RU2740808C1 - System of oligonucleotide primers and probe for detecting dna mycoplasma bovis - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention relates to the field of biotechnology. Disclosed is a system of primers and a probe, which enables specific detection of Mycoplasma bovis DNA by PCR in real time in DNA preparation extracted from biological material from cattle or raw material of animal origin for biological industry and products obtained from it. System includes the following components: a pair of oligonucleotide primers, complementary to a species-specific region in the Mycoplasma bovis sugar kinase gene and having forward and reverse primer activity and having a structure M.bov1 F 5'-GAACTAAGATTGGCGTCAAGACA-3', M.bov1 R 5'-GTTGCTGCAAGCGACACTAA-3', and a fluorescent labeled hydrolysis probe for identifying Mycoplasma bovis DNA during a real-time PCR reaction, complementary to a species-specific portion of the Mycoplasma bovis sugar kinase gene, located in sequence flanked by said primers and having structure M.bov1 Pr 5'-FAM CAGGTCATTATAGTCAATAGATTCAGTA BHQ1-3'.EFFECT: disclosed system of oligonucleotide primers and probes enables determining the presence of Mycoplasma bovis DNA in the analyzed material and differentiating Mycoplasma bovis from phylogenetically related Mycoplasma bovigenitalium mycoplasmas.1 cl, 2 dwg, 2 ex

Description

The invention relates to the field of microbiology, biotechnology and veterinary medicine, and can be used to diagnose animal diseases of viral, bacterial and other etiology, as well as to identify the carriage of Mycoplasma bovis in cattle, quality control of raw materials for the biotechnological industry and materials for research work.

A system has been constructed, which includes a pair of oligonucleotide primers complementary to the species-specific region in the Mycoplasma bovis sugar kinase gene, and possessing forward and reverse primer activity and having the structure

M.bov1 F 5'-GAACTAAGATTGGCGTCAAGACA-3 '

M.bov1 R 5'-GTTGCTGCAAGCGACACTAA-3 '

and a fluorescently labeled hydrolysis probe for identification of Mycoplasma bovis DNA during the real-time PCR reaction, complementary to the species-specific region in the Mycoplasma bovis sugar kinase gene, located in the sequence flanked by the above primers and having the structure

M.bov1 Pr 5'-FAM CAGGTCATTATAGTCAATAGATTCAGTA BHQ1-3 '

The use of the developed system of primers and a probe makes it possible to identify M. bovis, differentiate it from phylogenetically closely related M. bovigenitalium mycoplasmas, and detect in a short time with high sensitivity and specificity of the DNA of this mycoplasmosis pathogen in biological material from cattle and raw materials for the biotechnological industry and materials for laboratory research work.

The invention can be used in veterinary medicine to identify the genetic material of one of the causative agents of mycoplasmosis in cattle - M. bovis, in order to diagnose associated infectious diseases, to identify asymptomatic carriage and scientific research.

The invention can be used in biotechnology to control the contamination of raw materials of animal origin with M. bovis mycoplasmas, as well as to detect M. bovis in sera, which are reagents for laboratory research associated with work with cell cultures.

S., 2015). Заболевания, связанные с данным патогеном, распространены во всем мире. При этом распространенность носительства, при котором колонизация организма М. bovis протекает бессимптомно, может быть значительной, например до 6% телят на животноводческих предприятиях, благополучных по бронхопневмониям молодняка могут быть носителями М. bovis (Kirkbride С.А., 1987). Данный патоген приводит к развитию маститов, бронхопневмоний, артритов и заболеваний репродуктивной системы. Часто отмечается сочетанное поражение различных органов и систем органов. Заболевания, вызываемые М. bovis тяжело поддаются лечению из-за чего часто приводят к выбраковке животных (Maunsell F.P., 2011).M. bovis is the causative agent of various diseases of adult cattle and calves (

S., 2015). Diseases associated with this pathogen are common throughout the world. At the same time, the prevalence of carriage, in which the colonization of the organism of M. bovis is asymptomatic, can be significant, for example, up to 6% of calves at livestock enterprises that are free from bronchopneumonia in young animals can be carriers of M. bovis (Kirkbride SA, 1987). This pathogen leads to the development of mastitis, bronchopneumonia, arthritis and diseases of the reproductive system. Combined damage to various organs and organ systems is often noted. Diseases caused by M. bovis are difficult to treat and often lead to culling of animals (Maunsell FP, 2011).

Also M. bovis can act as a contaminant of raw materials of biological origin for biotechnological production, which can lead to defective products of the industry.

For the cultivation of M. bovis, specialized multicomponent media are needed, while its phenotypic differentiation from closely related mycoplasmas of the M. bovigenitalium species, which cause diseases with a milder course, is difficult.

Real-time polymerase chain reaction is a sensitive and specific method for detecting M. bovis DNA (Parker A.M., 2017). This method is based on the process of specific amplification (accumulation) of DNA fragments by means of template replication, carried out with the participation of the DNA polymerase enzyme. In this case, the amplification process is evaluated during the reaction (in real time). In this case, the evaluation is carried out by measuring the accumulation of fluorescence emitted by fluorochromes associated with the probe in the system. A prerequisite for the emission of fluorescence by these fluorochromes is the destruction of the probe, which occurs when it binds to the complementary sequence in the presence of the DNA polymerase enzyme. In this case, the activity of the cleavage of probes and the release of fluorochromes is directly dependent on the content of the target amplicons in the reaction mixture.

Primers are components of the reaction mixture that provide the specificity of the nucleic acid doubling reaction. They are short oligonucleotide sequences obtained by chemical synthesis. Structurally, the primers are complementary to highly conserved and highly specific sequences in the target DNA. In the case of the diagnosis of infectious diseases, the target DNA is the DNA of the pathogen, the identification of which the diagnostic system is aimed at. Probes are components of the reaction mixture that provide specific detection of the target product. They are complementary to a region of the target amplicon sequence and do not interact with other DNA sequences in the test material.

The specificity of the real-time PCR reaction is an important characteristic that determines the quality of the study. The most important for ensuring the specificity of amplification is the selection of a fragment for the selection of primers and probe, as well as the nucleotide composition of these short synthetic oligonucleotides.

The closest analogs of the developed system of primers and probes are specific systems of oligonucleotide primers and probes flanking a fragment of the gene for the elongation factor Jus A (Boonyayatra S., 2012) and a fragment of the gene for the protein involved in DNA repair uvrC (Righter DJ, 2011, Gioia G., 2016). The authors used the designed systems of primers and probes in real-time PCR to identify M. bovis. The use of these primers made it possible to differentiate M. bovis from both M. bovigenitalium and other mycoplasmas. A distinctive feature of the proposed system of primers and probes for detecting Mycoplasma bovis DNA is the choice of the specified type of sugar kinase gene fragment as a species-specific target in the mycoplasma genome.

It is an object of the present invention to provide an oligonucleotide primer and probe system for identifying M. bovis by real-time polymerase chain reaction.

The goal is achieved by constructing a system of specific primers and a probe for identifying DNA of one of the pathogens of cattle mycoplasmosis M. bovis, having the following structure:

M.bov1 F 5'-GAACTAAGATTGGCGTCAAGACA-3 '

M.bov1 R 5'-GTTGCTGCAAGCGACACTAA-3 '

M.bov1 Pr 5'-FAM CAGGTCATTATAGTCAATAGATTCAGTA BHQ1-3 '

Characterization of oligonucleotide primers and a region of amplified DNA.

Based on the data presented in the GenBank NCBI (National Center for Biotechnology Information), primers were selected, designated M.bov1 F and M.bov1 R, complementary to the M. bovis saccharinase gene fragment and possessing forward and reverse primer activity. An oligonucleotide probe M.bov1 complementary to the region of the M. bovis genome sequence located between the regions recognized by the primers M.bov1 F and M.bov1 R.

As a positive control, experiments were carried out on clinical material from cattle obtained during the examination of animals at livestock enterprises, where cases of bronchopneumonia of calves and mastitis with symptoms characteristic of infections associated with M. bovis were detected, using nasal swabs to isolate DNA. cavities of young cattle and the vestibule of the sheath of cows.

Examples of specific implementation.

Example 1. Procedure for the design of oligonucleotide primers and a probe for the identification of DNA of the causative agent of mycoplasmosis in cattle M. bovis by real-time PCR

Based on the study of the sequenced whole genome sequences of the causative agent of mycoplasmosis in cattle M. bovis, presented in the international Genbank database for the design of primers, the sequence of the M. bovis sugar kinase gene was selected. The size of this gene is 899 bp. (GenBank NCBI, CP038861.1). As part of the specified gene, specific DNA regions were selected that have nucleotide differences from the phylogenetically closely related species M. bovigenitalium and other microorganisms. The estimated length of the DNA fragment flanked by the proposed primers was 113 bp. For this fragment, a specific for M. bovis probe sequence was selected.

In order to determine the specificity of the selected system of primers and probes, the homology of the region recognized by it was assessed in silico with similar sequences in the genomes of other organisms by comparing this region with genetic sequences presented in the GenBank database using the BLASTN algorithm on the web server of the National Center for Biotechnological Information (NCBI)

(http://www.ncbi.nlm.mh.gov/BLAST/). At the time of the in silico analysis, no homology was found.

The molecules of fluorescein (FAM) and BHQ-1 were selected as components of the oligonucleotide probe. In this case, photons emitted by fluorescein upon excitation have a wavelength of about 518 nm, and BHQ-1 has a high ability to absorb photons with wavelengths of this range.

Example 2. Amplification of specific DNA fragments of the causative agent of mycoplasmosis in cattle M. bovis with detection of the accumulation of a specific DNA fragment by real-time PCR.

Using the developed system of primers and probes, reaction mixtures were prepared that included 10 pmol of each of the components of the system to identify the pathogen of mycoplasmosis in cattle M. bovis and other components required for real-time PCR.

The total volume of the reaction mixture is 25 μl per sample. To prepare it, the following components were mixed in a test tube:

Ready mixture for PCR brand qPCRmix-HS (OOO "Evrogen", Moscow) - 5 μl

Primer M.bov1 F (10 pM / μl) - 1 μl

Primer M.bov1 R (10 pM / μl) - 1 μl

M.bov1 Pr probe (10 pM / μl) - 1 μl

deionized water - 15 μl

investigated DNA sample - 2 μl.

The reaction conditions for the CFX96 amplifier (Bio-Rad, USA): the stage of preliminary DNA denaturation at 94 ° C - 5 min, then within 50 cycles - DNA denaturation at 94 ° C - 15 sec; annealing of primers at 60 ° С - 30 sec; chain elongation at 70 ° C - 30 sec. The assessment of the level of fluorescence in the sample was carried out at the end of each cycle. In the presence of M. bovis DNA in the sample, an increase in fluorescence was noted during the course of the reaction (Fig. 1).

Example 3. Determination of the specificity of the amplification reaction using the developed oligonucleotide primers and a probe for identifying DNA of the causative agent of mycoplasmosis in cattle M. bovis.

The specificity of the reaction was determined by staging a reaction with clinical samples containing DNA from closely related pathogens of cattle M. bovigenitalium and Ureaplasma diversum, as well as samples of DNA isolated from cultures of closely related human pathogens M. hominis, U. parvum and U. urealyticum.

Isolation of DNA from clinical samples was carried out by sorption on silicon particles; DNA from cultures of microorganisms was isolated by thermal destruction. The PCR reaction was carried out as described in example 2. When the PCR was performed with the material containing the DNA of closely related microorganisms, the accumulation of the product was not observed (Fig. 2).

Thus, the developed system of primers and probe, which differs from analogs in that the species-specific sequence of the sugar kinase gene is used as a target, can be used to identify M. bovis, allows it to be differentiated from the closely related species M. bovigenitalium and detect it in a short time with high sensitivity and specificity of the DNA of this causative agent of mycoplasmosis in cattle in biological material from animals, as well as in biological raw materials of animal origin and products based on it.

Claims (4)

A system of oligonucleotide primers and probes for the identification of Mycoplasma bovis in biological material from cattle, raw materials for the biological industry and materials for research work by the real-time polymerase chain reaction, characterized in that it contains primers and probes complementary to the sugar gene fragment -kinase M. bovis having the following structure: M.bov1 F 5'-GAACTAAGATTGGCGTCAAGACA-3 '; M.bov1 R 5-GTTGCTGCAAGCGACACTAA-3 '; M.bov1 Pr 5'-FAMCAGGTCATTATAGTCAATAGATTCAGTABHQ1-3 '.

Images