CN109988856B - LAMP primer combination for detecting yersinia pneumocystis and application thereof - Google Patents
LAMP primer combination for detecting yersinia pneumocystis and application thereof Download PDFInfo
- Publication number
- CN109988856B CN109988856B CN201711473083.6A CN201711473083A CN109988856B CN 109988856 B CN109988856 B CN 109988856B CN 201711473083 A CN201711473083 A CN 201711473083A CN 109988856 B CN109988856 B CN 109988856B
- Authority
- CN
- China
- Prior art keywords
- primer
- pneumocystis
- yersinia
- sequence
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an LAMP primer combination for detecting yersinia pneumocystis and application thereof. The primer combination provided by the invention consists of 6 primers shown in a sequence 1 to a sequence 6. The primer combination provided by the invention can be applied to detecting whether the sample to be detected contains the yersinia pneumocystis or not. The primer combination provided by the invention is used for detecting the yersinia pneumocystis, has high specificity and high sensitivity, and can realize simple, convenient, rapid and accurate detection. The invention has great popularization value.
Description
Technical Field
The invention relates to the technical field of biology, in particular to an LAMP primer combination for detecting yersinia pneumocystis and application thereof.
Background
Invasive Fungal Disease (IFD), also known as Invasive Fungal Infection (IFI), Deep Fungal Infection (DFI), refers to the pathophysiological process in which fungi invade human tissues and blood, grow and multiply therein, cause inflammatory reactions, and cause tissue damage and organ dysfunction. Over the last two thirty years, with the wide clinical application of new technologies such as solid organ and hematopoietic stem cell transplantation, tumor chemotherapy, immunosuppressants and the like, the incidence and fatality rate of invasive mycosis are increasing year by year, and the incidence and fatality rate become one of the main causes of death of hospitalized patients increasingly. Because the invasive mycosis is infected in the population such as ICU, senile, diabetes, malignant blood system diseases, candida colonization, invasive operation, application of antibacterial drugs, glucocorticoids, immunosuppressants and the like, the immunity of the organism is low, and the severe mortality rate is high, the method has very important significance for early detection of the invasive fungal infection and determination of the infected strain.
Pneumocystis pneumonia (PCP) is a respiratory fungal infection caused by yersinia Pneumocystis jiirovicii (formerly known as Pneumocystis carinii). The yersinia pneumocystis usually parasitized in alveoli, possibly diseased in immunocompromised persons such as immunodeficiency, weak premature babies or malnutrition, is the most important opportunistic infection of aids patients and also is an important cause of death for aids patients.
The existing invasive fungal infection detection methods mainly comprise a conventional detection method and a special detection method. The conventional inspection method mainly comprises the following steps: 1) microscopic examination of fungus, namely direct smear staining microscopic examination; 2) culturing and identifying fungi; 3) and (5) histopathological examination. The special inspection method mainly comprises the following steps: 1) serological examination; 2) and (4) molecular biological examination. The conventional inspection method is still regarded as a foundation stone for determining invasive fungal infection, but the conventional inspection method has the problems of low sensitivity, complicated operation, incapability of excluding diagnosis due to negative results, long detection period (usually requiring several days to several weeks), and the like, so that the condition and medication are delayed, the death rate is increased, and the like; serological tests have difficulty excluding interspecies antigen-antibody cross-reactions of certain genera of fungi, leading to false positives. Compared with the former two methods, the molecular biology technology has the advantages of high specificity and high accuracy, and can elucidate the taxonomic relation between and in fungal populations from the gene level, so that the molecular biology technology is more and more widely accepted and applied in recent years. The related molecular diagnosis methods established at present comprise a common PCR method, a pulse field gel electrophoresis typing (PFGE), a multi-site sequence typing (MLST), a restriction fragment length polymorphism analysis (RFLP), a real-time fluorescent quantitative PCR technology (RTFQ-PCR) and the like, and have the common problems of higher requirements on experimental operation and longer detection time (about 2.5h-3 h). Therefore, it is the key to solve the current situation to establish a fast and accurate molecular diagnosis method and provide an early diagnosis and treatment basis for clinical application.
Disclosure of Invention
The invention aims to provide an LAMP primer combination for detecting yersinia pneumocystis and application thereof.
The invention firstly provides a primer combination which consists of a primer F3, a primer B3, a primer FIP, a primer BIP, a primer LF and a primer LB;
the primer F3 is (a1) or (a 2):
(a1) a single-stranded DNA molecule shown in sequence 1 of the sequence table;
(a2) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 1 and have the same functions as the sequence 1;
the primer B3 is (a3) or (a 4):
(a3) a single-stranded DNA molecule shown in a sequence 2 of a sequence table;
(a4) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 2 and have the same functions as the sequence 2;
the primer FIP is (a5) or (a6) as follows:
(a5) a single-stranded DNA molecule shown in sequence 3 of the sequence table;
(a6) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 3 and have the same functions as the sequence 3;
the primer BIP is (a7) or (a8) as follows:
(a7) a single-stranded DNA molecule shown in a sequence 4 of the sequence table;
(a8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 4 and having the same functions as the sequence 4;
the primer LF is (a9) or (a 10):
(a9) a single-stranded DNA molecule shown in sequence 5 of the sequence table;
(a10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 5 and having the same functions as the sequence 5;
the primer LB is (a11) or (a 12):
(a11) a single-stranded DNA molecule shown in sequence 6 of the sequence table;
(a12) and (b) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 6 and has the same function as the sequence 6.
The application of the primer combination is (b1), (b2), (b3) or (b4):
(b1) identifying whether the bacteria to be tested is yersinia pneumocystis;
(b2) preparing a kit for identifying whether the bacteria to be detected are yersinia pneumocystis or not;
(b3) detecting whether the sample to be detected contains yersinia pneumocystis or not;
(b4) preparing a kit for detecting whether the sample to be detected contains the yersinia pneumocystis.
The invention also protects the application of the primer combination, which is (b1) or (b2) or (b3) or (b4):
(b1) identifying whether the bacteria to be tested is yersinia pneumocystis;
(b2) preparing a kit for identifying whether the bacteria to be detected are yersinia pneumocystis or not;
(b3) detecting whether the sample to be detected contains the yersinia pneumocystis or not;
(b4) preparing a kit for detecting whether the sample to be detected contains the yersinia pneumocystis or not.
The invention also protects a kit containing the primer combination; the use of the kit is as follows (c1) or (c 2):
(c1) identifying whether the bacteria to be tested is the yersinia pneumocystis;
(c2) and detecting whether the sample to be detected contains the yersinia pneumocystis.
The invention also provides a preparation method of the kit, which comprises the step of packaging each primer separately.
The invention also protects a method for identifying whether the bacteria to be detected is yarrowia pneumocystis, which comprises the following steps: taking the genome DNA of the bacteria to be detected as a template, and adopting the primer combination to carry out loop-mediated isothermal amplification, wherein if the primer combination is adopted, the specific amplification taking the genome DNA as the template can be realized, and the bacteria to be detected is or is selected as a candidate of the yersinia pneumocystis; if specific amplification by using the genome DNA as a template cannot be realized by using the primer combination, the to-be-detected bacterium is non-Yersinia pneumocystis.
The invention also provides a method for identifying whether the bacteria to be detected is yersinia pneumocystis, which comprises the following steps: detecting whether the genome DNA of the bacteria to be detected contains the target sequence of the primer combination, if the genome DNA contains the target sequence of the primer combination, the bacteria to be detected is or is selected as the yersinia pneumocystis; if the genomic DNA does not contain the target sequence of the primer combination, the bacteria to be tested is non-Yersinia pneumocystis.
The invention also provides a method for detecting whether the sample to be detected contains the yersinia pneumocystis, which comprises the following steps: taking the total DNA of a sample to be detected as a template, and adopting the primer combination to carry out loop-mediated isothermal amplification, wherein if the primer combination is adopted, the specific amplification taking the total DNA as the template can be realized, and the sample to be detected contains the yersinia pneumocystis; if specific amplification by using the total DNA as a template cannot be realized by using the primer combination, the sample to be detected does not contain the yersinia pneumocystis.
The invention also provides a method for detecting whether the sample to be detected contains the yersinia pneumocystis, which comprises the following steps: detecting whether the total DNA of a sample to be detected contains the target sequence of the primer combination, if so, the sample to be detected contains the yersinia pneumocystis; if the total DNA does not contain the target sequence of the primer combination, the sample to be tested does not contain the yersinia pneumocystis.
In any of the above methods, the molarity of the primer F3, the molarity of the primer B3, the molarity of the primer FIP, the molarity of the primer BIP, the molarity of the primer LF and the molarity of the primer LB are respectively 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M.
In any of the above methods, the loop-mediated isothermal amplification reaction conditions are: keeping the temperature at 65 ℃ for 50 min.
Any of the above-mentioned bacteria to be tested may specifically be Yersinia pneumocystis, Aspergillus fumigatus, Aspergillus terreus, Cryptococcus neoformans or Cryptococcus gatus. The aspergillus fumigatus can be specifically CGMCC, and the strain number is as follows: 3.08027 Aspergillus fumigatus. The aspergillus terreus can be specifically CGMCC, and the strain number is as follows: 3.08115 Aspergillus terreus. The cryptococcus neoformans can be specifically ATCC, strain number: 208821. The cryptococcus gatherensis can be ATCC, strain number: 14248 Cryptococcus gatherensis.
Any of the above-described test samples may specifically be alveolar lavage fluid from human (Homo sapiens).
The loop-mediated isothermal amplification (LAMP) is a sensitive, specific, simple and rapid nucleic acid amplification technology developed in recent years, and the principle is that under the action of DNA polymerase with strand displacement activity, 4-6 primers of 6-8 regions are identified, a target gene is rapidly and specifically amplified under an isothermal condition, and the LAMP can be popularized and applied to rapid and accurate detection of common carbapenem drug-resistant genes. The LAMP method has the advantages of high sensitivity, good specificity, short reaction time, convenient judgment result, no need of expensive instruments and the like.
The primer combination provided by the invention is used for detecting common aspergillus hexaflumineus, has high specificity and high sensitivity, and can realize simple, quick and accurate detection. The invention has great popularization value.
Drawings
FIG. 1 shows the results of detection using the primer set I in example 1.
FIG. 2 shows the results of detection using primer set II in example 1.
FIG. 3 shows the results of detection using the primer set III in example 1.
FIG. 4 shows the results of detection using the primer set IV in example 1.
FIG. 5 shows the results of detection using the primer set V in example 1.
FIG. 6 shows the results of the measurement in example 2.
FIG. 7 shows the results of detection in the reaction system 1 in example 3.
FIG. 8 shows the results of measurement of the reaction system 2 in example 3.
FIG. 9 shows the results of detection in reaction system 3 of example 3.
FIG. 10 shows the results of detection in the reaction system 4 of example 3.
FIG. 11 shows the results of detection in example 4.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
The reaction solution is a product of Boao biological group, Inc., and the catalog number is CP.440020.
The DNA copy number was calculated as follows:
1a260 absorbance value ds DNA 50 μ g/ml;
nucleic acid concentration (OD260) × (dilution factor) × (50) × ng/μ l;
average Molecular Weight (MW) represents grams per mole in daltons (dolton), i.e., 1dolton ═ 1 g/mol;
molar ratio is 6.02X 10 23 ；
Average Molecular Weight (MW) dsDNA ═ (number of bases) x (660 daltons/base);
copy number calculation formula:
(6.02×10 23 copies/mole) × (xng/μ l × 10 -9 ) /(DNA length. times.660) ═ copies/. mu.l.
Example 1 screening preparation of primer combinations
First, screening of primer combination
1. Several primer combinations were designed for yersinia pneumocystis, five of which were as follows:
primer combination I for detection of Yersinia pneumonoconiae was as follows (5 '→ 3'):
primers I-F3: TTCAACTATTTCTCCAGA, respectively;
primer I-B3: TGCCACTGTAATTTCC;
primers I-FIP: CGTCAAAAATAGACTTTGGTTGCAATACTGAACGGCCACCA, respectively;
primer I-BIP: AATTTTTTTCTTGGTACCCAGGACCCATGTAACAACATAAGG, respectively;
primers I-LF: TGAGTTACATTCTCAAA, respectively;
primers I-LB: AGTTTCCCACATAT are provided.
Primer combination ii for detection of yersinia pneumoniae was as follows (5 '→ 3'):
primer II-F3: AGCTGGTACATATGCA;
primer II-B3: ATTCTCCAACATAAGCAA, respectively;
primer II-FIP: AGCGAATGTCCTTTATACTGGAAAAACTTTATCAGCAATAGTTGA, respectively;
primer II-BIP: GCTATGCCTCATCATATGTCTTCAGTTGTACTTGGAAGAGAAAC, respectively;
primer II-LF: TGTATAAGTATAATTACCAGT, respectively;
primer II-LB: TGACAATATTACAGCATCT is added.
Primer combination iii for detection of yersinia pneumocystis was as follows (5 '→ 3'):
primer III-F3: ATTTATTTAGGGCTATAAGT, respectively;
primer III-B3: ATACACAAGATACCATGCT, respectively;
primer III-FIP: CCTTTCCAACCATCGTTAATAGTATTCGAACACCATCATT, respectively;
primer III-BIP: AAATCTGGCTATTTCAAAACCAAGACCCGTTATCAAGATATT;
primer III-LF: TTTGTTATCCCATTCAC, respectively;
primer III-LB: TATGATTTCTTTTCAAG is added.
The primer combination for detection of yarrowia pneumocystis iv was as follows (5 '→ 3'):
primer IV-F3: ATCAGCTGGTACATATG;
primer IV-B3: CTCCAACATAAGCAACC, respectively;
primer IV-FIP: AGCGAATGTCCTTTATACTGGAAAACAATAGTTGATGGCA, respectively;
primer IV-BIP: GCCTCATCATATGTCTTCAGTTGTACTTGGAAGAGAAACGT, respectively;
and (3) primers IV-LF: TATCAAATGTATAAGTAT, respectively;
and the primer IV-LB: TTTGACAATATTACAGC are provided.
Primer combination v for detection of yersinia pneumocystis was as follows (5 '→ 3'):
primer V-F3: TTTAATACGAGATGTTGCA, respectively;
primer V-B3: GGCATTATCACCGATTGT, respectively;
primer V-FIP: GCCCAAGAATGTCCAGTAAACCAAGTTCATGATTCTTATTTTCC, respectively;
primer V-BIP: GGTATATTTGAGTCGCCTGACGGAATCCCAAAAAGCTTCATTGC, respectively;
primer V-LF: TCAAAGGAGCGAAAA;
primer V-LB: AGACGAAGAATCTTCAT are provided.
In the above primer combination, each single-stranded DNA is packed independently.
In the above primer combinations, the molar ratios of the primer F3, the primer B3, the primer FIP, the primer BIP, the primer LF and the primer LB were all 0.5: 0.5: 2: 2: 1: 1.
2. and (2) taking the plasmid DNA of the gene for detecting the yersinia pneumocystis as a template, and respectively adopting the primer group I, the primer group II, the primer group III, the primer group IV and the primer group V prepared in the step (1) to carry out the loop-mediated isothermal amplification detection on the template.
Yersinia pneumocystis detection gene plasmid: inserting a DNA molecule with the Genbank number of KM056674.1 into a SacI site of a pUC57 plasmid (biological engineering (Shanghai) GmbH) to obtain a recombinant plasmid, wherein the plasmid is a detection gene plasmid of the yersinia pneumocystis.
Reaction system (10 μ L): mu.L of the reaction mixture (product catalog number: CP.440020, product of Boo Bio Inc.), 1. mu.L of the primer mixture, 1. mu.L of the template DNA (5pg-50pg), and 10. mu.L of water. The primer mixture is a mixture of each primer in the primer combination. In the reaction system, the final concentrations of the primer F3 and the primer B3 were 0.5. mu.M, the final concentrations of the primer FIP and the primer BIP were 2. mu.M, and the final concentrations of the primer LF and the primer LB were 1. mu.M, respectively.
The reaction conditions are as follows: keeping the temperature at 65 ℃ for 50 min.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.
Each reaction system was set up for 20 replicates.
If a positive amplification curve (i.e., an amplification curve that is typically a "sigmoid" amplification curve) appears within 50min, it indicates that the corresponding genomic content in the reaction system can be detected. If no positive amplification curve (i.e. amplification curve is typical "S-type" amplification curve) appears within 50min, it indicates that the corresponding genome content in the reaction system cannot be detected.
The results of the detection using the primer set I are shown in FIG. 1. The results of the detection using primer set II are shown in FIG. 2. The results of the detection using primer set III are shown in FIG. 3. The results of the detection using the primer set IV are shown in FIG. 4. The results of the detection using primer set V are shown in FIG. 5.
The results show that 20 primer combinations III have good repeatability, and the other four primer combinations have poor detection repeatability due to the primer spacing, annealing temperature and the like in primer design, so that the combination III is selected as the primer combination for detecting the yersinia pneumocystis.
Preparation of primer combination
Primer combinations for detection of yersinia pneumocystis were as follows (5 '→ 3'):
primer F3 (sequence 1): ATTTATTTAGGGCTATAAGT, respectively;
primer B3 (sequence 2): ATACACAAGATACCATGCT;
primer FIP (sequence 3): CCTTTCCAACCATCGTTAATAGTATTCGAACACCATCATT, respectively;
primer BIP (sequence 4): AAATCTGGCTATTTCAAAACCAAGACCCGTTATCAAGATATT, respectively;
primer LF (sequence 5): TTTGTTATCCCATTCAC, respectively;
primer LB (seq id No. 6): TATGATTTCTTTTCAAG are provided.
In the primer combination, each single-stranded DNA is independently packaged.
In the primer combination, the molar ratio of the primer F3, the primer B3, the primer FIP, the primer BIP, the primer LF and the primer LB is 0.5: 0.5: 2: 2: 1: 1.
example 2 specificity
Firstly, preparation of sample to be tested
Sample to be tested 1: aspergillus fumigatus (CGMCC, strain number: 3.08027) genomic DNA;
and 2, sample to be tested: aspergillus terreus (CGMCC, strain number: 3.08115) genome DNA;
sample to be tested 3: cryptococcus neoformans (ATCC, strain number: 208821) genomic DNA;
sample to be tested 4: cryptococcus gatherensis (ATCC, strain No. 14248) genomic DNA;
and 5, a sample to be detected: yersinia pneumocystis detection gene plasmid DNA; yersinia pneumocystis detection gene plasmid: inserting a DNA molecule with the Genbank number of KM056674.1 into a SacI site of a pUC57 plasmid (biological engineering (Shanghai) GmbH) to obtain a recombinant plasmid, wherein the plasmid is a detection gene plasmid of the yersinia pneumocystis.
Second, detection of the sample to be detected
And (3) taking each sample to be detected in the step one as a template, and performing loop-mediated isothermal amplification by adopting the primer combination prepared in the step two in the embodiment 1.
Reaction system (10 μ L): 7.0. mu.L of the reaction mixture (product catalog No. CP.440020, product of Boo Bio Inc.), 1. mu.L of the primer mixture, 1. mu.L of the template DNA (5pg-50pg), and 10. mu.L of water were added. The primer mixture is a mixture of each primer in the primer combination. In the reaction system, the final concentrations of the primer F3 and the primer B3 were 0.5. mu.M, the final concentrations of the primer FIP and the primer BIP were 2. mu.M, and the final concentrations of the primer LF and the primer LB were 1. mu.M, respectively.
Reaction conditions are as follows: keeping the temperature at 65 ℃ for 50 min.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.
Each reaction system was set up for 20 replicates.
The results are shown in FIG. 6. The results show that a positive amplification curve (i.e., an amplification curve that is typically a "sigmoid" amplification curve) is only shown when the sample to be tested is Yersinia pneumocystis plasmid DNA (sample 5). When the samples to be detected are samples 1, 2, 3 and 4, no positive amplification curve is displayed.
The results show that the primer combination provided by the invention has high specificity to the target gene.
Example 3 sensitivity
A sample to be tested: yersinia pneumocystis detection gene plasmid DNA; yersinia pneumocystis detection gene plasmid: inserting a DNA molecule with the Genbank number of KM056674.1 into a SacI site of a pUC57 plasmid (biological engineering (Shanghai) GmbH) to obtain a recombinant plasmid, wherein the plasmid is a detection gene plasmid of the yersinia pneumocystis.
1. And (3) carrying out gradient dilution on the sample to be detected by using sterile water to obtain each diluent.
2. And (2) performing loop-mediated isothermal amplification by using the diluent obtained in the step (1) as a template and adopting the primer combination prepared in the step (II) of the embodiment 1.
Reaction system (10 μ L): 7.0. mu.L of the reaction solution (product catalog number CP.440020 of Boo Bio Inc.), 1. mu.L of the primer mixture, 1. mu.L of the diluent, and 10. mu.L of water. The primer mixture is a mixture of each primer in the primer combination. In the reaction system, the final concentrations of the primer F3 and the primer B3 were 0.5. mu.M, the final concentrations of the primer FIP and the primer BIP were 2. mu.M, and the final concentrations of the primer LF and the primer LB were 1. mu.M, respectively.
Reaction conditions are as follows: keeping the temperature at 65 ℃ for 50 min.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.
The total of 4 reaction systems are as follows according to the different genome copy numbers in the dilution:
reaction system 1: the number of copies of the genome contained in 1. mu.L of each dilution was 10 3 ；
Reaction system 2: the number of copies of the genome contained in 1. mu.L of the dilution was 5X 10 2 ；
Reaction system 3: the number of copies of the genome contained in 1. mu.L of each dilution was 10 2 ；
Reaction system 4: the number of copies of the genome contained in 1. mu.L of each dilution was 10 1 。
Each reaction system was set up for 20 replicates.
The results are shown in FIGS. 7-10. Primer combination detection targetGene genome copy number in 1. mu.L dilution is 10 3 (FIG. 7) and 5X 10 2 (FIG. 8) 20 assays were all detectable with good reproducibility, 10 2 (FIG. 9) and 10 1 (FIG. 10) since 20 detections did not show complete peak and were poor in reproducibility, the sensitivity of the primer combination was 5X 10 2 Number of copies/reaction system.
Example 4 clinical sample testing
A sample to be tested: human alveolar lavage fluid confirmed to contain yersinia.
1. And extracting the total DNA of the sample to be detected.
2. And (3) performing loop-mediated isothermal amplification by using the total DNA extracted in the step (1) as a template and adopting the primer combination prepared in the step (II) of the embodiment 1.
The reaction system and reaction conditions were the same as in example 2.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.
The results are shown in FIG. 11. The result shows that a positive amplification curve is obtained, which indicates that the primer combination can be used for detecting the yersinia pneumocystis in a clinical sample.
The result shows that the primer combination of the yersinia pneumocystis can be used for detecting the yersinia pneumocystis, and the result is accurate and reliable.
<110> Bo ao bion Co., Ltd
<120> LAMP primer combination for detecting yersinia pneumocystis and application thereof
<160> 6
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 1
atttatttag ggctataagt 20
<210> 2
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 2
atacacaaga taccatgct 19
<210> 3
<211> 40
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 3
cctttccaac catcgttaat agtattcgaa caccatcatt 40
<210> 4
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 4
aaatctggct atttcaaaac caagacccgt tatcaagata tt 42
<210> 5
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 5
tttgttatcc cattcac 17
<210> 6
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 6
tatgatttct tttcaag 17
Claims (7)
1. The primer combination consists of a primer F3, a primer B3, a primer FIP, a primer BIP, a primer LF and a primer LB;
the primer F3 is a single-stranded DNA molecule shown in sequence 1 of the sequence table;
the primer B3 is a single-stranded DNA molecule shown in a sequence 2 in a sequence table;
the primer FIP is a single-stranded DNA molecule shown in a sequence 3 of a sequence table;
the primer BIP is a single-stranded DNA molecule shown in a sequence 4 of a sequence table;
the primer LF is a single-stranded DNA molecule shown in a sequence 5 of a sequence table;
the primer LB is a single-stranded DNA molecule shown in a sequence 6 of the sequence table.
2. The primer combination of claim 1, which is used as (b1), (b2), (b3) or (b4):
(b1) identifying whether the bacteria to be tested is the yersinia pneumocystis;
(b2) preparing a kit for identifying whether the bacteria to be detected are yersinia pneumocystis or not;
(b3) detecting whether the sample to be detected contains the yersinia pneumocystis or not;
(b4) preparing a kit for detecting whether the sample to be detected contains the yersinia pneumocystis or not;
the use is for non-disease diagnostic and therapeutic purposes.
3. A kit comprising the primer combination of claim 1; the use of the kit is as follows (c1) or (c 2):
(c1) identifying whether the bacteria to be tested is the yersinia pneumocystis;
(c2) and detecting whether the sample to be detected contains the yersinia pneumocystis.
4. A method for identifying whether a test bacterium is a yersinia pneumocystis, comprising the steps of: performing loop-mediated isothermal amplification by using the primer combination of claim 1 and genomic DNA of a bacterium to be tested as a template, wherein if the primer combination is used to realize specific amplification by using the genomic DNA as the template, the bacterium to be tested is or is selected as a candidate of the bacterium to be tested; if specific amplification by taking the genome DNA as a template cannot be realized by adopting the primer combination, the to-be-detected bacterium is non-Yersinia pneumocystis;
the methods are for non-disease diagnostic and therapeutic purposes.
5. A method for identifying whether a test bacterium is a yersinia pneumocystis, comprising the steps of: detecting whether the genomic DNA of a test bacterium contains the target sequence of the primer combination in the claim 1, if the genomic DNA contains the target sequence of the primer combination, the test bacterium is or is selected to be yersinia pneumocystis; if the genomic DNA does not contain the target sequence of the primer combination, the bacteria to be detected is non-Yersinia pneumocystis;
the methods are methods for non-disease diagnostic and therapeutic purposes.
6. The method for detecting whether the sample to be detected contains the yersinia pneumocystis or not comprises the following steps: performing loop-mediated isothermal amplification by using the primer combination of claim 1 and the total DNA of a sample to be tested as a template, wherein if the primer combination is used, specific amplification by using the total DNA as the template can be realized, and the sample to be tested contains the yersinia pneumocystis; if specific amplification by taking the total DNA as a template cannot be realized by adopting the primer combination, the sample to be detected does not contain the yersinia pneumocystis;
the methods are methods for non-disease diagnostic and therapeutic purposes.
7. The method for detecting whether the sample to be detected contains the yersinia pneumocystis or not comprises the following steps: detecting whether the total DNA of a sample to be tested contains the target sequence of the primer combination of claim 1, if the total DNA contains the target sequence of the primer combination, the sample to be tested contains the yersinia pneumocystis; if the total DNA does not contain the target sequence of the primer combination, the sample to be tested does not contain the yersinia pneumocystis;
the methods are for non-disease diagnostic and therapeutic purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711473083.6A CN109988856B (en) | 2017-12-29 | 2017-12-29 | LAMP primer combination for detecting yersinia pneumocystis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711473083.6A CN109988856B (en) | 2017-12-29 | 2017-12-29 | LAMP primer combination for detecting yersinia pneumocystis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109988856A CN109988856A (en) | 2019-07-09 |
| CN109988856B true CN109988856B (en) | 2022-09-27 |
Family
ID=67109262
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711473083.6A Active CN109988856B (en) | 2017-12-29 | 2017-12-29 | LAMP primer combination for detecting yersinia pneumocystis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109988856B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4019631A4 (en) * | 2019-08-23 | 2023-09-13 | FUJIFILM Corporation | Primer pair for detecting pneumocystis jirovecii, method for detecting pneumocystis jirovecii using same and reagent kit therefor |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN203833934U (en) * | 2013-09-10 | 2014-09-17 | 中国医科大学 | Pneumocystis LAMP specific detection kit |
-
2017
- 2017-12-29 CN CN201711473083.6A patent/CN109988856B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN203833934U (en) * | 2013-09-10 | 2014-09-17 | 中国医科大学 | Pneumocystis LAMP specific detection kit |
Non-Patent Citations (3)
| Title |
|---|
| Evaluation of Loop-Mediated Isothermal Amplification Assay for the Detection of Pneumocystis jirovecii in Immunocompromised Patients;Preeti Singh et al.;《Molecular Biology International》;20151231;第2015卷;第2.4节、第3.3节 * |
| 肺孢子菌基因LAMP检测方法的建立;张楠等;《热带医学杂志》;20150828;第15卷(第8期);第1007-1009页 * |
| 肺孢子菌肺炎的病原检查和基因检测;卢思奇;《诊断学理论与实践》;20101225(第06期);第552-554页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109988856A (en) | 2019-07-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109055502B (en) | Detection method, detection kit and application of invasive fungal infection | |
| CN106893782B (en) | It is a kind of to detect and identify cryptococcal target gene, primer and probe and kit | |
| CN113881789B (en) | Probe and primer pair composition for detecting cryptococcus and detection method and application | |
| CN106702019A (en) | Detection probe for SNP (Single Nucleotide Polymorphism) of human CYP2C19 gene and application of detection probe | |
| CN111004862B (en) | Primer and probe for rapidly detecting and identifying cryptococcus and application thereof | |
| CN113999933A (en) | Method for accurately detecting cryptococcus neoformans | |
| CN103667514A (en) | Kit for detecting polymorphism of interleukin 28B gene by utilizing fluorescence PCR (Polymerase Chain Reaction) technology | |
| CN109706145B (en) | Primer set and application thereof | |
| CN109487000B (en) | Primer combination and application thereof | |
| CN110079621B (en) | Oligonucleotide combination, method and kit for identifying mycobacterium species | |
| CN108707691A (en) | A kind of primer combination of probe of specific detection aspergillus fumigatus and the kit that aspergillus fumigatus is detected based on fluorescent PCR method | |
| CN102229989A (en) | Method and kit for detecting ethambutol resistance mutation of Mycobacterium tuberculosis | |
| CN104263833B (en) | Nucleic acid film bar and test kit for candidiasis strain identification and detection in Gene Mutation | |
| CN109988857B (en) | LAMP primer combination for detecting two cryptococcus and application thereof | |
| CN108315478A (en) | The probe and kit of RAA Fluorometric assay hydrophobins | |
| CN109988856B (en) | LAMP primer combination for detecting yersinia pneumocystis and application thereof | |
| CN109988855B (en) | LAMP primer combination for detecting six kinds of aspergillus and application thereof | |
| CN105368943A (en) | Kit and method for identifying mycobacterium strains | |
| CN111172273B (en) | Primer group, kit and detection method for SMN1 gene detection | |
| RU2550257C2 (en) | METHOD OF DIFFERENTIATING TYPICAL AND ATYPICAL STRAINS Yersinia pestis OF MEDIEVAL BIOVAR BY PCR METHOD WITH HYBRIDISATION-FLUORESCENT RECORDING RESULTS | |
| CN102719548B (en) | Kit for detecting brucella and use method thereof | |
| CN110055345A (en) | Primer sets and its application | |
| CN110894532A (en) | RAA constant temperature fluorescence detection method and reagent for bacterial septicemia (FBS) | |
| CN111712583B (en) | Method for diagnosing tsutsugamushi disease using multiple copy genes | |
| CN107312832A (en) | A kind of kit, the application method of kit, the purposes of kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |