CN105368943A - Kit and method for identifying mycobacterium strains - Google Patents
Kit and method for identifying mycobacterium strains Download PDFInfo
- Publication number
- CN105368943A CN105368943A CN201510812703.9A CN201510812703A CN105368943A CN 105368943 A CN105368943 A CN 105368943A CN 201510812703 A CN201510812703 A CN 201510812703A CN 105368943 A CN105368943 A CN 105368943A
- Authority
- CN
- China
- Prior art keywords
- probe
- mycobacterium
- nucleic acid
- target nucleic
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a kit and a method for identifying mycobacterium strains. The method comprises the following steps: (1) design and synthesis of a primer and a probe; (2) PCR reaction component; (3) PCR amplification; and (4) melting curve analysis. The kit and the method disclosed by the invention, on the basis of fluorescent PCR and melting curve analysis technical platform, can detect 12 mycobacterium strains which are common in the clinical field through the innovative application of the novel double-labeled and double-specific probe which has nucleic acid modification, so that the Tm value difference among the various strains is more than or equal to 4 DEG C within at least one detection channel; and the kit and the method is suitable for accurately and effectively identifying a composite strain that two or more strains simultaneously exist.
Description
Technical field
The present invention relates to a kind of test kit for the identification of mycobacteria strain and method, belong to technical field of molecular biology.
Background technology
Polymerase chain reaction (PCR) technology, since 1985 come out, through the development of decades, has become the routine techniques in laboratory.It is indispensable means in modern molecular biology research, is a kind of very responsive amplification system.Compared to traditional methods for clinical diagnosis, diagnostic nucleic acid is the diagnostic techniques on molecular level, can make up some defect of traditional clinical diagnostic method.Therefore, be that the nucleic acid diagnostic techniques of representative obtains increasingly extensive application in clinical diagnosis with round pcr.
Compared with traditional PCR detecting pattern, the fluorescent PCR method of inspection of (namely pcr amplification reaction and fluorescence labeling probe are detected in same encloses container and combine) the testing goal nucleic acid that the pcr amplification in normal PCR detecting pattern and detection combined in recent years is launched respectively.The fluorescent PCR method of inspection not only has the high sensitivity of regular-PCR, and owing to applying fluorescent probe, so also have the high specific of DNA hybridization and the high precision of spectroscopic techniques, overcome many shortcomings of Standard PCR, do not need PCR aftertreatment, avoid the many drawbacks in Standard PCR operation, thus pcr amplification product can be detected fast and dynamically and reduce the pollution that external nucleic acid causes.
The fluorescence dye that fluorescence PCR detection reagent uses the earliest comprises: SYBRGREEN, EVEGREEN, although dye method is simple, None-identified non-specific amplification, is therefore very restricted in actual applications.Nowadays such as, mainly with method, Taqman probe, molecular beacon and fluorogenic hybridization probe etc. based on employing fluorescent probe, fluorescent probe monitors the specificity of pcr amplification product in real time, thus avoids non-specific amplification, improves the specificity of target sequence.But probe ubiquity as above inserts or lacks the limited shortcoming of recognition capability to single base mutation or polybase base.
Fluorescent PCR application clinically is mainly divided into: the diagnosis of infectious diseases; The diagnosis of genetic diseases; The diagnosis of tumour; The diagnosis of mother-to-baby transmission and Forensic Identification etc.
The clinical visible mainly mycobacterium tuberculosis (MTB) that can cause human diseases, also has Kansas, bird in addition, in born of the same parents, ape and monkey, toad, sea, ulcer, scrofula, Ma Ermo, Su Jia, accidentally, tortoise, abscess etc. more than 10 plants non-tuberculous mycobacteria (NTM).NTM disease has the systemic toxicity profiles symptom similar to tuberculosis clinical manifestation and local lesion, when without bacterial classification qualification result, is difficult to differentiate with tuberculosis.NTM and MTB drug susceptibility differs widely, many NTM Antituberculous Drugs natural drug resistances, different N TM bacterial classification is also not identical to drug susceptibility, chemotherapy regimen should be different according to different strain, therefore, mycobacteria strain is identified not only on epidemiology, and all significant in clinical diagnosis and treatment.
And traditional at present method for identification of mycobacterium species is according to biological phenotype feature and cytochemistry reaction analyses, method is complicated, time-consuming, is badly in need of setting up quick, easy, method for identification of mycobacterium species accurately.In recent years, along with Molecular Biology and technology, the fast development of the various molecular diagnostic techniques particularly based on polymerase chain reaction (PCR), molecular diagnostic techniques is studied application in mycobacteria strain qualification.
The at present method of more existing mycobacteria strain qualifications based on round pcr, as PCR-direct sequencing, PCR-RFLP, PCR-gene chips etc., these method ubiquity complicated operations, easily cause the shortcomings such as crossed contamination.
The present inventor is called in the Chinese invention patent CN102634575B of " a kind of new mycobacteria strain rapid identification method and test kit " in name disclosed in 15 days Augusts in 2012 and discloses a kind of test kit for the identification of mycobacteria strain, comprising two pairs of primers and three probes, described two pairs of primers comprise primer TBleft1, TBleft2, TBright1 and TBright2, its nucleotide sequence is respectively as SEQIDNO:1, SEQIDNO:2, SEQIDNO:3, shown in SEQIDNO:4, described three probe TBProbe1, TBProbe2, 5 ' the end of TBProbe3 uses reporter fluorescence dye marker, 3 ' end quencher fluorescent dye marks, its nucleotide sequence is respectively as SEQIDNO:13, SEQIDNO:14, shown in SEQIDNO:15.Through experiment, contriver finds, owing to only employing common double label probe in the method disclosed in this patent documentation, between part bacterial classification, Tm value difference is different less, be only applicable to the single culture qualification of separation and Culture, and to the simultaneous situation of two or more bacterium, then cannot differentiate.
Therefore, provide a kind of and can identify that the test kit of two or more mycobacteria strains and method just become the technical barrier that this technical field is badly in need of solution accurately and effectively.
Summary of the invention
An object of the present invention is to provide a kind of test kit can identifying two or more mycobacteria strains accurately and effectively.
Foregoing invention object of the present invention reaches by the following technical programs:
A kind of test kit for the identification of mycobacteria strain, wherein identification reagent comprises three pairs of primers and five probes, and described primer comprises upstream primer primer1, downstream primer primer2, upstream primer primer3, downstream primer primer4, upstream primer primer5 and downstream primer primer6; The nucleotide sequence of primer primer1, primer2, primer3, primer4, primer5 and primer6 is respectively as shown in SEQIDNO.6, SEQIDNO.7, SEQIDNO.8, SEQIDNO.9, SEQIDNO.10, SEQIDNO.11; Described probe comprises 3 regions: hold strand target nucleic acid sequence combining site as the 1st region with 5 ' of described target nucleic acid sequence complementation; Hold strand target nucleic acid sequence combining site as the 2nd region with 3 ' of described target nucleic acid sequence complementation; Hold the non-binding protruding part of holding combining site to be connected with described 3 ' as the 3rd region with described 5 '; Described five probes are respectively Probe1, Probe2, Probe3, Probe4 and Probe5; Its nucleotide sequence is respectively as shown in SEQIDNO.1, SEQIDNO.2, SEQIDNO.3, SEQIDNO.4, SEQIDNO.5.
Preferably, described probe is the double-tagging and dual specific probe of modifying with nucleic acid, and nucleic acid is modified to lock nucleic acid and modifies, and to modify and target nucleic acid sequence exists the nucleic acid sequences of mutation differences in described probe the 1st the region in.
Preferably, described probe also comprises a fluorophor and a non-fluorescence quencher, fluorophor is marked at the described 1st region 5 ' end of described probe or described 2nd region 3 ' end, and non-fluorescence quencher is marked on the nucleotide residue of the 1st intra-zone of probe.
Preferably, described fluorophor is selected from HEX and/or ROX.
Preferably, described non-fluorescence quencher is selected from BHQ1 and/or BHQ2.
Preferably, described mycobacterium is selected from mycobacterium tuberculosis (M.tuberculosis), mycobacterium kansasii (M.kansasii), Mycobacterium scrofulaceum (M.scrofulaceum), Mycobacterium marinum (M.marmum), mycobacterium buruli (M.ulcerans), Mycobacterium intracellulare (M.intracellulare), mycobacterium avium (M.avium), M. smegmatics (M.smegmatis), mycobacterium fortuitum (M.fortuitum), Mycobacterium chelonei tortoise subspecies (M.chelonaesubsp.chelonae), Mycobacterium chelonei abscess subspecies (M.chelonaesubsp.abscessus), the combination of one or two or more kinds in mycobacterium xenopi (M.xenopi).
Its middle probe Probe1 effectively can differentiate mycobacterium tuberculosis, Mycobacterium marinum/mycobacterium buruli, Mycobacterium intracellulare/mycobacterium avium/mycobacterium fortuitum, Mycobacterium scrofulaceum/mycobacterium kansasii, M. smegmatics/Mycobacterium chelonei/mycobacterium abscessus/mycobacterium xenopi; Probe Probe2 effectively can differentiate Mycobacterium intracellulare, mycobacterium avium/mycobacterium xenopi, mycobacterium fortuitum/M. smegmatics, Mycobacterium chelonei/mycobacterium abscessus; Probe Probe3 can effectively differentiate Mycobacterium marinum, mycobacterium buruli; Probe Probe4 can effectively differentiate Mycobacterium chelonei, mycobacterium abscessus; Probe Probe5 can effectively differentiate Mycobacterium scrofulaceum, mycobacterium kansasii.
Another object of the present invention is to provide a kind of mentioned reagent box for the preparation of the application in the product of identification of mycobacterium.
Foregoing invention object of the present invention reaches by the following technical programs:
The above-mentioned test kit for the identification of mycobacteria strain is for the preparation of the application in the product of identification of mycobacterium.
Another object of the present invention is to provide a kind of method can identifying two or more mycobacteria strains accurately and effectively.
Foregoing invention object of the present invention reaches by the following technical programs:
For the identification of a method for mycobacteria strain, its step is as follows:
(1) design and synthesis of primer and probe
Design five double-taggings with nucleic acid modification and dual specific probe, the oligonucleotide sequence table of described probe is as following table 1:
Table 1
Wherein, described FAM: a kind of fluorophor, excitation wavelength 495nm, wavelength of transmitted light 521nm; BHQ1dT: the thymine deoxyribotide that marked quenching group BHQ1; PO4: represent phosphorylation modification; HEX: a kind of fluorophor, excitation wavelength 535nm, wavelength of transmitted light 556nm; BHQ2dT: the thymine deoxyribotide that marked quenching group BHQ2; ROX: be a kind of fluorophor, excitation wavelength 575nm, wavelength of transmitted light 602nm; "
=" represent that this position is the non-natural Nucleotide that lock nucleic acid (LNA) is modified; Central marker is expressed as with " // "; " _ _ _ _ _ " be expressed as the Nucleotide of non-binding protruding part;
Design of primers: probe comprises 3 regions: hold strand target nucleic acid sequence combining site as the 1st region with 5 ' of target nucleic acid sequence complementation; Hold strand target nucleic acid sequence combining site as the 2nd region with 3 ' of target nucleic acid sequence complementation; Hold the non-binding protruding part of holding combining site to be connected with 3 ' as the 3rd region with 5 ';
1st zone design upstream primer primer1 and downstream primer primer2; 2nd zone design upstream primer primer3 and downstream primer primer4; 3rd zone design upstream primer primer5 and downstream primer primer6, the nucleotides sequence list of described primer is as shown in table 2 below;
Table 2
| Sequence numbering | Sequence names | Nucleotide sequence |
| SEQ ID NO.6 | Primer1 | CTCGAGTGGCGAACGGGTGAGTAA |
| SEQ ID NO.7 | Primer2 | TACCCCACCAACAAGCTGATAG |
| SEQ ID NO.8 | Primer3 | GGTCAACTCGGAGGAAGGTGG |
| SEQ ID NO.9 | Primer4 | GACCCCGATCCGAACTGAGACCG |
| SEQ ID NO.10 | Primer5 | ATATTGCACAATGGGCGCAAGCCTGATG |
| SEQ ID NO.11 | Primer6 | CGGACAACGCTCGCACCCTACGTAT |
1st Area Probe probe1, probe2; 2nd Area Probe probe3, probe4; 3rd Area Probe probe5; Upstream primer, downstream primer and probe all entrust specialized company to synthesize, and upstream primer and downstream primer are PAGE purifying, and probe is HPLC purifying;
(2), PCR reactive component
PCR reaction is divided into A, B two group reaction component, and primer and the probe of A group reaction comprise: primer1, primer2, probe1, probe2; Primer and the probe of B group reaction comprise: primer3, primer4, primer5, primer6, probe3, probe4, probe5; A group PCR reaction solution formulation components is as shown in table 3 below; B group PCR reaction solution formulation components is as shown in table 4 below;
Table 3
Table 4
(3), pcr amplification
Add in clean centrifuge tube by each component in table 3 in step (2) and table 4 successively, whirlpool mixes, centrifugal; Then being divided by reaction solution is filled in PCR pipe;
Add in different PCR pipe by the template DNA extracted and positive reference substance, blank product, mixing, after centrifugal, be placed in PCR instrument by pre-detection PCR pipe, arrange response procedures: 95 DEG C of denaturations 1 minute; 95 DEG C of sex change 6 seconds, 58 DEG C of annealing 30 seconds, 72 DEG C extend 10 seconds, totally 50 circulations; 95 DEG C of sex change 30 seconds, 40 DEG C of annealing 1 minute, melting curve (Meltingcurve) sets: 40 ~ 85 DEG C, each step raises 1 DEG C, each temperature maintains 30s, collects fluorescence in each temperature, arranges the sense channel collecting FAM, HEX, ROX fluorescent signal;
(4), melting curve analysis
When quantitative real time PCR Instrument end of run, its software kit is used to carry out melting curve analysis to this test-results, rear generation melts spectrum, there is notable difference at the melting peak that the target nucleic acid sequence of target nucleic acid sequence and various mutations difference and probe are formed, distinguish the classification of target nucleic acid sequence and various mutations difference target nucleic acid sequence, identify mycobacterium bacterium with this.
12 kinds of common mycobacteriums with nucleic acid modified double-tagging and dual specific probe identification are selected from mycobacterium tuberculosis (M.tuberculosis), mycobacterium kansasii (M.kansasii), Mycobacterium scrofulaceum (M.scrofulaceum), Mycobacterium marinum (M.marmum), mycobacterium buruli (M.ulcerans), Mycobacterium intracellulare (M.intracellulare), mycobacterium avium (M.avium), M. smegmatics (M.smegmatis), mycobacterium fortuitum (M.fortuitum), Mycobacterium chelonei tortoise subspecies (M.chelonaesubsp.chelonae), Mycobacterium chelonei abscess subspecies (M.chelonaesubsp.abscessus), the combination of one or two or more kinds in mycobacterium xenopi (M.xenopi).
Non-binding protruding part in the middle of probe of the present invention is divided into two independent positions 5 ' of probe end and 3 ' end strand target nucleic acid sequence combining site and is combined with target nucleic acid sequence specific hybrid respectively, adds the dual specific that probe is combined with target nucleic acid sequence simultaneously, when probe 5 ' hold with the target nucleic acid sequence of mutation differences in conjunction with time, due to 5 ' end strand target nucleic acid sequence combining site can not be stable with target nucleic acid sequence combination, make Tm value hold 3 ' end strand target nucleic acid sequence combining site of strand target nucleic acid sequence combining site and target nucleic acid sequence to hybridize the possibility combined lower than probe 5 ' to reduce, modify the nucleic acid sequences of mutation differences with LNA simultaneously, reduce further the stability that probe is combined with the target nucleic acid sequence of mutation differences, after carrying out melting curve analysis, there is notable difference at the melting peak that the target nucleic acid sequence of target nucleic acid sequence and various mutations difference and probe are formed, be conducive to the classification distinguishing target nucleic acid sequence and multiple mutation differences target nucleic acid sequence.
Its middle probe Probe1 effectively can differentiate mycobacterium tuberculosis, Mycobacterium marinum/mycobacterium buruli, Mycobacterium intracellulare/mycobacterium avium/mycobacterium fortuitum, Mycobacterium scrofulaceum/mycobacterium kansasii, M. smegmatics/Mycobacterium chelonei/mycobacterium abscessus/mycobacterium xenopi; Probe Probe2 effectively can differentiate Mycobacterium intracellulare, mycobacterium avium/mycobacterium xenopi, mycobacterium fortuitum/M. smegmatics, Mycobacterium chelonei/mycobacterium abscessus; Probe Probe3 can effectively differentiate Mycobacterium marinum, mycobacterium buruli; Probe Probe4 can effectively differentiate Mycobacterium chelonei, mycobacterium abscessus; Probe Probe5 can effectively differentiate Mycobacterium scrofulaceum, mycobacterium kansasii.
The "/" used when representing strain identification result in the present invention represents the meaning of "or", such as " Mycobacterium marinum/mycobacterium buruli " represents that the bacterial strain of qualification gets rid of Mycobacterium marinum outside other bacterial strain or mycobacterium buruli, needs this bacterial strain of qualification to be further Mycobacterium marinum or mycobacterium buruli.
In addition due to the dual specific of probe of the present invention, on it, described 5 probes not only can identify above 12 kinds of mycobacteria strains, in same pipe PCR reacts, effectively can also identify two or more mixing mycobacteria strain in 12 kinds of mycobacteriums simultaneously, when there is two or more mixing mycobacterium in a reaction, in the melting spectrum that this probe produces after melting curve analysis, have two melting peaks or multiple melting peak.
The present invention utilizes fluorescent PCR and melting curve analysis technology platform, apply the clinical common 12 kinds of mycobacteria strains of probe in detecting of novel double-tagging and the dual specific modified with nucleic acid innovatively, the difference achieving the Tm value between each bacterial classification at least in a sense channel is more than or equal to 4 DEG C, therefore can identify the simultaneous composite bacteria of two or more bacterium accurately and effectively.
Below by the drawings and specific embodiments, the present invention will be further described, but and do not mean that limiting the scope of the invention.
Accompanying drawing explanation
Fig. 1 detects for the identification of the probe Probe1 of mycobacteria strain the melting curve analysis figure that 12 kinds of common mycobacteriums produce for the present invention in FAM passage.
Fig. 2 detects for the identification of the probe Probe2 of mycobacteria strain the melting curve analysis figure that 12 kinds of common mycobacteriums produce for the present invention in HEX passage.
Fig. 3 detects for the identification of the probe Probe3 of mycobacteria strain the melting curve analysis figure that 12 kinds of common mycobacteriums produce for the present invention in FAM passage.
Fig. 4 detects for the identification of the probe Probe4 of mycobacteria strain the melting curve analysis figure that 12 kinds of common mycobacteriums produce for the present invention in HEX passage.
Fig. 5 detects for the identification of the probe Probe5 of mycobacteria strain the melting curve analysis figure that 12 kinds of common mycobacteriums produce for the present invention in ROX passage.
Fig. 6 detects for the identification of the probe Probe1 of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for the present invention in FAM passage.
Fig. 7 detects for the identification of the probe Probe2 of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for the present invention in HEX passage.
Fig. 8 detects for the identification of the probe Probe3 of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for the present invention in FAM passage.
Fig. 9 detects for the identification of the probe Probe5 of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for the present invention in ROX passage.
Figure 10 detects for the identification of TBProbe1 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for patent of invention CN102634575B in FAM passage.
Figure 11 detects for the identification of TBProbe2 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for patent of invention CN102634575B in HEX passage.
Figure 12 detects for the identification of TBProbe4 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for patent of invention CN102634575B in FAM passage.
Figure 13 detects for the identification of TBProbe5 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for patent of invention CN102634575B in ROX passage.
Embodiment
Embodiment 1:
For the identification of a method for mycobacteria strain, its step is as follows:
1, the design and synthesis of primer and probe
The 16SrRNA gene order of the present inventor to common 12 kinds of mycobacteriums has carried out compare of analysis, the genus specificity corresponding to 12 kinds of mycobacteriums and species specificity Variable Area are found: between 55-251 base of the 1st Variable Area (the 1st region) sequence X 55588.1 in ncbi database, 2nd Variable Area (the 2nd region) is between 366-539 base, 3rd Variable Area (the 3rd region) is between 1110-1314 base, although disclose three specific probes in patent CN102634575B, but these three specific probes are common double label probe, between part bacterial classification, Tm value difference is different less, be applicable to the single culture qualification of separation and Culture, and exist two or more bacterium simultaneously, then cannot differentiate.
For the problems referred to above, the present inventor after further research, by the cooperation of particular probe and primer, can realize discriminating when two or more bacterium exist.
According to 12 kinds of mycobacteriums in each Variable Area species specificity, design five double-taggings with nucleic acid modification and dual specific probe, and to each Variable Area design Species specific probes:
Probe comprises 3 regions: hold strand target nucleic acid sequence combining site as the 1st region with 5 ' of target nucleic acid sequence complementation; Hold strand target nucleic acid sequence combining site as the 2nd region with 3 ' of target nucleic acid sequence complementation; Hold the non-binding protruding part of holding combining site to be connected with 3 ' as the 3rd region with 5 ';
Nucleic acid is modified to lock nucleic acid (Lockednucleicacid, LNA) and modifies, and LNA modifies the nucleic acid sequences that there is mutation differences in probe the 1st region with target nucleic acid sequence.
The length in probe the 1st region is longer than the 2nd region, and the length in the 1st region can be 15-60 Nucleotide, can be maybe 15-40 Nucleotide, can be still 15-30 Nucleotide.
Probe the 2nd zone length can be 3-15 Nucleotide, can be maybe 3-13 Nucleotide, can be still 4-12 Nucleotide, can be more 5-11 Nucleotide, preferably not more than 15 Nucleotide.
Probe the 3rd zone length can be 3-10 Nucleotide, can be maybe 3-8 Nucleotide, can be still 4-7 Nucleotide, can be more 4-5 Nucleotide.
The length in the 1st region is 15-60 Nucleotide; The length in described 2nd region is 3-15 Nucleotide; The length in described 3rd region is 3-10 Nucleotide.
The Tm value scope in probe the 1st region can be 40 DEG C-80 DEG C, can be maybe 45 DEG C-70 DEG C; The Tm value scope in the 2nd region can be 6 DEG C-40 DEG C, can be maybe 10 DEG C-40 DEG C; The Tm value scope in the 3rd region can be 2 DEG C-15 DEG C.
Described in probe, the Tm value in the 1st region is 40 DEG C-80 DEG C; The Tm value in described 2nd region is 6 DEG C-40 DEG C; The Tm value in described 3rd region is 2-15 DEG C.
Probe also comprises a fluorophor and a non-fluorescence quencher, and fluorophor is marked at the described 1st region 5 ' end of described probe or described 2nd region 3 ' end, and non-fluorescence quencher is marked on the nucleotide residue of the 1st intra-zone of probe.
Between fluorophor and non-fluorescence quencher, interval is no more than 25 Nucleotide, or is no more than 18 Nucleotide.
Distance between fluorophor and non-fluorescence quencher can be 8-20 Nucleotide, also can be 10-17 Nucleotide, also can be 10-15 Nucleotide.
The nucleotides sequence column number of probe is selected from the group of SEQIDNO.1-5 and combination composition thereof.
Probe is 5 probes, respectively: Probe1, Probe2, Probe3, Probe4, Probe5.
1st region is probe probe1, probe2; 2nd region is probe probe3, probe4; 3rd region is probe probe5.
Article 5,5 ' end of probe all marks with fluorophor, non-fluorescence quencher is marked on the nucleotide residue of probe the 1st intra-zone, and described nucleotide sequence is respectively as shown in SEQIDNO.1, SEQIDNO.2, SEQIDNO.3, SEQIDNO.4, SEQIDNO.5.
Mycobacterium is selected from the combination of one or two or more kinds in mycobacterium tuberculosis, mycobacterium kansasii, Mycobacterium scrofulaceum, Mycobacterium marinum, mycobacterium buruli, Mycobacterium intracellulare, mycobacterium avium, M. smegmatics, mycobacterium fortuitum, Mycobacterium chelonei tortoise subspecies, Mycobacterium chelonei abscess subspecies, mycobacterium xenopi.
The oligonucleotide sequence of the amplimer that probe is corresponding is numbered SEQIDNO.6, SEQIDNO.7, SEQIDNO.8, SEQIDNO.9, SEQIDNO.10, SEQIDNO.11.
Because probe is made up of 3 regions, under certain conditions, determine probe the 1st region and the 2nd region to be combined with the dual specific of target nucleic acid sequence; When the target nucleic acid sequence with mutation differences is hybridized, with the formation double-strand that probe the 1st region of LNA modification can not be stable with the target nucleic acid sequence of mutation differences, reduce the possibility that probe the 2nd region is combined with target nucleic acid sequence, the melting spectrum of carrying out melting curve analysis generation can effectively be differentiated the multiple non-target nucleic acid classification of target nucleic acid and mutation differences to be conducive to the diagnosis of clinical polygenic mutation and strain identification etc.
At each zone design upstream and downstream primer: the 1st zone design upstream primer primer1 and downstream primer primer2; 2nd zone design upstream primer primer3 and downstream primer primer4; 3rd zone design upstream primer primer5 and downstream primer primer6.
1st Area Probe probe1, probe2; 2nd Area Probe probe3, probe4; 3rd Area Probe probe5.Primer and probe all entrust specialized company to synthesize, and primer is PAGE purifying, and probe is HPLC purifying.
The oligonucleotide sequence of described primer and probe is as following table 5:
Table 5
Note: FAM is a kind of fluorophor, excitation wavelength 495nm, wavelength of transmitted light 521nm; BHQ1dT is the thymine deoxyribotide that marked quenching group BHQ1; PO4 represents phosphorylation modification; HEX is a kind of fluorophor, excitation wavelength 535nm, wavelength of transmitted light 556nm; BHQ2dT is the thymine deoxyribotide that marked quenching group BHQ2; ROX is a kind of fluorophor, excitation wavelength 575nm, wavelength of transmitted light 602nm; "
=" represent that this position is the non-natural Nucleotide that lock nucleic acid (LNA) is modified; " // " is expressed as central marker; " _ _ _ _ _ _ _ " be expressed as the Nucleotide of non-binding protruding part.
2, PCR reactive component
PCR reaction is divided into A, B two group reaction, and primer and the probe of A group reaction comprise: primer1, primer2, probe1, probe2; Primer and the probe of B group reaction comprise: primer3, primer4, primer5, primer6, probe3, probe4, probe5.
First the stoichiometric number (N) of needs is calculated: N=n+2+1, wherein " n " is the template DNA number needing to detect, " 2 " refer to two control reaction (positive control and blank), " 1 " is the reaction additionally added, and object is for avoiding loss in point process of assembling to cause reaction solution not enough.
A group PCR reaction solution formulation components is as shown in table 6; B group PCR reaction solution formulation components is as shown in table 7.
The volume number of often kind of component in table 6, table 7 is multiplied by N, obtains the volume of often kind of required component.According to calculating the volume obtained, each component added successively in clean 1.5ml centrifuge tube, whirlpool mixes, centrifugal.Then being divided by reaction solution is filled in PCR pipe, often pipe 18 μ L.
The template DNA extracted and positive reference substance, blank product are respectively got 2 μ L and added in different PCR pipe, mixing, centrifugal rear upper machine amplification.
In the present embodiment, template used DNA comprises mycobacterium tuberculosis (M.tuberculosis), mycobacterium kansasii (M.kansasii), Mycobacterium scrofulaceum (M.scrofulaceum), Mycobacterium marinum (M.marmum), mycobacterium buruli (M.ulcerans), Mycobacterium intracellulare (M.intracellulare), mycobacterium avium (M.avium), M. smegmatics (M.smegmatis), mycobacterium fortuitum (M.fortuitum), Mycobacterium chelonei tortoise subspecies (M.chelonaesubsp.chelonae), Mycobacterium chelonei abscess subspecies (M.chelonaesubsp.abscessus), mycobacterium xenopi (M.xenopi) and colibacillary genomic dna.All template DNAs are the Clinical isolation after cultivation, and after deactivation, the bacterial genomes DNA extraction kit of commodity in use is extracted and obtained.
Table 6
Table 7
3, pcr amplification reaction
Arrange FAM, HEX, ROX tri-fluorescence detection channel by routine techniques, pre-detection PCR pipe be placed in PCR instrument and start pcr amplification, response procedures is as following table 8.
Table 8
Add in clean centrifuge tube by component each in table 3 in step 2 and table 4 successively, whirlpool mixes, centrifugal; Then being divided by reaction solution is filled in PCR pipe;
Add in different PCR pipe by the template DNA extracted and positive reference substance, blank product, mixing, after centrifugal, be placed in PCR instrument by pre-detection PCR pipe, arrange response procedures: 95 DEG C of denaturations 1 minute; 95 DEG C of sex change 6 seconds, 58 DEG C of annealing 30 seconds, 72 DEG C extend 10 seconds, totally 50 circulations; 95 DEG C of sex change 30 seconds, 40 DEG C of annealing 1 minute, melting curve (Meltingcurve) sets: 40 ~ 85 DEG C, each step raises 1 DEG C, each temperature maintains 30s, collects fluorescence in each temperature, arranges the sense channel collecting FAM, HEX, ROX fluorescent signal;
4, melting curve analysis
When quantitative real time PCR Instrument end of run, use its software kit to carry out melting curve analysis to this test-results, melting curve is shown in that accompanying drawing 1-6: Fig. 1 detects for the identification of Probe1 in the probe of mycobacteria strain the melting curve analysis figure that 12 kinds of common mycobacteriums produce for the present invention in FAM passage.Fig. 2 detects for the identification of Probe2 in the probe of mycobacteria strain the melting curve analysis figure that 12 kinds of common mycobacteriums produce for the present invention in HEX passage.Fig. 3 detects for the identification of Probe3 in the probe of mycobacteria strain the melting curve analysis figure that 12 kinds of common mycobacteriums produce for the present invention in FAM passage.Fig. 4 detects for the identification of Probe4 in the probe of mycobacteria strain the melting curve analysis figure that 12 kinds of common mycobacteriums produce for the present invention in HEX passage.Fig. 5 detects for the identification of Probe5 in the probe of mycobacteria strain the melting curve analysis figure that 12 kinds of common mycobacteriums produce for the present invention in ROX passage.Fig. 6 detects for the identification of Probe1 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for the present invention in FAM passage.
Obvious melting peak has all been there is from Fig. 1-6,12 kinds of mycobacteriums; (not shown) is there is in negative control and blank without obviously melting peak.And in the detected result of any two kinds of mycobacteriums, at least in a sense channel, difference Δ Tm >=4 DEG C of Tm value (the 9:12 kind that sees the following form mycobacteria strain produces the Tm value (DEG C) melting spectrum).What wherein Δ Tm was minimum is mycobacterium avium and Mycobacterium intracellulare, and these two kinds of bacterium are Tm value difference 4 DEG C in Probe2 only, and all the other sense channels are all identical.
Table 9
Embodiment 2:
1, compound strain detects
In recent years in skin soft-tissue infection, Skeletal system infection and 50%AIDS (acquired immune deficiency syndrome (AIDS)) become celestial patient, find that in bird-born of the same parents, compound group infects, feature according to probe of the present invention differs greatly to the melting spectrum Tm value that two nucleotide sequence difference sites produce, therefore for the infection sample of two kinds of mycobacterium compound groups, bimodal can be there is, the melting peak value that namely two kinds of bacterial strains are corresponding in the melting spectrum of same tube reaction.
For verifying the identification capacity of probe of the present invention to compound strain, mycobacterium avium and Mycobacterium intracellulare mix by different ratios by the present inventor, obtain 5 mixed bacterium samples such as 95%M.avium-5%M.intracellulare, 75%M.avium-25%M.intracellulare, 50%M.avium-50%M.intracellulare, 25%M.avium-75%M.intracellulare and 5%M.avium-95%M.intracellulare respectively.Extract the nucleic acid of 5 mixed bacterium samples respectively, adopt primed probe of the present invention to detect, the results are shown in accompanying drawing: 7-9: Fig. 7 detects for the identification of Probe2 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for the present invention in HEX passage.Fig. 8 detects for the identification of Probe3 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for the present invention in FAM passage.Fig. 9 detects for the identification of Probe5 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for the present invention in ROX passage.
From result, in the sense channel of probe Probe2, when the ratio of a kind of bacterium is more than or equal to 25%, can detect that two kinds of bacterium feature separately melts peak, thus this sample of interpretation is the mixed bacterium of mycobacterium avium and Mycobacterium intracellulare.
2, contrast experiment
Do identical compound strain with primed probe disclosed in patent of invention CN102634575B to detect: mycobacterium avium and Mycobacterium intracellulare are mixed by different ratios, obtains 5 mixed bacterium samples such as 95%M.avium-5%M.intracellulare, 75%M.avium-25%M.intracellulare, 50%M.avium-50%M.intracellulare, 25%M.avium-75%M.intracellulare and 5%M.avium-95%M.intracellulare respectively.Extract the nucleic acid of 5 mixed bacterium samples respectively, adopt primed probe described in CN102634575B to detect, the results are shown in accompanying drawing 10-13.Figure 10 detects for the identification of TBProbe1 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for patent of invention CN102634575B in FAM passage.Figure 11 detects for the identification of TBProbe2 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for patent of invention CN102634575B in HEX passage.Figure 12 detects for the identification of TBProbe4 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for patent of invention CN102634575B in FAM passage.Figure 13 detects for the identification of TBProbe5 in the probe of mycobacteria strain the melting curve analysis figure that the mycobacterium avium of different ratios and Mycobacterium intracellulare mixed bacterium produce for patent of invention CN102634575B in ROX passage.
As can be known from the results, when doing identical compound strain detection with primed probe disclosed in patent of invention CN102634575B, probe probe3 and probe6 is all without melting peak, probe probe1, probe2, probe4 are identical or close with the Tm value of Mycobacterium intracellulare to mycobacterium avium with probe5, causing being and melt peak separately, cannot interpretation sample be compound strain.
The present invention holds the Bispecific Hybrid of combining site and target nucleic acid sequence with nucleic acid modified 5 ' end and 3 ', hybridize to produce with different strain mycobacterium target nucleic acid sequence and melt peak (Tm value) in a big way and change, qualification single culture that therefore can be quick, accurate, sensitive and the simultaneous composite bacteria sample of two or more mycobacteria strains.
Claims (8)
1. the test kit for the identification of mycobacteria strain, wherein identification reagent comprises three pairs of primers and five probes, and described primer comprises upstream primer primer1, downstream primer primer2, upstream primer primer3, downstream primer primer4, upstream primer primer5 and downstream primer primer6; The nucleotide sequence of primer primer1, primer2, primer3, primer4, primer5 and primer6 is respectively as shown in SEQIDNO.6, SEQIDNO.7, SEQIDNO.8, SEQIDNO.9, SEQIDNO.10, SEQIDNO.11; Described probe comprises 3 regions: hold strand target nucleic acid sequence combining site as the 1st region with 5 ' of described target nucleic acid sequence complementation; Hold strand target nucleic acid sequence combining site as the 2nd region with 3 ' of described target nucleic acid sequence complementation; Hold the non-binding protruding part of holding combining site to be connected with described 3 ' as the 3rd region with described 5 '; Described five probes are respectively Probe1, Probe2, Probe3, Probe4 and Probe5; Its nucleotide sequence is respectively as shown in SEQIDNO.1, SEQIDNO.2, SEQIDNO.3, SEQIDNO.4, SEQIDNO.5.
2. the test kit for the identification of mycobacteria strain according to claim 1, it is characterized in that: described probe be with nucleic acid modify double-tagging and dual specific probe, nucleic acid is modified to lock nucleic acid and modifies, and modifies the nucleic acid sequences that there is mutation differences in described probe the 1st region with target nucleic acid sequence.
3. the test kit for the identification of mycobacteria strain according to claim 2, it is characterized in that: described probe also comprises a fluorophor and a non-fluorescence quencher, fluorophor is marked at the described 1st region 5 ' end of described probe or described 2nd region 3 ' end, and non-fluorescence quencher is marked on the nucleotide residue of the 1st intra-zone of probe.
4. the test kit for the identification of mycobacteria strain according to claim 3, is characterized in that: described fluorophor is selected from HEX and/or ROX.
5. the test kit for the identification of mycobacteria strain according to claim 1, is characterized in that: described non-fluorescence quencher is selected from BHQ1 and/or BHQ2.
6. the test kit for the identification of mycobacteria strain according to claim 1, is characterized in that: described mycobacterium is selected from the combination of more than two kinds in mycobacterium tuberculosis, mycobacterium kansasii, Mycobacterium scrofulaceum, Mycobacterium marinum, mycobacterium buruli, Mycobacterium intracellulare, mycobacterium avium, M. smegmatics, mycobacterium fortuitum, Mycobacterium chelonei tortoise subspecies, Mycobacterium chelonei abscess subspecies, mycobacterium xenopi.
7. the test kit for the identification of mycobacteria strain described in any one of claim 1-6 is for the preparation of the application in the product of identification of mycobacterium.
8. the method for the identification of mycobacteria strain described in any one of claim 1-6, its step is as follows:
(2) design and synthesis of primer and probe
Design five double-taggings with nucleic acid modification and dual specific probe, the oligonucleotide sequence of described probe
Be listed as follows table 1:
Table 1
Wherein, described FAM: a kind of fluorophor, excitation wavelength 495nm, wavelength of transmitted light 521nm; BHQ1dT: the thymine deoxyribotide that marked quenching group BHQ1; PO4: represent phosphorylation modification; HEX: a kind of fluorophor, excitation wavelength 535nm, wavelength of transmitted light 556nm; BHQ2dT: the thymine deoxyribotide that marked quenching group BHQ2; ROX: be a kind of fluorophor, excitation wavelength 575nm, wavelength of transmitted light 602nm;
represent that this position is the non-natural Nucleotide that lock nucleic acid (LNA) is modified; Central marker is expressed as with " // "; " _ _ _ _ " be expressed as the Nucleotide of non-binding protruding part;
Design of primers: probe comprises 3 regions: hold strand target nucleic acid sequence combining site as the 1st region with 5 ' of target nucleic acid sequence complementation; Hold strand target nucleic acid sequence combining site as the 2nd region with 3 ' of target nucleic acid sequence complementation; Hold the non-binding protruding part of holding combining site to be connected with 3 ' as the 3rd region with 5 ';
1st zone design upstream primer primer1 and downstream primer primer2; 2nd zone design upstream primer primer3 and downstream primer primer4; 3rd zone design upstream primer primer5 and downstream primer primer6, the nucleotides sequence list of described primer is as shown in table 2 below;
Table 2
1st Area Probe probe1, probe2; 2nd Area Probe probe3, probe4; 3rd Area Probe probe5; Upstream primer, downstream primer and probe all entrust specialized company to synthesize, and upstream primer and downstream primer are PAGE purifying, and probe is HPLC purifying;
(2), PCR reactive component
PCR reaction is divided into A, B two group reaction component, and primer and the probe of A group reaction comprise: primer1, primer2, probe1, probe2; Primer and the probe of B group reaction comprise: primer3, primer4, primer5, primer6, probe3, probe4, probe5; A group PCR reaction solution formulation components is as shown in table 3 below; B group PCR reaction solution formulation components is as shown in table 4 below;
Table 3
Table 4
(3), pcr amplification
Add in clean centrifuge tube by each component in table 3 in step (2) and table 4 successively, whirlpool mixes, centrifugal; Then being divided by reaction solution is filled in PCR pipe;
Add in different PCR pipe by the template DNA extracted and positive reference substance, blank product, mixing, after centrifugal, be placed in PCR instrument by pre-detection PCR pipe, arrange response procedures: 95 DEG C of denaturations 1 minute; 95 DEG C of sex change 6 seconds, 58 DEG C of annealing 30 seconds, 72 DEG C extend 10 seconds, totally 50 circulations; 95 DEG C of sex change 30 seconds, 40 DEG C of annealing 1 minute, melting curve (Meltingcurve) sets: 40 ~ 85 DEG C, each step raises 1 DEG C, each temperature maintains 30s, collects fluorescence in each temperature, arranges the sense channel collecting FAM, HEX, ROX fluorescent signal;
(4), melting curve analysis
When quantitative real time PCR Instrument end of run, its software kit is used to carry out melting curve analysis to this test-results, rear generation melts spectrum, there is notable difference at the melting peak that the target nucleic acid sequence of target nucleic acid sequence and various mutations difference and probe are formed, distinguish the classification of target nucleic acid sequence and various mutations difference target nucleic acid sequence, identify mycobacterium bacterium with this.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510812703.9A CN105368943B (en) | 2015-11-21 | 2015-11-21 | A kind of kit and method for identification of mycobacterium strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510812703.9A CN105368943B (en) | 2015-11-21 | 2015-11-21 | A kind of kit and method for identification of mycobacterium strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105368943A true CN105368943A (en) | 2016-03-02 |
| CN105368943B CN105368943B (en) | 2018-10-16 |
Family
ID=55371569
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510812703.9A Active CN105368943B (en) | 2015-11-21 | 2015-11-21 | A kind of kit and method for identification of mycobacterium strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105368943B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119363A (en) * | 2016-07-01 | 2016-11-16 | 中国人民解放军第三〇九医院 | SNP combination, detection method and test kit for the detection of antituberculotics hepatic injury susceptible genotype |
| CN106834520A (en) * | 2017-03-27 | 2017-06-13 | 杭州迪安生物技术有限公司 | A kind of kit of utilization molecular beacon melting curve technical appraisement bacterium and its application |
| CN106868171A (en) * | 2017-03-27 | 2017-06-20 | 温州迪安医学检验所有限公司 | A kind of kit of clinical common causative bacterium of RNA constant-temperature amplifications melting curve method detection and its application |
| CN110872614A (en) * | 2019-12-05 | 2020-03-10 | 深圳市第三人民医院 | Cas12 a/gRNA-based method for rapidly identifying mycobacteria |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011027966A2 (en) * | 2009-09-03 | 2011-03-10 | Seegene, Inc. | Td probe and its uses |
| KR20110050327A (en) * | 2009-11-07 | 2011-05-13 | 주식회사 씨젠 | T h d primer target detection |
| CN102634575B (en) * | 2012-03-26 | 2014-04-02 | 中国人民解放军第三O九医院 | Rapid identification method and kit of novel mycobacterium strain |
| GB201317355D0 (en) * | 2013-10-01 | 2013-11-13 | Epistem Ltd | Mutation Analysis |
-
2015
- 2015-11-21 CN CN201510812703.9A patent/CN105368943B/en active Active
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119363A (en) * | 2016-07-01 | 2016-11-16 | 中国人民解放军第三〇九医院 | SNP combination, detection method and test kit for the detection of antituberculotics hepatic injury susceptible genotype |
| CN106119363B (en) * | 2016-07-01 | 2019-12-03 | 中国人民解放军第三〇九医院 | SNP combination, detection method and kit for the detection of antituberculotic hepatic injury susceptible genotype |
| CN106834520A (en) * | 2017-03-27 | 2017-06-13 | 杭州迪安生物技术有限公司 | A kind of kit of utilization molecular beacon melting curve technical appraisement bacterium and its application |
| CN106868171A (en) * | 2017-03-27 | 2017-06-20 | 温州迪安医学检验所有限公司 | A kind of kit of clinical common causative bacterium of RNA constant-temperature amplifications melting curve method detection and its application |
| CN106834520B (en) * | 2017-03-27 | 2020-12-18 | 杭州迪安生物技术有限公司 | Kit for identifying bacteria by using molecular beacon-melting curve technology and application thereof |
| CN110872614A (en) * | 2019-12-05 | 2020-03-10 | 深圳市第三人民医院 | Cas12 a/gRNA-based method for rapidly identifying mycobacteria |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105368943B (en) | 2018-10-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Neonakis et al. | Molecular diagnostic tools in mycobacteriology | |
| CN102634575B (en) | Rapid identification method and kit of novel mycobacterium strain | |
| CN106399517B (en) | Nucleic acid detection technology combining multi-cross constant-temperature amplification with gold nano biosensing | |
| CA2442936A1 (en) | New method for genotype determination | |
| CN102618625B (en) | Method and kit for detecting drug resistance of mycobacterium tuberculosis | |
| CA2793660A1 (en) | Methods, kits and compositions for detection of mrsa | |
| CN102229989B (en) | Method and kit for detecting ethambutol resistance mutation of Mycobacterium tuberculosis | |
| CN105368943B (en) | A kind of kit and method for identification of mycobacterium strain | |
| Somogyvari et al. | Detection of invasive fungal pathogens by real-time PCR and high-resolution melting analysis | |
| CN111004862B (en) | Primer and probe for rapidly detecting and identifying cryptococcus and application thereof | |
| CN116042777A (en) | Primer combination for detecting mycobacterium tuberculosis complex by multi-cross amplification combined with biosensing and detection method | |
| CN113201594A (en) | Method for rapidly detecting food-borne Burkholderia gladioli | |
| Liu et al. | A universal biosensor for multiplex DNA detection based on hairpin probe assisted cascade signal amplification | |
| CN110079621B (en) | Oligonucleotide combination, method and kit for identifying mycobacterium species | |
| CN102286616A (en) | Method and kit for detecting mycobacterium tuberculosis isoniazide drug resistant gene mutation | |
| KR20190017698A (en) | Kit For Detecting Tuberculosis and Method of Detecting Tuberculosis Using the Same | |
| CN103045717A (en) | Method for detecting rifampin drug resistance of mycobacterium tuberculosis by using pyrosequencing technology | |
| CN106319079A (en) | Method for detecting 22q11.2 copy number deletion | |
| CN103045716B (en) | Method for detecting isoniazid drug resistance of mycobacterium tuberculosis by using pyrosequencing technology | |
| US20150031576A1 (en) | Real time pcr detection of m. tuberculosis resistant/susceptible to rifampicin and/or isoniazid | |
| CN108060244A (en) | A kind of nucleotide sequence and application for mycobacterium tuberculosis complex detection | |
| CN106755530A (en) | One kind detection HLA A*31:The MGB probe for real-time fluorescence PCR method and its primer combination of probe of 01 allele | |
| RU2455364C2 (en) | Method of identifying mycobacteria by polymerase chain reaction | |
| CN103757110A (en) | Vibrio cholera analysis typing kit | |
| KR101227204B1 (en) | Methods for identification and detection of mycobacterium tuberculosis complex and nontuberculous mycobacteria using duplex real time polymerase chain reaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |