при 72°С - 30 секунд и 1 цикл при 72°С в течение 7 минут. Продукты ПЦР анализируют в 2% агарозном геле с нанесением в лунки 6 мкл амплификата. Электрофорез проводят в течение 30 минут при напряжении 300 В.For PCR, the prepared GenPack PCR Universal PCR mixture is used, and the incubation mixture is also prepared with a final volume of 50 μl, which contains 10 mM Mg-buffer, 10 mM dNTP, 2 μl of primers, 5 μl of DNA template, 1 unit. DNA polymerase, the remaining volume of water. Over the mixture layered 25 μl of mineral oil. As a matrix, DNA of a standardized strain of M. paratuberculosis (Central Lubinsky) isolated from the biomaterial of infected animals and from museum culture is used. For identification of M. paratuberculosis DNA, primers (SEQ ID NO: 5) and (SEQ ID NO: 6) homologous to the IS900 region specific for M. paratuberculosis are used. The following amplification mode was selected: denaturation at 94 ° C for 1 minute, then 30 cycles, each of which consisted of denaturation at 93 ° C for 30 seconds, annealing at 58 ° C for 1 minute, synthesis at 72 ° C for 30 seconds, and 1 cycle at 72 ° C for 7 minutes. PCR products are analyzed on a 2% agarose gel with 6 μl amplification applied to the wells. Electrophoresis is carried out for 30 minutes at a voltage of 300 V.
Пример 3. Определение продуктов диагностической ПЦР.Example 3. The definition of diagnostic PCR products.
Продукты ПЦР анализируют методом электрофореза в 2% агарозном геле в стандартном трис-боратном или трис-ацетатном буфере (рН 8,0).PCR products are analyzed by electrophoresis in a 2% agarose gel in standard Tris-borate or Tris-acetate buffer (pH 8.0).
5 мкл амплификата смешивают с 1 мкл буфера для нанесения проб на гель, а в случае использования набора GenPack PCR Universal 6 мкл амплификата вносят в лунку агарозного геля. Электрофорез проводят при напряжении 10 В/см длины геля до тех пор, пока краситель не пройдет от старта не менее половины геля (не менее 30 минут). Результаты элекрофореза учитывают, просматривая гель в ультрафиолетовом свете с длиной волны 254 нм на приборе Трансиллюминатор. Используют маркеры молекулярного веса pBluescript/Msp I и pUC19/KzoI. Результат ПЦР считают положительным, если продукт ПЦР соответствует размеру 413 п.н. При этом в отрицательном контроле (реакционная смесь, не содержащая ДНК матрицу) продукты амплификации отсутствуют.5 μl of the amplify is mixed with 1 μl of gel sample buffer, and if using a GenPack PCR Universal kit, 6 μl of the amplification is added to the agarose gel well. Electrophoresis is carried out at a voltage of 10 V / cm of the gel length until the dye passes from the start of at least half of the gel (at least 30 minutes). Electrophoresis results are taken into account when viewing the gel in ultraviolet light with a wavelength of 254 nm on a Transilluminator instrument. The molecular weight markers pBluescript / Msp I and pUC19 / KzoI are used. The PCR result is considered positive if the PCR product corresponds to a size of 413 bp Moreover, in the negative control (reaction mixture that does not contain a DNA matrix), amplification products are absent.
Таким образом, указанный способ позволяет выявлять ДНК M.paratuberculosis в исследуемом материале.Thus, this method allows the detection of M. paratuberculosis DNA in the test material.
Пример 4. Определение специфичности ПЦР. Результаты испытаний на специфичность ПЦР для выявления ДНК M.paratuberculosis. Во избежание ложноположительных результатов, в связи с возможным присутствием в исследуемых образцах возбудителей других инфекций была проанализирована комплементарность праймеров к геномным последовательностям следующих микроорганизмов: Citrobacter frendii, Escherichia coli, Staphylococcus albus. Кроме того, была выяснена возможность неспецифического связывания праймеров с участками гена следующих видов микобактерий: M.avium str. 104, М. intracellulare, M. tuberculosis Нз7Ку, М. bovis str. 14 (СибНИВИ), M. smegmatis (ВГНКИ), М. fortuitum (ВГНКИ), М. terrae (полевой изолят).Example 4. Determination of the specificity of PCR. PCR specificity test results for the detection of M. paratuberculosis DNA. In order to avoid false positive results, in connection with the possible presence of other infections pathogens in the studied samples, the complementarity of primers to the genomic sequences of the following microorganisms was analyzed: Citrobacter frendii, Escherichia coli, Staphylococcus albus. In addition, the possibility of nonspecific binding of primers to gene regions of the following types of mycobacteria was clarified: M.avium str. 104, M. intracellulare, M. tuberculosis Hz7Ku, M. bovis str. 14 (SibNIVI), M. smegmatis (VGNKI), M. fortuitum (VGNKI), M. terrae (field isolate).
Таким образом, олигонуклеотидные праймеры, позволяющие выявлять ДНК возбудителя паратуберкулеза, не дают перекрестных реакций с родственными видами, позволяют, ограничиваясь одноступенчатой процедурой проведения реакции, быстро и надежно определять наличие ДНК M.paratuberculosis - возбудителя паратуберкулеза, а способ выявления ДНК M.paratuberculosis высокочувствителен и прост в исполнении.Thus, oligonucleotide primers that allow the detection of DNA of the pathogen of paratuberculosis do not cross-react with related species, allowing, confining themselves to a single-step reaction procedure, quickly and reliably determine the presence of DNA of M. paratuberculosis, the causative agent of paratuberculosis, and the method for detecting DNA of M. paratuberculosis is highly sensitive and simple to execute.
Использование заявленного способа позволит повысить скорость проведения и надежность диагностики паратуберкулеза за счет использования специфической амплификации свойственного для M.paratuberculosis участка IS900.Using the claimed method will increase the speed and reliability of the diagnosis of paratuberculosis through the use of specific amplification characteristic of M. paratuberculosis plot IS900.
Claims (3)
(SEQ ID NO:5) gaagggtgttcggggccgtcgcttagg и (SEQ ID NO:6) ggcgttgaggtcgatcgcccacgtgac, в случае положительной реакции синтезируется фрагмент, соответствующий размеру 413 п.н.2. A method for detecting DNA of Mycobacterium paratuberculosis - the causative agent of paratuberculosis using oligonucleotide primers by the method of polymerase chain reaction (PCR), including DNA extraction, DNA amplification by oligonucleotide primers, transferring the amplification product to a gel, followed by detection of the results of the analysis for transillumin primers have nucleotide sequences:
(SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac, in the case of a positive reaction, a fragment corresponding to the size of 413 bp is synthesized.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2010123200/10A RU2435852C1 (en) | 2010-06-07 | 2010-06-07 | OLIGONUCLEOTIDE PRIMERS AND METHOD OF DETECTING DNA OF Mycobacterium paratuberculosis THAT IS PARATUBERCULOSIS AGENT BY METHOD OF POLYMERASE CHAIN REACTION (PCR) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2010123200/10A RU2435852C1 (en) | 2010-06-07 | 2010-06-07 | OLIGONUCLEOTIDE PRIMERS AND METHOD OF DETECTING DNA OF Mycobacterium paratuberculosis THAT IS PARATUBERCULOSIS AGENT BY METHOD OF POLYMERASE CHAIN REACTION (PCR) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2435852C1 true RU2435852C1 (en) | 2011-12-10 |
Family
ID=45405569
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2010123200/10A RU2435852C1 (en) | 2010-06-07 | 2010-06-07 | OLIGONUCLEOTIDE PRIMERS AND METHOD OF DETECTING DNA OF Mycobacterium paratuberculosis THAT IS PARATUBERCULOSIS AGENT BY METHOD OF POLYMERASE CHAIN REACTION (PCR) |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2435852C1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2740808C1 (en) * | 2019-08-06 | 2021-01-21 | Федеральное бюджетное учреждение науки "Санкт-Петербургский научно-исследовательский институт эпидемиологии и микробиологии им. Пастера Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека" (ФБУН НИИ эпидемиологии и микробиологии имени Пастера) | System of oligonucleotide primers and probe for detecting dna mycoplasma bovis |
-
2010
- 2010-06-07 RU RU2010123200/10A patent/RU2435852C1/en not_active IP Right Cessation
Non-Patent Citations (1)
| Title |
|---|
| Mobius Р. ЕТ AL. Comparison of 13 singleround and nested PCR assays targeting IS900, ISMav 2, fa57 and locus 255 for detection of Mycobacterium avium subsp.paratuberculosis. Vet. Microbiol, 2008, v.126, no.4, p.324-333. Bull T.J. ET AL. Detection and verification of Mycobacterium avium subsp.paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn's disease, J Clin Microbiol. 2003, v.41, no.7, p.2915-2923. BENAZZI S. ET AL. Paratuberculosis in sheep flocks in Morocco: a serological, microscopical and cultural survey, Zentralbl Veterinarmed В., 1996, v.43, no.4, p.213-219. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2740808C1 (en) * | 2019-08-06 | 2021-01-21 | Федеральное бюджетное учреждение науки "Санкт-Петербургский научно-исследовательский институт эпидемиологии и микробиологии им. Пастера Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека" (ФБУН НИИ эпидемиологии и микробиологии имени Пастера) | System of oligonucleotide primers and probe for detecting dna mycoplasma bovis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3320110B1 (en) | 16s ribosomal rna universal primers and use thereof in microbiological analysis and diagnostics | |
| Cai et al. | Development of a real-time PCR for detection of Mycoplasma bovis in bovine milk and lung samples | |
| Schonenbrucher et al. | New triplex real-time PCR assay for detection of Mycobacterium avium subsp. paratuberculosis in bovine feces | |
| Vasylyeva | Identification of Bordetella bronchiseptica bacteria with the help of polymerase chain reaction in monoand multyplex format | |
| Fearnley et al. | The development of a real-time PCR to detect pathogenic Leptospira species in kidney tissue | |
| US20200181690A1 (en) | Primer and probe for detection of mycobacterium avium and method for detection of mycobacterium avium by using the primer or probe | |
| Salgado et al. | A novel low-cost method for Mycobacterium avium subsp. paratuberculosis DNA extraction from an automated broth culture system for real-time PCR analysis | |
| Bölske et al. | Diagnosis of paratuberculosis by PCR. | |
| Spence et al. | Cross-reaction of a Campylobacter fetus subspecies venerealis real-time PCR | |
| Gupta et al. | Single-step PCR for detection of Brucella melitensis from tissue and blood of goats | |
| RU2435852C1 (en) | OLIGONUCLEOTIDE PRIMERS AND METHOD OF DETECTING DNA OF Mycobacterium paratuberculosis THAT IS PARATUBERCULOSIS AGENT BY METHOD OF POLYMERASE CHAIN REACTION (PCR) | |
| JP4899009B2 (en) | Clostridium difficile toxin B gene detection method using LAMP method and primer set used in this method | |
| Brey et al. | Design and development of an internal control plasmid for the detection of Mycobacterium avium subsp. paratuberculosis using real-time PCR | |
| KR20200048082A (en) | Kit for diagnosing infection due to orientia tsutsugamushi | |
| Mohammed et al. | Review on polymerase chain reaction and its diagnostic merit over conventional techniques in animal disease | |
| RU2732923C1 (en) | Method and kit for detecting campylobacter bacteria in patients with inflammatory intestinal diseases | |
| RU2732448C9 (en) | Method for identification of vibrio-cholerae o1 strains, determination of their toxigenicity and biovar with differentiation of el tor biovar on typical and genetically changed versions by multiplex polymerase chain reaction and test system for implementation thereof taking into account results in real time mode | |
| RU2755690C1 (en) | METHOD FOR DETECTING METHICILLIN RESISTANCE GENES mecA AND mecC IN STAPHYLOCOCCI | |
| RU2795987C1 (en) | Set of oligonucleotide primers and fluorescently labeled probes and a method for detecting brucellosis pathogen dna | |
| CN110656190B (en) | Multiple PCR detection kit for common bacterial disease pathogens of cattle | |
| RU2525059C2 (en) | Kit for detecting q fever agent in biological material by real time polymerase chain reaction (rt pcr) | |
| Sharma et al. | Polymerase chain reaction (PCR) amplification of IS6110 sequences to detect Mycobacterium tuberculosis complex from formalin-fixed paraffin-embedded tissues of deer (Axis axis) | |
| Best et al. | Specific detection of Campylobacter jejuni from faeces using single nucleotide polymorphisms | |
| Van Nguyen et al. | Development and clinical validation of a DNA gyrase subunit B gene based loop-mediated isothermal amplification method for detection of Melissococcus plutonius | |
| CN108753999B (en) | Nucleic acid, kit and detection method for detecting salmonella paratyphi of pigeon |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20130608 |