RU2732448C9 - Method for identification of vibrio-cholerae o1 strains, determination of their toxigenicity and biovar with differentiation of el tor biovar on typical and genetically changed versions by multiplex polymerase chain reaction and test system for implementation thereof taking into account results in real time mode - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology. Invention represents a method for identification of Vibrio cholerae O1 strains, determination of their toxigenicity and biovar with differentiation of the biologist El Tor into typical and genetically modified versions by the method of multiplex polymerase chain reaction (PCR) in real time mode, including: recovering DNA from the analysed Vibrio cholerae O1 culture; components for PCR: 10x buffer for TaqPol, MgCL₂ (50 mM), a mixture of dNTPs (5 mM), TaqPol (5 units/mql), deionised sterile water, a mixture of primers 1 - (F+R) ctxB primers (10 mM), probe G-FAM (10 mM) and A-VIC probe (10 mM), mixture of primers 2 - (F + R) rtxC primers (10 mcM), ROX probe on rtxC gene (10 mM), two positive (PKO + Classical and PKO + E1 Tor) and one negative (H₂O) control; carrying out polymerase chain reaction in one step in two reaction mixtures of different composition in volume of 25 mcl in real time mode: 1 cycle 95 °C - 3 min, 40 cycles 95 °C - 20 s, 57 °C - 30 s (fluorescence measurement), 72 °C - 20 s; recording results on specific curve bands in Green channels (ctxB^CL gene), Yellow (ctxB^EL gene), Orange (rtxC gene) at level of threshold line on these accounting channels is 0.05; Ct ≤ 30.

EFFECT: method using a kit enables to quickly and reliably identify cholera vibrios of a classical biovar or El Tor biovar and differentiate the detected toxic strains of V_ cholerae biovar El Tor into typical and altered versions.

2 cl, 2 tbl, 18 dwg

Description

The invention relates to the field of medical microbiology, in particular to the identification of toxigenic strains of Vibrio cholerae O1, the definition of their biovar (classical or El Tor) and the differentiation of V. cholerae O1 biovar El Tor into typical isolates and modified variants, and is intended for the identification of cholera vibrios O1 serological groups isolated from a person or from environmental objects at the genome level using a polymerase chain reaction in "real time" in specialized laboratories of medical and preventive and sanitary-epidemiological institutions in the Russian Federation.

Scope - clinical laboratory diagnostics, scientific research, epidemiological surveillance.

Typical toxigenic vibrios El Tor (Vibrio cholerae O1 biotype El Tor, Hly-, ctxA +), resistant to adverse environmental factors due to the presence in the genome of additional gene blocks that provide a high level of adaptation to changing environmental conditions: pathogenicity islands (VPI -I, II) and pandemicity (VSP-I, II) [1, 2, 3], were the etiological factor of cholera in Asia (1961-1969), in (Asia, Africa, Europe, USA, Oceania (1970- 1980), Asia, Africa, Europe, USA, Oceania, Australia (1981-1990).

In the early 90s of the last century, strains of Vibrio cholerae O1 of the serological group appeared with typical phenotypic features of the El-Tor biovar, but producing the classic type of enterotoxin (CT1) and with phenotypic features of the El-Tor and classical biovars, also with the production of the classic type of enterotoxin ( ST-1). V. cholerae O1 isolates with genotypic traits of both biovars were called “genetically altered” (genovariants) or “hybrid variants of the El-Tor biovar” [4, 5], and they are the dominant etiological agents of the current stage of development of the seventh El Tor cholera pandemic. which began in the 90s of the XX century, and in the first two decades of the XXI century - gained global distribution.

Evolutionary transformations of a typical toxigenic biovar El Tor into a hybrid variant were accompanied by changes in the structure of the genes of the core region of the CTX _ϕ prophage and the RSI _ϕ prophage [6]. As a result of horizontal gene transfer genotypes formed with different combinations of genes typical pathogenic El Tor and classical biovar: ctxB ^{Cl, rstR El, rstC, rstR Cl} (III genotype); ctxB ^Cl rstR ^El , rstC (IV genotype); ctxB ^Cl , rstR ^El , rstC (V genotype); ctxB ^Cl , rstR ^Cl , rstR ^El (VI genotype); ctxB ^Cl , rstR ^Cl , rtxC (genotype VII) It should be noted that the genomes of the named variants of the El-Tor biovar necessarily contain the ctxB ^Cl gene encoding the biosynthesis of the classical type of enterotoxin (CT-1) [8.]. At the same time, evolutionary transformations into a hybrid variant did not affect the genes of the “housekeeping”, in particular, the rtxC gene, which is specific for the typical toxigenic biovar El Tor. In this case, in the polymerase chain reaction reaction, typical toxigenic strains of the El Tor biovar form amplicons to the ctxB ^El and rtxC genes, and genetically modified variants of the El Tor biovar form amplicons to the ctxB ^CL and rtxC genes.

Cholera caused by genetically modified Vibrio cholerae biovar El Tor, producing XT of the classical type, causes significant harm to the health of the population and economic damage to the country where this infection occurs [1, 3, 6, 7]. Therefore, in order to improve the efficiency of the cholera epidemiological surveillance system and to carry out anti-epidemic measures in the event of its import, it is necessary to develop a method for a quick and reliable diagnosis of the etiological factor of the disease, based on the differentiation of typical toxigenic and genetically modified variants of V. cholerae biovar El Tor using the polymerase chain reaction.

It is known to identify altered toxigenic strains of V. cholerae biovar El Tor by PCR using allele-specific primers to detect the classic or El Tor biovar of the ctxB gene [9]. However, this method is applicable only for strains of Vibrio cholerae with a pre-established serogroup and biovar.

At the same time, monitoring studies require not only identification of toxigenic strains of V. cholerae O1 serogroup and determination of their biovar, but also timely and rapid differentiation of V. cholerae biovar El Tor by the structure of the ctxB gene in order to identify altered variants of the causative agent of cholera El Tor to increase the effectiveness of anti-epidemic measures.

From sources of scientific and technical information, a method is known for identifying toxigenic V. cholerae Ol strains, determining their biovar and differentiating El Tor biovar strains into typical and modified by multiplex polymerase chain reaction and a test system for its implementation with electrophoretic accounting of the results [10]. According to the invention, multiplex polymerase chain reaction (PCR) is carried out in one step in two reaction mixtures, where each of the mixtures contains a specially selected combination of primers: one for the rfbO1, cas3 and ctxB ^CL genes, the second for the rfbO1, rtxC and ctxB ^EL genes. The test system for carrying out the method includes components for DNA extraction, components for PCR and components for analyzing the results. Components for PCR contain: 10-fold buffer solution, pH 8.4, mineral oil, deionized sterile water, two positive controls, Taq-polymerase enzyme, dNTP mixture, primer mixture 1 - rfbO1-F - rfbO1-R, cas3- F - cas3-R, ctxB ^CL -F-ctxB ^CL -R and primer mixture 2 - rfbO1-F - rfbO1-R, rtxC-F - rtxC-R, ctxB ^EL -F -ctxB ^EL -R.

The claimed method makes it possible to quickly and reliably identify biovars of serogroup O1 cholera vibrios, determine their toxigenicity and differentiate the identified toxigenic strains of V. cholerae biovar El Tor into typical isolates and modified variants.

To implement the method for identifying toxigenic strains of Vibrio cholerae O1, determining their biovar and differentiating the El Tor biovar into typical and genetically modified variants by the method of multiplex polymerase chain reaction, a test system with a phoresis method for accounting for results "Vibrio cholerae gene variant ctxB-REF)" [7 ]. With the help of the specified "Set ..." when identifying the isolated culture of Vibrio cholerae, the O1 serogroup (by the rfbO1 gene, 638 bp), biovar (classic by the cas3 gene, 415 bp; El Tor by the rtxC gene, 265 bp) are determined. bp), toxigenicity (for genes ctxB ^Cl , 189 bp or ctxB ^El , 189 bp), typicality (typical biovar El Tor - for a combination of genes rfbO1.638 bp + rtxC, 265 bp) n + ctxB ^El , 189 bp); modified biovar El Tor - ctxB ^Cl , 189 bp + rfbO1, 638 bp + rtxC, 265 bp).

Thus, this multilocus PCR, used to identify the isolated culture of the cholera pathogen, provides the determination of serogroup, toxigenicity, biovar and differentiation of the El Tor biovar into typical toxigenic and genetically modified (hybrid) variants by the electrophoretic method of recording the results, which lengthens the time of this method for identifying Vibrio strains cholerae O1.

At the same time, in this area there is an obvious need for the development of a more informative and fast method for identifying toxigenic strains of Vibrio cholerae O1, determining their biovar and differentiating El Tor biovar into typical and genetically modified variants, as well as test systems for implementing this method for identifying toxigenic strains of Vibrio cholerae O1 serogroup.

The technical result of the invention is to provide the possibility of simultaneous identification of V. cholereae O1 serogroup strains of classical and El Tor biovars (based on the presence in their genome of biovar-specific genes ctxB ^CL , ctxB ^EL and rtxC gene specific for biovar El Tor), determination of their toxigenicity (on based on testing the ctxB gene) and differentiation of V. cholerae biovar El Tor into typical isolates and altered variants based on the simultaneous presence of the ctxB ^EL + rtxC or ctxB ^CL + rtxC genes in their genome.

The technical result is achieved by the method of identification and differentiation of typical and modified toxigenic strains of V. cholerae O1 by the method of multiplex polymerase chain reaction, characterized by the fact that PCR is carried out in one step in two reaction mixtures, each of which contains a specially selected mixture of primers SEQ ID NO: 1 to genes ctxB ^CL and ctxB ^EL with probes G-FAM and A-VIC, respectively, in the first, and primers SEQ ID NO: 2 F + R to the rtxC gene with a probe ROX in the second, with primer annealing temperature of 57 ° C for 30 with the number of amplification cycles equal to 40, followed by analysis by comparing amplified gene fragments of the studied and control strains. The classical biovar V. cholerae strains are characterized by the presence of the ctxB ^CL gene amplicon, identical to the control sample. Typical toxigenic V. cholerae O1 strains of the El Tor biovar are characterized by the presence of amplicons of the ctxB ^EL and rtxC genes identical to the control sample, while the modified V. cholereae O1 variants of the El Tor biovar are characterized by the presence of amplicons of the ctxB ^CL and rtxC genes identical to the control sample.

DNA of typical toxigenic strains of V. cholerae classical and El Tor biovars is used as a control.

The technical result is also achieved by a test system for identification and differentiation of typical and modified toxigenic strains of V. cholerae O1 biovar El Tor by the method of multiplex polymerase chain reaction, including components for DNA isolation and components for PCR in Real Time mode: 10x buffer for TaqPol, MgCL ₂ (50 mM), deionized sterile water, two positive controls (PCO + El Tor and PCO + Classical), TaqPol enzyme (5 U / μL), dNTPs mixture (5 mM), mix 1 containing primers SEQ ID NO: l to F + R ctxB ^CL (10 mM) and F + R ctxB ^EL (10 mM), probes G -FAM (10 mM), A-VIC (10 mM) and mixture 2 containing primers SEQ ID NO: 2, k the rtxC gene (10 mM) and the ROX probe (10 mM).

When developing the method, particular importance was attached to the design of a mixture of primers and probes specific to genes of classical and El Tor biovars. The ctxB and rtxC genes were selected as targets. Our development of a set of probes, which turned out to be highly specific, allowed us to design a test system for real-time PCR.

In this case, the accumulation of an amplification product with a probe specific for the corresponding allele (ctxB ^CL or ctxB ^EL ) of the ctxB gene indicates the presence of a classical or El Tor biovar in the DNA sample of the ctxB gene. The accumulation of the amplification product with two probes simultaneously (in two channels) indicates the presence of two genes in the DNA sample at the same time. The accumulation of the amplification product with the ROX probe specific for the rtxC gene in the Orange channel indicates the presence of the rtxC gene in the DNA sample.

The optimal composition of the reaction mixture for carrying out the multiplex chain reaction in "real time" was experimentally established, the combination of primers and probes, the necessary and sufficient ratio of the components of the reaction mixture were selected, and the PCR mode was determined, which is important for the PCR analysis.

The claimed PCR test system "Vibrio cholerae genes O1 variant ctxB - rtxC, FL" is divided into 3 sets:

Kit 1 contains components for DNA extraction, packed in six plastic vials containing solution 1 (6 M guanidine thiocyanate solution), solution 2 (4 M guanidine thiocyanate solution), solution 3 (alcohol-saline solution), acetone, DNA eluent (TE buffer) , 2 plastic test tubes with nucleosorbent;

Kit 2 consists of components for PCR with a 1: 1 mixture.Plastic tube containing F + R ctxB primers (10 mM), G-FAM probe (10 mM), A-VIC probe (10 μM), 10x TaqPol buffer, MgCL ₂ (50 mM), mixture of dNTPs (5 mM), TaqPol (5 U / μl), H ₂ O or RNA eluent; 1 plastic test tube containing a control positive sample with DNA of a typical toxigenic V. cholerae O1 strain of a classic biovar, and 1 plastic test tube containing a control positive sample with DNA of a typical toxigenic V. cholerae O1 strain of biovar El Tor;

Kit 3 consists of components for PCR with mixture # 2: 1 plastic tube containing F + R rtxC primers (10 μM), rtxC probe (10 μM), 10x buffer for TaqPol, MgCL ₂ (50 mM), dNTPs mixture (5 mM), TaqPol (5 U / μL), H ₂ O or RNA eluent; 1 plastic tube containing a control positive sample with DNA of a typical toxigenic V. cholerae O1 strain of a classic biovar, and 1 plastic tube containing a control positive sample with DNA of a typical toxigenic strain V. cholerae O1 biovar El Tor;

PCR test system "Vibrio cholerae genes O1 variant ctxB - rtxC, FL" is designed for 50 determinations, including control samples.

The claimed identification method includes the following steps.

a) Isolation of DNA using reagents for DNA extraction "AmpliPrime DNA-Sorb-AM" (set 1).

b) Real-time PCR: (set 2, 3). The polymerase chain reaction of two reaction mixtures of different composition with hybridization-fluorescence detection in "real time" is carried out in a volume of 25 μl. in one step according to the following program:

preliminary denaturation 1 cycle 95 ° С - 3 min, 40 cycles 95 ° С -20 sec, 57 ° С - 30 sec (fluorescence measurement), prolongation 72 ° С - 20 sec.

c) Analysis and interpretation of results:

The method is carried out as follows.

1. Sample preparation is carried out according to MU 1.3. 2569-09 "Organization of the work of laboratories using methods of amplification of nucleic acids when working with material containing microorganisms of I-IV pathogenicity groups" in a class II biological safety box in a type IV anti-plague suit with rubber or latex gloves. Vibrio cholerae cells grown on alkaline agar (pH 7.8) for 18 hours are resuspended in 0.85% sodium chloride solution to a concentration of 10 ⁹ microbial cells in 1 ml and then diluted in deionized water to a concentration of 1 × 10 ⁷ m.c. / ml. Then sodium merthiolate is added to the suspension to a final concentration of 1: 10000 (0.01%) and heated at 56 ° C for 30 minutes. Next, 100 μl of the sample is transferred into microcentrifuge tubes with a volume of 1.5 ml, a lysis solution prepared on the basis of 6 M guanidine isothiocyanate is added and incubated for 15 min at 65 ° C. After completing these procedures, the material is considered disinfected.

DNA extraction is carried out using kit 1. - kit 1 (AmpliPrime DNA-sorb-AM DNA extraction reagent kit) includes two plastic vials containing, respectively, solution 1 (6 M guanidine thiocyanate solution), solution 2 (4 M solution guanidine thiocyanate), solution 3 (alcohol-salt solution), acetone, DNA eluent (TE-buffer), 2 plastic tubes with nucleosorbent.

The DNA extraction kit is removed from the refrigerator and kept at room temperature. All kit reagents are added with separate tips using automatic micropipettes. Solution 1 is heated at a temperature of 60-65 ° C until the crystals are completely dissolved, and then added to the disinfected samples in a volume of 300 μl. The samples are thoroughly mixed in a microcentrifuge / shaker and incubated at 65 ° C. The sorbent is carefully resuspended in a microcentrifuge / shaker. In each tube add 25 μl of the prepared sorbent, mix in a microcentrifuge / shaker for 30 s and leave in a rack for 2 minutes.

The procedure is repeated twice. Then the tubes are centrifuged at 12000 g for 30 s, the supernatant is removed. 300 μl of solution 2 is added to the sediment. The contents of the tube are mixed in a microcentrifuge / shaker until homogeneous, centrifuged at 12000 g for 30 s, the supernatant is removed.

Then 500 μl of solution 3 is added to the sediment. The contents of the tube are mixed in a microcentrifuge / shaker until homogeneous and centrifuged at 12000 g for 30 s. The supernatant is removed, washing with solution 3 is repeated. 400 μL of acetone is added to the precipitate. The contents are mixed in a microcentrifuge / shaker, then centrifuged at 12000 g for 30 s, the supernatant is removed. The precipitate is dried at a temperature of 65 ° C for 5-7 minutes. To the sediment, add 50 μl of TE-buffer and incubate at a temperature of 65 ° C for 10 min, shaking in a microcentrifuge / shaker 2-3 times. At the end, the suspension is centrifuged at 12000 g for 1 min. The supernatant contains purified DNA.

2. Conducting PCR in "real time": (set 2, 3). The contents of test tubes of sets 2, 3 are removed from the freezer, the contents of test tubes of sets 2, 3 are prepared, and reaction mixtures are prepared for carrying out PCR: from set 2, prepare the required number of micro tubes (corresponding to the number of tested samples) with mixture 1, and from set 3 prepare the same number of test tubes with mixture 2.

Mix 1 consists of the following components:

10x buffer for TaqPol 2.5 μl MgCL ₂ (50 mM) 2.0 μl F + R ctxB primers (10 mM) 2.5 μl Probe G -FAM (10 mM), Green 1 μl Probe A-VIC (10 mM), `Yellou 1 μl Mixture of dNTPs (5 mM) 4 μl TaqPol (5 units / μl) 1 μl Water up to 25 μl

Controls:

K- (H ₂ O) - negative control 2.0 μl PKO + El Tor: DNA of the V. cholerae El Tor strain 484Ct (10 ng / μL) 2 μl PKO + Classical: DNA of V. cholerae Classical 569B strain (10 ng / μl) 2 μl DNA (10 ng / μl) 2 μl

Mix 2 consists of the following components:

10x buffer for TaqPol 2.5 μl MgCL ₂ (50 μM) 2.0 μl F + R rtxC primers (10 μM) 2.5 μl ROX probe on rtxC (10 μM), Orange 1 μL dNTPs mixture (5 μM) 4 μl TaqPol (5 units / μl) 1 μl Water up to 25 μl Controls: K- (H ₂ O) - negative control 2.0 μl PCO + El Tor: DNA of the V. cholerae El Tor strain 484 St (10 ng / μL) 2 μl PKO + Classical: DNA of V. cholerae Classical 569B strain (10 ng / μl) 2 mk DNA (10 ng / μl) studied 2 μl

Amplification mode: 1 cycle 95 ° С-3 min; 40 cycles 95 ° C - 20 sec; 57 ° С - 30 sec; 72 ° C - 20 sec. The accumulation of the amplification product only with a probe specific to the ctxB ^CL gene (G-FAM) in the Green channel indicates the presence of ctxB ^CL (B1) in the sample. The accumulation of the amplification product only with a probe specific to the ctxB ^EL gene (A-VIC) in the HEX / VIC channel (Yellow) indicates the presence of the ctxB ^EL gene (B3) in the sample. The accumulation of the amplification product with two probes simultaneously (in two channels) indicates the presence of two genes in the DNA sample at the same time. The accumulation of the amplification product only with the ROX probe, specific for the rtxC gene in the Orange channel, indicates the presence of the rtxC gene in the DNA sample.

3. Analysis of the results of DNA amplification of the studied strains of microorganisms with PCR mixture No. 1 - the curves of the accumulation of the fluorescent signal are analyzed in two channels:

- through the channel for fluoroflora G-FAM, a signal is recorded, indicating the accumulation of the amplification product of the DNA fragment of the ctxB ^CL (Bl) gene on the Green channel;

- a signal is recorded via the A-VIC fluoroflora channel, indicating the accumulation of the amplification product of the DNA fragment of the ctxB ^EL (B3) gene on the Yellou channel.

- Analysis of the results of DNA amplification of the studied strains of microorganisms with PCR-mixture No. 2. - a signal is registered via the ROX channel for fluoroflore, indicating the accumulation of the amplification product of the rtxC gene DNA fragment on the Orange channel.

The threshold line level (Threshold) on all metering channels is 0.05. Ct (not ≥25).

Accounting for the results of PNR analysis is carried out by comparing the obtained amplicons with control samples in accordance with the results of amplification according to Table 1.

The invention is illustrated by the following example.

Example 1. To determine the effectiveness of the proposed method and test system, PCR analysis of Vibrio cholerae O1, non 01/139 strains and heterologous microorganisms isolated in different territories and in different years was carried out Table 2.

The protocols of the results of PCR analysis of DNA of V. cholerae O1, nonO1 / O139 strains and heterologous microorganisms are shown in Fig. 1-18,

where in Fig. 1 - Dagestan, 1993, 1994, 1998, B1 +;

in fig. 2 - Dagestan, 1993, 1994, 1998. B3 + control, strain 484;

in fig. 3 - Dagestan, 1993, 1994, 1998, rtxC + in all studied strains;

in fig. 4 - Mariupol (Ukraine), 1994-2011 B1 + in all studied strains;

in fig. 5 - Mariupol (Ukraine), 1994-2011 VZ3t only in the control strain;

in fig. 6 - Mariupol (Ukraine), 1994-2011 rtxC + in all studied strains;

in fig. 7 - Azerbaijan, 1985, Stavropol, 1990, B1 + only in the control strain, 569B;

in fig. 8 - Azerbaijan, 1985, Stavropol, 1990, B3 in all studied strains;

in fig. 9 - Azerbaijan, 1985, Stavropol, 1990 rtxC + in all studied strains;

in fig. 10 - Sochi, 2015, B1 + traps only in the control strain 569B;

in fig. 11 - Sochi, 2015, B3 + traps in the control strain 484 and strain 647;

in fig. 12 - Sochi, 2015, rtxC + traps in all studied strains;

in fig. 13. - Azerbaijan, V. choleraenonO1, B1 + only in the control strain 569B;

in fig. 14 - Azerbaijan, V. choleraenonO1, B3 + only in the control strain 484;

in fig. 15 - Azerbaijan, V. cholera pop O1, rtxC + only in the control strain 484;

in fig. 16 - Heterologous strains: Shigella, Salmonella, Esherichia B1 + only in the control strain 569B;

in fig. 17 - Heterologous strains: Shigella, Salmonella, Esherichia B3 + only in the control strain 484;

in fig. 18 - Heterologous strains: Shigella, Salmonella, Esherichia rtxC gene - do not contain.

The results presented in Table 2 and Figures 1-18 showed that the "Set of reagents for the PCR test system Genes Vibrio cholerae variant ctxB - rtxC, FL)" detects in the genome of toxigenic V. cholera O1 DNA fragments of genes ctxB ^Cl , ctxB ^El , rtxC (has specific activity), and does not detect these genes in nontoxigenic V. cholera O1 and pop O1, as well as in heterologous strains of microorganisms - Shigella zonnei 20, 76; Salmonella typhimurium 160; Salmonella enteritidis 165; Esherichia coli 406-1) (specific).

Thus, the proposed method and multiplex PCR test system "Genes Vibrio cholerae variant ctxB - rtxC, FL)" allow you to quickly and reliably identify cholera vibrios O1 serogroup of the classic or El Tor biovar, determine their toxigenicity and differentiate the identified toxigenic strains of V cholerae biovar El Thor for typical isolates and modified variants.

BIBLIOGRAPHY

1. De Haan L. Cholera toxin: a paradigm for multi-functional engagement of cellular mechanisms. / L. De Haan, T.R. Hirst // Mol. Membr. Biol. - 2004. - Vol. 21, N2. - P. 77-92.

2. Comparative genomicanalysis of Vibrio cholerae: genes that correlate with cholera endemic and handemic disease. / Dziejman M., Balon E., Boyd D. [et al.] // Proc. Natl. Acad. Sci. USA. - 2002. - Vol. 99, No. 3. - P. 1556-1561.

3. The El Tor biotype of Vibrio cholerae exhibits Vibrio cholerae a growth advantage in the stationary phase in mixt cultures with the classical biotype. / S. Pradhan, A.K. Baidya, A. Ghosh [et al.] // J. Bacteriol. - 2010. - Vol. 192, No. 4. - P. 955-963.

4. Development and validation of a mismatch amplification mutation PCA assay to monitor tht dissemination of an emerging variant of Vibrio cholerae O1 biotype El Tor. / Morita M., Ohnishi M., Arakava E. [et al.] // Microbiol. Immunol. - 2008. - Vol. 52. - P. 314-317.

5. Vibrio cholera O1 Hybrid El Tor strains Asia and Africa / G.B. Nair, F. `Qadri, J. Holmgren [et al.] / G.B. Nair // J. Clin. Microbiol. - 2006. - Vol. 44. - P. 3296-3299.

6. Smirnova N.I., Cheldyshova N.B., Goryaev A.A. et al. Evolution of the Vibrio cholerae genome: pathways for the formation of atypical strains. Probl. especially dangerous inf. 2008, 3 (97): 3-12

7. Evolution of the genome of the cholera vibrio biovar El Tor and the development of a PCR test system for the identification of strains of the causative agent of cholera / IV Savelyeva, AN Kulichenko, DA Kovalev. [and others] // Cholera and vibrios pathogenic for humans: materials of the problem commission - Rostov-on-Don, 2017. Issue. 30 - S. 172-177.

8. Shashkova A.V. Phenotypic and molecular genetic analysis of altered variants of Vibrio cholerae biovar Eltor: author. diss. ... cand. biol. sciences / A.V. Shashkova - Saratov, 2012 .-- 21 p.

9. Morita M., Ohnishi M., Arakawa E. et al. Development and validation of a mismatch amplification mutation PCR assay to monitor the dissemination of an emerging variant of Vibrio cholerae O1 biotype El Tor. Microbiol. Immunol. 2008, 52 (6): 314-317.

10. Smirnova N.I., Goryaev A.A., Shubina A.V., Zadnova S.P., Kutyrev V.B. RF patent No. 2458141, published on 08/10/2012.

Method for identification of VIBRIOCHOLERAEO1 strains,

determination of their toxicity and biovar with differentiation

biovar El Tor for typical and genetically modified

multiplex polymerase chain options

reactions and a test system for its implementation, taking into account

results in "real time"

List of primer and probe sequences 5'– 3 '

SEQ ID NO: 1

ctxB-F = TGTGAATCTATATGTTGACTACCTGG

ctxB-R = CTCTAGCTGGAAAAAGAGAGATGG

ctxB -FAM-G = FAM-TCTACTTGAAAAGTTGCACC BHQ1

ctxB ^CL = G (FAM), Green channel

ctxB -VIC-A = VIC-TCTACTTGAAAAATTGCACC-BHQ

ctxB ^{E L} = A (VIC), channelYellou

SEQ ID NO: 2

rtxC -F = GCTCAAACGCAGGCAGAATG

rtxC -R = GATAGGTGGTGTGATGCTGCTC

rtxC -Probe = FAM / ROXCAGCCATTCTGCAACCACA AACGAC-BHQ1 / 2

rtxC -Probe = FAM / ROX, channel Orange

Claims (2)

1. Method for identification of V. cholerae O1 strains, determination of their toxigenicity and biovar with differentiation of El Tor biovar strains into typical and modified by the method of multiplex polymerase chain reaction with hybridization-fluorescent accounting of the results, characterized by the fact that the polymerase chain reaction is carried out in one step in two reaction mixtures, each of which contains a specially selected combination of primers SEQ ID NO: 1 for genes ctxB ^CL and ctxB ^EL with probes G-FAM and A-VIC in the first; and primers SEQ ID NO: 2 F + R to the rtxC gene with the ROX probe in the second, with the primer annealing temperature of 57 ° C for 30 s with the number of amplification cycles equal to 40, followed by analysis by comparing amplified gene fragments of the studied and control strains ; typical toxigenic V. cholerae O1 strains of the classical biovar are characterized by the presence of amplicons of the ctxB ^CL gene, identical to the control sample; typical toxigenic strains of V. cholerae O1 biovar El Tor are characterized by the presence of amplicons of the ctxB ^EL and rtxC genes, which are identical to the control sample; the modified variants of V. cholerae biovar El Tor are characterized by the presence of amplicons for the ctxB ^CL and rtxC genes. 2. Test system "Genes Vibrio cholerae O1 variant ctxB - rtxC, FL" for the implementation of the method according to claim 1 by the method of multiplex polymerase chain reaction (PCR) in "real time" includes: DNA isolation from the studied culture of Vibrio cholerae O1; components for PCR: 10x buffer for TaqPol, MgCL ₂ (50 mM), a mixture of dNTPs (5 mM), TaqPol (5 U / μL), deionized sterile water, a mixture of primers SEQ ID NO: 1 for the ctxB ^CL and ctxB ^{EL genes} with probes G-FAM (10 mM) and A-VIC (10 mM), a mixture of primers SEQ ID NO: 2 F + R to the rtxC gene with a probe ROX (10 mM), two positive PKO + Classical (V. cholerae Classical DNA 569B) and PKO + El Tor (V. cholerae El Tor DNA, 484Ct) and one negative (H ₂ O) controls; carrying out the polymerase chain reaction in one step in two reaction mixtures of different composition in a volume of 25 μl in "real time": 1 cycle at 95 ° С - 3 min, 40 cycles at 95 ° С - 20 s, 57 ° С - 30 s, 72 ° С - 20 s; accounting of results for specific curved bands in the channels Green (ctxB ^CL gene), Yellow (ctxB ^EL gene), Orange (rtxC gene) at the threshold line level on these metering channels - 0.05; Ct≤30.

Images