CN105368943B - A kind of kit and method for identification of mycobacterium strain - Google Patents
A kind of kit and method for identification of mycobacterium strain Download PDFInfo
- Publication number
- CN105368943B CN105368943B CN201510812703.9A CN201510812703A CN105368943B CN 105368943 B CN105368943 B CN 105368943B CN 201510812703 A CN201510812703 A CN 201510812703A CN 105368943 B CN105368943 B CN 105368943B
- Authority
- CN
- China
- Prior art keywords
- mycobacterium
- probe
- nucleic acid
- primer
- target nucleic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of kits and method for identification of mycobacterium strain, and described method includes following steps：(1) the design synthesis of primer and probe；(2), PCR reactive components, (3), PCR amplification；(4), melting curve analysis.The present invention utilizes fluorescent PCR and melting curve analysis technology platform, the innovatively clinical common 12 kinds of mycobacteria strains of probe in detecting of novel double labelling and bispecific of the application with nucleic acid modification, the difference for realizing the Tm values between each strain at least in a sense channel is more than or equal to 4 DEG C, can accurately and effectively identify the simultaneous compound bacteria of two or more bacterium.
Description
Technical field
The present invention relates to a kind of kits and method for identification of mycobacterium strain, belong to Protocols in Molecular Biology neck
Domain.
Background technology
Polymerase chain reaction (PCR) technology is since 1985 come out, after decades of development, it has also become laboratory
Routine techniques.It is indispensable means in modern molecular biology research, is a kind of extremely sensitive amplification system.Phase
Than in traditional methods for clinical diagnosis, diagnostic nucleic acid is the diagnostic techniques on molecular level, can make up traditional clinical diagnosis side
Certain defects of method.Therefore, increasingly extensive answer is obtained in clinical diagnosis by the nucleic acid diagnostic techniques of representative of round pcr
With.
Compared with traditional PCR detection patterns, the PCR amplification in normal PCR detection pattern is mutually tied with detection in recent years
Close and (pcr amplification reaction and fluorescence labeling probe detection be combined together i.e. in the same closed container) testing goal nucleic acid
The fluorescent PCR method of inspection launch respectively.The fluorescent PCR method of inspection not only has the high sensitivity of regular-PCR, but also due to answering
With fluorescence probe Standard PCR is overcome so also having the high precision of the high specific and spectral technique of DNA hybridization
Many disadvantages do not need PCR post-processings, many drawbacks in Standard PCR operation are avoided, so as to quickly and dynamically
It detects pcr amplification product and is polluted caused by reducing external nucleic acid.
The fluorescent dye that fluorescence PCR detection reagent uses earliest includes：SYBR GREEN, EVE GREEN, dye method are most
Pipe is simple, but None- identified non-specific amplification, therefore is very restricted in practical applications.Nowadays mostly to be visited using fluorescence
Needle is basic method, such as Taqman probes, molecular beacon and fluorogenic hybridization probe etc., and fluorescence probe monitors PCR amplification in real time
The specificity of product improves the specificity of target sequence so as to avoid non-specific amplification.But probe as described above is general
Store-through is being inserted into or is lacking the limited disadvantage of recognition capability to single base mutation or polybase base.
The application of fluorescent PCR clinically is broadly divided into：The diagnosis of infectious diseases；The diagnosis of genetic disease；Tumour
Diagnosis；The diagnosis of mother-to-baby transmission and Forensic Identification etc..
The clinical visible mainly mycobacterium tuberculosis (MTB) that can cause human diseases, in addition there are Kansas, bird, born of the same parents
Interior, ape and monkey, toad, sea, ulcer, scrofula, Ma Ermo, Su Jia, accidental, tortoise, abscess etc. more than 10 plants non-tuberculous mycobacteria
(NTM).NTM diseases have systemic toxicity profiles symptom similar with tuberculosis clinical manifestation and local lesion, in no strain qualification result
In the case of, it is difficult to differentiate with tuberculosis.NTM and MTB drug susceptibilities differ widely, and many NTM Antituberculous Drugs are natural
Drug resistance, different NTM strains also differ drug susceptibility, and chemotherapy regimen should be different according to different strain, therefore, branch
Bacillus species are identified not only on epidemiology, but also in clinical diagnosis and are treated significant.
And method for identification of mycobacterium species traditional at present is multinomial according to biological phenotype feature and cytochemistry reaction
Index comprehensive is analyzed, and method is complicated, time-consuming, is badly in need of establishing quick, easy, accurate method for identification of mycobacterium species.In recent years
Come, with Molecular Biology and technology, the various molecular diagnostic techniques especially based on polymerase chain reaction (PCR)
Fast development, molecular diagnostic techniques mycobacteria strain identification in be able to research application.
At present have some based on round pcr mycobacteria strain identification method, as PCR- direct sequencings,
PCR-RFLP, PCR- gene chips etc., these method generally existings are complicated for operation, the shortcomings of easily causing cross contamination.
A kind of the present inventor's entitled " new mycobacteria strain rapid identification method disclosed in August in 2012 15 days
And kit " Chinese invention patent CN102634575B in disclose a kind of kit for identification of mycobacterium strain,
Including two pairs of primers and three probes, two pairs of primers include primer TBleft1, TBleft2, TBright1 and
TBright2, nucleotide sequence is respectively such as SEQ ID NO：1、SEQ ID NO：2、SEQ ID NO：3、SEQ ID NO：4 institutes
Show, 5 ' the end reporter fluorescence dye markers of described three probes TBProbe1, TBProbe2, TBProbe3,3 ' ends are with being quenched
Fluorochrome label, nucleotide sequence is respectively such as SEQ ID NO：13、SEQ ID NO：14、SEQ ID NO：Shown in 15.Through
Experiment is crossed, inventor has found, due to having only used common dual labelled probe, part strain in the method disclosed in this patent document
Between Tm value differences it is different smaller, be only applicable to the single culture being separately cultured identification, and the case where existed simultaneously to two or more bacterium,
Can not then it differentiate.
Therefore it provides a kind of kit that can accurately and effectively identify two or more mycobacteria strains and method are just
The technical barrier for being badly in need of solving as the technical field.
Invention content
An object of the present invention, which is to provide, a kind of can accurately and effectively identify two or more mycobacteria strains
Kit.
The purpose of foregoing invention of the present invention, reaches by the following technical programs：
A kind of kit for identification of mycobacterium strain, wherein identification reagent include three pairs of primers and five probes,
The primer include sense primer primer1, downstream primer primer2, sense primer primer3, downstream primer primer4,
Sense primer primer5 and downstream primer primer6；Primer primer1, primer2, primer3, primer4, primer5
With the nucleotide sequence of primer6 respectively as SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9,
Shown in SEQ ID NO.10, SEQ ID NO.11；The probe includes 3 regions：5 ' the ends complementary with the target nucleic acid sequence
Single-stranded target nucleic acid sequence binding site is as the 1st region；3 ' the end single-stranded target nucleic acid sequence knots complementary with the target nucleic acid sequence
Position is closed as the 2nd region；The non-binding protruding part being connected with the 5 ' end and 3 ' end binding site is as the 3rd area
Domain；Five probes are respectively Probe1, Probe2, Probe3, Probe4 and Probe5；Its nucleotide sequence is respectively such as
SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, shown in SEQ ID NO.5.
Preferably, the probe is modified to lock nucleic acid for the double labelling and bispecific probe, nucleic acid modified with nucleic acid
Modification, modifies in the 1st region of the probe that there are the nucleic acid sequences of mutation differences with target nucleic acid sequence.
Preferably, the probe further includes a fluorophor and a non-fluorescence quencher, and fluorophor label exists
5 ' the end of the 1st region of the probe or the 3 ' end of the 2nd region, non-fluorescence quencher label is the 1st of probe
On nucleotide residue inside region.
Preferably, the fluorophor is selected from HEX and/or ROX.
Preferably, the non-fluorescence quencher is selected from BHQ1 and/or BHQ2.
Preferably, the mycobacteria is selected from mycobacterium tuberculosis (M.tuberculosis), mycobacterium kansasii
(M.kansasii), Mycobacterium scrofulaceum (M.scrofulaceum), Mycobacterium marinum (M.marmum), mycobacterium buruli
(M.ulcerans), Mycobacterium intracellulare (M.intracellulare), mycobacterium avium (M.avium), mycobacterium smegmatis
(M.smegmatis), mycobacterium fortuitum (M.fortuitum), Mycobacterium chelonei tortoise subspecies (M.chelonae
Subsp.chelonae), Mycobacterium chelonei abscess subspecies (M.chelonae subsp.abscessus), mycobacterium xenopi
(M.xenopi) one or two or more kinds of combinations in.
Its middle probe Probe1 can effectively differentiate mycobacterium tuberculosis, Mycobacterium marinum/mycobacterium buruli, intracellular point
Branch bacillus/mycobacterium avium/mycobacterium fortuitum, Mycobacterium scrofulaceum/mycobacterium kansasii, mycobacterium smegmatis/tortoise point
Branch bacillus/mycobacterium abscessus/mycobacterium xenopi；Probe Probe2 can effectively differentiate Mycobacterium intracellulare, bird branch bar
Bacterium/mycobacterium xenopi, mycobacterium fortuitum/mycobacterium smegmatis, Mycobacterium chelonei/mycobacterium abscessus；Probe Probe3
It can effectively differentiate Mycobacterium marinum, mycobacterium buruli；Probe Probe4 can effectively differentiate Mycobacterium chelonei, abscess branch bar
Bacterium；Probe Probe5 can effectively differentiate Mycobacterium scrofulaceum, mycobacterium kansasii.
It is a further object of the present invention to provide a kind of mentioned reagent boxes in preparing the product for identification of mycobacterium
Using.
The purpose of foregoing invention of the present invention, reaches by the following technical programs：
Application of the above-mentioned kit for identification of mycobacterium strain in preparing the product for identification of mycobacterium.
Another object of the present invention, which is to provide, a kind of can accurately and effectively identify two or more mycobacteria strains
Method.
The purpose of foregoing invention of the present invention, reaches by the following technical programs：
A method of it being used for identification of mycobacterium strain, its step are as follows：
(1) the design synthesis of primer and probe
Design five double labellings and bispecific probe with nucleic acid modification, the oligonucleotide sequence table of the probe is such as
The following table 1：
Table 1
Wherein, the FAM：A kind of fluorophor, excitation wavelength 495nm, wavelength of transmitted light 521nm；BHQ1dT：Label
The thymine deoxyribotide of quenching group BHQ1；PO4：Indicate phosphorylation modification；HEX：A kind of fluorophor swashs
Emission wavelength 535nm, wavelength of transmitted light 556nm；BHQ2dT：The thymidine dezyribonucleoside of quenching group BHQ2 is marked
Acid；ROX：For a kind of fluorophor, excitation wavelength 575nm, wavelength of transmitted light 602nm；“=" indicate that the position is lock nucleic acid
(LNA) the non-natural nucleotide modified；It is expressed as central marker with " // "；" _ _ _ _ _ " it is expressed as the core of non-binding protruding part
Thuja acid；
Design of primers：Probe includes 3 regions：5 ' the end single-stranded target nucleic acid sequence binding sites complementary with target nucleic acid sequence
As the 1st region；3 ' the end single-stranded target nucleic acid sequence binding sites complementary with target nucleic acid sequence are as the 2nd region；With 5 ' end and
The non-binding protruding part that 3 ' end binding sites are connected is as the 3rd region；
Design sense primer primer1 and downstream primer primer2 in 1st region；Design sense primer in 2nd region
Primer3 and downstream primer primer4；Design sense primer primer5 and downstream primer primer6, the primer in 3rd region
Nucleotides sequence list it is as shown in table 2 below；
Table 2
| Sequence number | Sequence names | Nucleotide sequence |
| SEQ ID NO.6 | Primer1 | CTCGAGTGGCGAACGGGTGAGTAA |
| SEQ ID NO.7 | Primer2 | TACCCCACCAACAAGCTGATAG |
| SEQ ID NO.8 | Primer3 | GGTCAACTCGGAGGAAGGTGG |
| SEQ ID NO.9 | Primer4 | GACCCCGATCCGAACTGAGACCG |
| SEQ ID NO.10 | Primer5 | ATATTGCACAATGGGCGCAAGCCTGATG |
| SEQ ID NO.11 | Primer6 | CGGACAACGCTCGCACCCTACGTAT |
1st Area Probe probe1, probe2；2nd Area Probe probe3, probe4；3rd Area Probe probe5；
Sense primer, downstream primer and probe entrust specialized company to be synthesized, and sense primer and downstream primer purify for PAGE, visit
Needle purifies for HPLC；
(2), PCR reactive components
PCR reactions are divided into two groups of reactive components of A, B, and the primer and probe of A groups reaction includes：primer1、primer2、
probe1、probe2；B groups reaction primer and probe include：primer3、primer4、primer5、primer6、probe3、
probe4、probe5；A group PCR reaction solution formulation components are as shown in table 3 below；B group PCR reaction solutions formulation components such as the following table 4 institute
Show；
Table 3
Table 4
(3), PCR amplification
Each component in table 3 in step (2) and table 4 is added in clean centrifuge tube successively, whirlpool mixing, is centrifuged；Then
Reaction solution is dispensed into PCR pipe；
The template DNA extracted and positive reference substance, blank control product are added in different PCR pipes, mixing, are centrifuged
Afterwards, pre-detection PCR pipe is placed in PCR instrument, response procedures is set：95 DEG C of pre-degenerations 1 minute；95 DEG C are denaturalized 6 seconds, 58 DEG C of annealing 30
Second, 72 DEG C extend 10 seconds, and totally 50 recycle；95 DEG C are denaturalized 30 seconds, and 40 DEG C are annealed 1 minute, melting curve (Melting curve)
Setting：40~85 DEG C, each step increases 1 DEG C, and each temperature maintains 30s, in each temperature collection fluorescence, setting collect FAM,
The sense channel of HEX, ROX fluorescence signal；
(4), melting curve analysis
When fluorescence quantitative PCR instrument end of run, melting curve analysis is carried out to this test result using its software kit,
It generates afterwards and melts spectrum, it is obviously poor that target nucleic acid sequence and the melting peakss that probe is formed of target nucleic acid sequence and various mutations difference have
It is different, the classification of target nucleic acid sequence and various mutations difference target nucleic acid sequence is distinguished, mycobacterium bacterium is identified with this.
12 kinds of common mycobacterias with nucleic acid modified double labelling and bispecific probe identification are selected from tuberculosis point
Branch bacillus (M.tuberculosis), mycobacterium kansasii (M.kansasii), Mycobacterium scrofulaceum
(M.scrofulaceum), Mycobacterium marinum (M.marmum), mycobacterium buruli (M.ulcerans), Mycobacterium intracellulare
(M.intracellulare), mycobacterium avium (M.avium), mycobacterium smegmatis (M.smegmatis), mycobacterium fortuitum
(M.fortuitum), Mycobacterium chelonei tortoise subspecies (M.chelonae subsp.chelonae), Mycobacterium chelonei abscess subspecies
One or two or more kinds of combinations in (M.chelonae subsp.abscessus), mycobacterium xenopi (M.xenopi).
Non-binding protruding part among the probe of the present invention combines 5 ' ends of probe and 3 ' end single-stranded target nucleic acid sequences
Position is divided into two independent positions and is combined respectively with target nucleic acid sequence specific hybrid, while increasing probe and target nucleic acid sequence
In conjunction with bispecific；When the end of probe 5 ' is combined with the target nucleic acid sequence of mutation differences, due to 5 ' end single-stranded target nucleic acid sequences
Binding site cannot and target nucleic acid sequence stablize combination so that Tm values less than probe 5 ' hold single-stranded target nucleic acid sequence binding site
3 ' end single-stranded target nucleic acid sequence binding sites hybridize with target nucleic acid sequence combine possibilities reduce, while with LNA modification dash forward
The nucleic acid sequences for becoming difference, further reduced the stability that probe is combined with the target nucleic acid sequence of mutation differences, are melted
After tracing analysis, it is apparent poor that melting peakss that target nucleic acid sequence and the probe of target nucleic acid sequence and various mutations difference are formed have
It is different, be conducive to the classification for distinguishing target nucleic acid sequence and multiple mutation differences target nucleic acid sequences.
Its middle probe Probe1 can effectively differentiate mycobacterium tuberculosis, Mycobacterium marinum/mycobacterium buruli, intracellular point
Branch bacillus/mycobacterium avium/mycobacterium fortuitum, Mycobacterium scrofulaceum/mycobacterium kansasii, mycobacterium smegmatis/tortoise point
Branch bacillus/mycobacterium abscessus/mycobacterium xenopi；Probe Probe2 can effectively differentiate Mycobacterium intracellulare, bird branch bar
Bacterium/mycobacterium xenopi, mycobacterium fortuitum/mycobacterium smegmatis, Mycobacterium chelonei/mycobacterium abscessus；Probe Probe3
It can effectively differentiate Mycobacterium marinum, mycobacterium buruli；Probe Probe4 can effectively differentiate Mycobacterium chelonei, abscess branch bar
Bacterium；Probe Probe5 can effectively differentiate Mycobacterium scrofulaceum, mycobacterium kansasii.
The "/" used when indicating strain idenfication result in the present invention indicates the meaning of "or", such as " Mycobacterium marinum/burst
Ulcer mycobacteria " indicates that the bacterial strain of identification is the Mycobacterium marinum or mycobacterium buruli excluded except other bacterial strains, need into
One step identifies that the bacterial strain is Mycobacterium marinum or mycobacterium buruli.
Additionally due to the bispecific of probe of the present invention, 5 probes can not only identify above 12 kinds of branches thereon
Bacillus species, while can also effectively identify that two or more is mixed in 12 kinds of mycobacterias in same pipe PCR reactions
Mycobacteria strain, when mixing mycobacteria there are two or more in being reacted at one, this probe is melting song
Double melting peakss or multiple melting peakss are had in the melting spectrum generated after line analysis.
The present invention utilizes fluorescent PCR and melting curve analysis technology platform, and innovatively application is with the new of nucleic acid modification
The clinical common 12 kinds of mycobacteria strains of type double labelling and the probe in detecting of bispecific realize between each strain at least at one
The difference of Tm values in sense channel is more than or equal to 4 DEG C, therefore can accurately and effectively identify that two or more bacterium are simultaneous
Compound bacteria.
Below by the drawings and specific embodiments, the present invention will be further described, but is not meant to protect the present invention
Protect the limitation of range.
Description of the drawings
Fig. 1 is that probe Probe1 of the present invention for identification of mycobacterium strain detects 12 kinds common point in the channels FAM
Melting curve analysis figure caused by branch bacillus.
Fig. 2 is that probe Probe2 of the present invention for identification of mycobacterium strain detects 12 kinds common point in the channels HEX
Melting curve analysis figure caused by branch bacillus.
Fig. 3 is that probe Probe3 of the present invention for identification of mycobacterium strain detects 12 kinds common point in the channels FAM
Melting curve analysis figure caused by branch bacillus.
Fig. 4 is that probe Probe4 of the present invention for identification of mycobacterium strain detects 12 kinds common point in the channels HEX
Melting curve analysis figure caused by branch bacillus.
Fig. 5 is that probe Probe5 of the present invention for identification of mycobacterium strain detects 12 kinds common point in the channels ROX
Melting curve analysis figure caused by branch bacillus.
Fig. 6 is that probe Probe1 of the present invention for identification of mycobacterium strain detects different proportion in the channels FAM
Mycobacterium avium and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes.
Fig. 7 is that probe Probe2 of the present invention for identification of mycobacterium strain detects different proportion in the channels HEX
Mycobacterium avium and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes.
Fig. 8 is that probe Probe3 of the present invention for identification of mycobacterium strain detects different proportion in the channels FAM
Mycobacterium avium and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes.
Fig. 9 is that probe Probe5 of the present invention for identification of mycobacterium strain detects different proportion in the channels ROX
Mycobacterium avium and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes.
Figure 10 is patent of invention CN102634575B logical in FAM for TBProbe1 in the probe of identification of mycobacterium strain
The mycobacterium avium and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes that different proportion is detected in road.
Figure 11 is patent of invention CN102634575B logical in HEX for TBProbe2 in the probe of identification of mycobacterium strain
The mycobacterium avium and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes that different proportion is detected in road.
Figure 12 is patent of invention CN102634575B logical in FAM for TBProbe4 in the probe of identification of mycobacterium strain
The mycobacterium avium and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes that different proportion is detected in road.
Figure 13 is patent of invention CN102634575B logical in ROX for TBProbe5 in the probe of identification of mycobacterium strain
The mycobacterium avium and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes that different proportion is detected in road.
Specific implementation mode
Embodiment 1：
A method of it being used for identification of mycobacterium strain, its step are as follows：
1, the design synthesis of primer and probe
The present inventor has carried out the 16S rRNA gene orders of 12 kinds of common mycobacterias to compare analysis, it was found that 12
Category specificity corresponding to kind mycobacteria and species specificity Variable Area：1st Variable Area (the 1st region) is located at NCBI data
In library between 55-251 base of sequence X 55588.1, the 2nd Variable Area (the 2nd region) be located at the 366-539 base it
Between, the 3rd Variable Area (the 3rd region) is located between the 1110-1314 base, although being disclosed in patent CN102634575B
Three specific probes, but three specific probes are common dual labelled probe, and Tm value differences are different smaller between the strain of part, fit
Single culture identification for being separately cultured, and two or more bacterium are existed simultaneously, then it can not differentiate.
In view of the above-mentioned problems, the present inventor is after further research, by the cooperation of particular probe and primer, may be implemented
Discriminating in the presence of two or more bacterium.
According to 12 kinds of mycobacterias in each Variable Area species specificity, double labelling of the design five with nucleic acid modification and
Bispecific probe, and Species specific probes are designed to each Variable Area：
Probe includes 3 regions：5 ' the end single-stranded target nucleic acid sequence binding sites complementary with target nucleic acid sequence are as the 1st area
Domain；3 ' the end single-stranded target nucleic acid sequence binding sites complementary with target nucleic acid sequence are as the 2nd region；With 5 ' ends and 3 ' end engaging portions
The non-binding protruding part that position is connected is as the 3rd region；
Nucleic acid is modified to lock nucleic acid (Locked nucleic acid, LNA) modification, LNA modify in probe the 1st region and
There are the nucleic acid sequences of mutation differences for target nucleic acid sequence.
The length in the 1st region of probe is longer than the 2nd region, and the length in the 1st region can be 15-60 nucleotide, or can be with
It is 15-40 nucleotide, still can is 15-30 nucleotide.
The 2nd zone length of probe can be 3-15 nucleotide, or can be 3-13 nucleotide, still can be 4-12
Nucleotide more can be 5-11 nucleotide, preferably not more than 15 nucleotide.
The 3rd zone length of probe can be 3-10 nucleotide, or can be 3-8 nucleotide, still can be 4-7 core
Thuja acid more can be 4-5 nucleotide.
The length in the 1st region is 15-60 nucleotide；The length in the 2nd region is 3-15 nucleotide；Described 3rd
The length in region is 3-10 nucleotide.
The Tm values range in the 1st region of probe can be 40 DEG C -80 DEG C, or can be 45 DEG C -70 DEG C；The Tm values in the 2nd region
Range can be 6 DEG C -40 DEG C, or can be 10 DEG C -40 DEG C；The Tm values range in the 3rd region can be 2 DEG C -15 DEG C.
The Tm values in the 1st region described in probe are 40 DEG C -80 DEG C；The Tm values in the 2nd region are 6 DEG C -40 DEG C；Described
The Tm values in 3 regions are 2-15 DEG C.
Probe further includes a fluorophor and a non-fluorescence quencher, and fluorophor marks the institute in the probe
5 ' end of the 1st region or the 3 ' end of the 2nd region are stated, non-fluorescence quencher marks the core inside the 1st region of probe
On thuja acid residue.
Interval is no more than 25 nucleotide between fluorophor and non-fluorescence quencher, or is no more than 18 nucleosides
Acid.
The distance between fluorophor and non-fluorescence quencher can be 8-20 nucleotide, can also be 10-17
Nucleotide can also be 10-15 nucleotide.
The nucleotides sequence column number of probe is selected from the group of SEQ ID NO.1-5 and combinations thereof compositions.
Probe is 5 probes, is respectively：Probe1、Probe2、Probe3、Probe4、Probe5.
1st region is probe probe1, probe2；2nd region is probe probe3, probe4；3rd region is probe
probe5。
5 ' ends of 5 probes are marked with fluorophor, and non-fluorescence quencher marks the core inside the 1st region of probe
On thuja acid residue, the nucleotide sequence is respectively such as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID
Shown in NO.4, SEQ ID NO.5.
Mycobacteria is selected from mycobacterium tuberculosis, mycobacterium kansasii, Mycobacterium scrofulaceum, Mycobacterium marinum, ulcer
Mycobacteria, Mycobacterium intracellulare, mycobacterium avium, mycobacterium smegmatis, mycobacterium fortuitum, Mycobacterium chelonei tortoise subspecies,
One or two or more kinds of combinations in Mycobacterium chelonei abscess subspecies, mycobacterium xenopi.
The oligonucleotide sequence number of the corresponding amplimer of probe is SEQ ID NO.6, SEQ ID NO.7, SEQ
ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11.
Since probe is made of 3 regions, under certain conditions, the 1st region of probe and the 2nd region and target nucleus are determined
The bispecific of acid sequence combines；When the target nucleic acid sequence with mutation differences hybridizes, the 1st region of probe with LNA modifications
The formation double-strand that cannot stablize with the target nucleic acid sequence of mutation differences, reduces what the 2nd region of probe was combined with target nucleic acid sequence
Possibility, a variety of non-target nucleic acids of target nucleic acid and mutation differences can effectively be differentiated by carrying out the melting spectrum of melting curve analysis generation
Classification is conducive to clinical polygenic mutation diagnosis and strain idenfication etc..
Upstream and downstream primer is designed in each region：Design sense primer primer1 and downstream primer primer2 in 1st region；
Design sense primer primer3 and downstream primer primer4 in 2nd region；Design sense primer primer5 and downstream in 3rd region
Primer primer6.
1st Area Probe probe1, probe2；2nd Area Probe probe3, probe4；3rd Area Probe probe5.
Primer and probe entrusts specialized company to be synthesized, and primer purifies for PAGE, and probe purifies for HPLC.
The oligonucleotide sequence of the primer and probe such as the following table 5：
Table 5
Note：FAM is a kind of fluorophor, excitation wavelength 495nm, wavelength of transmitted light 521nm；BHQ1dT is to be marked
The thymine deoxyribotide of quenching group BHQ1；PO4 indicates phosphorylation modification；HEX is a kind of fluorophor, excitation
Optical wavelength 535nm, wavelength of transmitted light 556nm；BHQ2dT is the thymidine dezyribonucleoside that quenching group BHQ2 is marked
Acid；ROX is a kind of fluorophor, excitation wavelength 575nm, wavelength of transmitted light 602nm；“=" indicate that the position is lock nucleic acid
(LNA) the non-natural nucleotide modified；" // " is expressed as central marker；" _ _ _ _ _ _ _ " it is expressed as the core of non-binding protruding part
Thuja acid.
2, PCR reactive components
PCR reactions are divided into two groups of reactions of A, B, and the primer and probe of A groups reaction includes：primer1、primer2、
probe1、probe2；B groups reaction primer and probe include：primer3、primer4、primer5、primer6、probe3、
probe4、probe5。
The stoichiometric number (N) of needs is calculated first：N=n+2+1, wherein " n " is the template DNA number for needing to detect, " 2 " refer to
Two control reactions (positive control and blank control), " 1 " are the reactions additionally added, it is therefore an objective to avoid packing process
Middle loss causes reaction solution insufficient.
A group PCR reaction solution formulation components are as shown in table 6；B group PCR reaction solution formulation components are as shown in table 7.
The volume number of each component in table 6, table 7 is multiplied by N, obtains the volume of each required component.According to calculating
The volume of acquisition each component is added in clean 1.5ml centrifuge tubes, whirlpool mixing successively, centrifugation.Then by reaction solution point
It is filled in PCR pipe, often 18 μ L of pipe.
It respectively takes 2 μ L to be added in different PCR pipes the template DNA extracted and positive reference substance, blank control product, mixes
It is even, upper machine amplification after centrifugation.
Template used DNA includes mycobacterium tuberculosis (M.tuberculosis), mycobacterium kansasii in the present embodiment
(M.kansasii), Mycobacterium scrofulaceum (M.scrofulaceum), Mycobacterium marinum (M.marmum), mycobacterium buruli
(M.ulcerans), Mycobacterium intracellulare (M.intracellulare), mycobacterium avium (M.avium), mycobacterium smegmatis
(M.smegmatis), mycobacterium fortuitum (M.fortuitum), Mycobacterium chelonei tortoise subspecies (M.chelonae
Subsp.chelonae), Mycobacterium chelonei abscess subspecies (M.chelonae subsp.abscessus), mycobacterium xenopi
(M.xenopi) and the genomic DNA of Escherichia coli.All template DNAs are the Clinical isolation after culture, after inactivation, are made
It is extracted and is obtained with the bacterial genomes DNA extraction kit of commercialization.
Table 6
Table 7
3, pcr amplification reaction
Tri- fluorescence detection channels of FAM, HEX, ROX are set by routine techniques, pre-detection PCR pipe is placed in PCR instrument
Start PCR amplification, response procedures such as the following table 8.
Table 8
Each component in table in step 23 and table 4 is added in clean centrifuge tube successively, whirlpool mixing, is centrifuged；Then will
Reaction solution is dispensed into PCR pipe；
The template DNA extracted and positive reference substance, blank control product are added in different PCR pipes, mixing, are centrifuged
Afterwards, pre-detection PCR pipe is placed in PCR instrument, response procedures is set：95 DEG C of pre-degenerations 1 minute；95 DEG C are denaturalized 6 seconds, 58 DEG C of annealing 30
Second, 72 DEG C extend 10 seconds, and totally 50 recycle；95 DEG C are denaturalized 30 seconds, and 40 DEG C are annealed 1 minute, melting curve (Melting curve)
Setting：40~85 DEG C, each step increases 1 DEG C, and each temperature maintains 30s, in each temperature collection fluorescence, setting collect FAM,
The sense channel of HEX, ROX fluorescence signal；
4, melting curve analysis
When fluorescence quantitative PCR instrument end of run, melting curve analysis is carried out to this test result using its software kit,
Melting curve is shown in attached drawing 1-6：Fig. 1 is that the present invention is examined for Probe1 in the probe of identification of mycobacterium strain in the channels FAM
Survey melting curve analysis figure caused by 12 kinds of common mycobacterias.Fig. 2 is the spy that the present invention is used for identification of mycobacterium strain
Probe2 detects melting curve analysis figure caused by 12 kinds of common mycobacterias in the channels HEX in needle.Fig. 3 is that the present invention uses
It is bent to detect melting caused by 12 kinds of common mycobacterias in the channels FAM by Probe3 in the probe of identification of mycobacterium strain
Line analysis figure.Fig. 4 be the present invention for identification of mycobacterium strain probe in Probe4 detected in the channels HEX 12 kinds it is common
Melting curve analysis figure caused by mycobacteria.Fig. 5 is the present invention for Probe5 in the probe of identification of mycobacterium strain
Melting curve analysis figure caused by 12 kinds of common mycobacterias is detected in the channels ROX.Fig. 6 is the present invention for identifying branch
Probe1 detects the mycobacterium avium and Mycobacterium intracellulare Mixed Microbes of different proportion in the channels FAM in the probe of bacillus species
Generated melting curve analysis figure.
From Fig. 1-6 it is found that apparent melting peakss occur in 12 kinds of mycobacterias；Negative control and blank control are without apparent
There is (not shown) in melting peakss.And in the testing result of arbitrary two kinds of mycobacterias, at least in a sense channel, Tm
Value (see the table below 9：12 kinds of mycobacteria strains generate the Tm values (DEG C) for melting spectrum) difference Δ Tm >=4 DEG C.Wherein Δ Tm minimums
It is mycobacterium avium and Mycobacterium intracellulare, only Tm values differ 4 DEG C to both bacterium in Probe2, remaining sense channel is homogeneous
Together.
Table 9
Embodiment 2：
1, compound strain detects
In recent years in skin soft-tissue infection, skeletal system infection and 50%AIDS (Immune Deficiency Syndrome) corpse
It solves and finds the compound group's infection of bird-intracellular in patient, pair two nucleotide sequence difference site productions the characteristics of probe according to the present invention
Raw melting spectrum Tm values differ greatly, therefore for the infection sample of two kinds of compound groups of mycobacteria, it can be in same tube reaction
It melts in spectrum and bimodal, the i.e. corresponding melting peak value of two kinds of bacterial strains occurs.
To verify identification capacity of the probe of the present invention to compound strain, the present inventor divides mycobacterium avium and intracellular
Branch bacillus is mixed by different proportion, obtains 95%M.avium-5%M.intracellulare, 75%M.avium- respectively
25%M.intracellulare, 50%M.avium-50%M.intracellulare, 25%M.avium-75%
5 Mixed Microbes samples such as M.intracellulare and 5%M.avium-95%M.intracellulare.5 are extracted respectively
The nucleic acid of Mixed Microbes sample is detected using primed probe of the present invention, as a result sees attached drawing:7-9：Fig. 7 is that the present invention uses
Probe2 detects the mycobacterium avium and intracellular branch of different proportion in the channels HEX in the probe of identification of mycobacterium strain
Melting curve analysis figure caused by bacillus Mixed Microbes.Fig. 8 is the present invention in the probe of identification of mycobacterium strain
The mycobacterium avium and melting curve caused by Mycobacterium intracellulare Mixed Microbes that Probe3 detects different proportion in the channels FAM
Analysis chart.Fig. 9 is that the present invention detects different proportion for Probe5 in the probe of identification of mycobacterium strain in the channels ROX
Mycobacterium avium and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes.
From result as it can be seen that in the sense channel of probe Probe2, when a kind of ratio of bacterium is more than or equal to 25%, you can inspection
The respective feature melting peakss of two kinds of bacterium are measured, to which the interpretation sample is the Mixed Microbes of mycobacterium avium and Mycobacterium intracellulare.
2, contrast experiment
The primed probe disclosed in patent of invention CN102634575B does identical compound strain detection：By bird branch bar
Bacterium and Mycobacterium intracellulare are mixed by different proportion, respectively obtain 95%M.avium-5%M.intracellulare,
75%M.avium-25%M.intracellulare, 50%M.avium-50%M.intracellulare, 25%
5 Mixed Microbes samples such as M.avium-75%M.intracellulare and 5%M.avium-95%M.intracellulare.
The nucleic acid for extracting 5 Mixed Microbes samples respectively, is detected using primed probe described in CN102634575B, as a result sees attached drawing
10-13.Figure 10 is for patent of invention CN102634575B for TBProbe1 in the probe of identification of mycobacterium strain in the channels FAM
The mycobacterium avium of middle detection different proportion and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes.Figure 11 is hair
Bright patent CN102634575B detects different proportion for TBProbe2 in the probe of identification of mycobacterium strain in the channels HEX
Mycobacterium avium and Mycobacterium intracellulare Mixed Microbes caused by melting curve analysis figure.Figure 12 is patent of invention
CN102634575B detects the bird point of different proportion for TBProbe4 in the probe of identification of mycobacterium strain in the channels FAM
Branch bacillus and melting curve analysis figure caused by Mycobacterium intracellulare Mixed Microbes.Figure 13 is that patent of invention CN102634575B is used
TBProbe5 detects the mycobacterium avium and intracellular point of different proportion in the channels ROX in the probe of identification of mycobacterium strain
Melting curve analysis figure caused by branch bacillus Mixed Microbes.
As can be known from the results, the primed probe disclosed in patent of invention CN102634575B does identical compound strain detection
When, probe probe3 and probe6 are without melting peakss, and probe probe1, probe2, probe4 and probe5 are to mycobacterium avium
It is same or similar with the Tm values of Mycobacterium intracellulare, cause to be independent melting peakss, can not interpretation sample be compound strain.
The present invention does not hold the Bispecific Hybrid of binding sites and target nucleic acid sequence with the end of nucleic acid modified 5 ' and 3 ', and not
Can generate wide range melting peakss (Tm values) variation with the hybridization of strain mycobacteria target nucleic acid sequence, thus can quickly, it is accurate,
Sensitive identification single culture and the simultaneous compound bacteria sample of two or more mycobacteria strains.
Claims (4)
1. a kind of kit for identification of mycobacterium strain, wherein identification reagent include three pairs of primers and five probes, institute
State primer include sense primer primer1, downstream primer primer2, sense primer primer3, downstream primer primer4, on
Swim primer primer5 and downstream primer primer6；Primer primer1, primer2, primer3, primer4, primer5 and
The nucleotide sequence difference of primer6 is as shown in table 1 below；The probe includes 3 regions：With target nucleic acid sequence complementation
5 ' end single-stranded target nucleic acid sequence binding sites are as the 1st region；3 ' the end single-stranded target nucleic acid sequences complementary with the target nucleic acid sequence
Row binding site is as the 2nd region；The non-binding protruding part conduct being connected with the 5 ' end and 3 ' end binding site
3rd region；Five probes are respectively Probe1, Probe2, Probe3, Probe4 and Probe5；Its oligonucleotide sequence
It is as shown in table 1 below respectively：
Table 1
Wherein, the FAM：A kind of fluorophor, excitation wavelength 495nm, wavelength of transmitted light 521nm；BHQ1 dT：It is marked
The thymine deoxyribotide of quenching group BHQ1；PO4：Indicate phosphorylation modification；HEX：A kind of fluorophor, excitation
Optical wavelength 535nm, wavelength of transmitted light 556nm；BHQ2 dT：The thymidine dezyribonucleoside of quenching group BHQ2 is marked
Acid；ROX：For a kind of fluorophor, excitation wavelength 575nm, wavelength of transmitted light 602nm；"=" indicates that the position is lock nucleic acid
(LNA) the non-natural nucleotide modified；It is expressed as central marker with " // "；" _ _ _ _ _ _ " it is expressed as the core of non-binding protruding part
Thuja acid.
2. the kit according to claim 1 for identification of mycobacterium strain, it is characterised in that：The branch bar
Bacterium is selected from mycobacterium tuberculosis, mycobacterium kansasii, Mycobacterium scrofulaceum, Mycobacterium marinum, mycobacterium buruli, intracellular point
Branch bacillus, mycobacterium avium, mycobacterium smegmatis, mycobacterium fortuitum, Mycobacterium chelonei tortoise subspecies, Mycobacterium chelonei abscess are sub-
Two kinds or more of combination in kind, mycobacterium xenopi.
3. kit of the claim 1-2 any one of them for identification of mycobacterium strain is being prepared for identifying branch bar
Application in the product of bacterium.
4. side of the claim 1-2 any one of them kits for the identification of mycobacterium strain of non-disease diagnostic purpose
Method, its step are as follows：
(1) the design synthesis of primer and probe
Design five double labellings and bispecific probe with nucleic acid modification, oligonucleotide sequence such as the following table 2 of the probe：
Table 2
Wherein, the FAM：A kind of fluorophor, excitation wavelength 495nm, wavelength of transmitted light 521nm；BHQ1 dT：It is marked
The thymine deoxyribotide of quenching group BHQ1；PO4：Indicate phosphorylation modification；HEX：A kind of fluorophor, excitation
Optical wavelength 535nm, wavelength of transmitted light 556nm；BHQ2 dT：The thymidine dezyribonucleoside of quenching group BHQ2 is marked
Acid；ROX：For a kind of fluorophor, excitation wavelength 575nm, wavelength of transmitted light 602nm；"=" indicates that the position is lock nucleic acid
(LNA) the non-natural nucleotide modified；It is expressed as central marker with " // "；" _ _ _ _ _ _ " it is expressed as the core of non-binding protruding part
Thuja acid；
Design of primers：Probe includes 3 regions：5 ' the end single-stranded target nucleic acid sequence binding site conducts complementary with target nucleic acid sequence
1st region；3 ' the end single-stranded target nucleic acid sequence binding sites complementary with target nucleic acid sequence are as the 2nd region；With 5 ' ends and 3 ' ends
The non-binding protruding part that binding site is connected is as the 3rd region；
Design sense primer primer1 and downstream primer primer2 in 1st region；2nd region design sense primer primer3 and
Downstream primer primer4；Design sense primer primer5 and downstream primer primer6, the nucleotide of the primer in 3rd region
Sequence table is as shown in table 3 below；
Table 3
1st Area Probe probe1, probe2；2nd Area Probe probe3, probe4；3rd Area Probe probe5；Upstream
Primer, downstream primer and probe entrust specialized company to be synthesized, and sense primer and downstream primer purify for PAGE, and probe is
HPLC is purified；
(2), PCR reactive components
PCR reactions are divided into two groups of reactive components of A, B, and the primer and probe of A groups reaction includes：primer1、primer2、
probe1、probe2；B groups reaction primer and probe include：primer3、primer4、primer5、primer6、probe3、
probe4、probe5；A group PCR reaction solution formulation components are as shown in table 4 below；B group PCR reaction solutions formulation components such as the following table 5 institute
Show；
Table 4
Table 5
(3), PCR amplification
Each component in table 4 in step (2) and table 5 is added in clean centrifuge tube successively, whirlpool mixing, is centrifuged；It then will be anti-
Liquid is answered to dispense into PCR pipe；
The template DNA extracted and positive reference substance, blank control product are added in different PCR pipes, mixing, it, will after centrifugation
Pre-detection PCR pipe is placed in PCR instrument, and response procedures are arranged：95 DEG C of pre-degenerations 1 minute；95 DEG C are denaturalized 6 seconds, and 58 DEG C are annealed 30 seconds, and 72
DEG C extend 10 seconds, totally 50 cycle；95 DEG C are denaturalized 30 seconds, and 40 DEG C are annealed 1 minute, melting curve (Melting curve) setting：
40~85 DEG C, each step increases 1 DEG C, and each temperature maintains 30s, in each temperature collection fluorescence, setting collect FAM, HEX,
The sense channel of ROX fluorescence signals；
(4), melting curve analysis
When fluorescence quantitative PCR instrument end of run, melting curve analysis is carried out to this test result using its software kit, it is rear to produce
Raw to melt spectrum, the target nucleic acid sequence and the melting peakss of probe formation of target nucleic acid sequence and various mutations difference have notable difference,
The classification for distinguishing target nucleic acid sequence and various mutations difference target nucleic acid sequence, mycobacterium bacterium is identified with this.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510812703.9A CN105368943B (en) | 2015-11-21 | 2015-11-21 | A kind of kit and method for identification of mycobacterium strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510812703.9A CN105368943B (en) | 2015-11-21 | 2015-11-21 | A kind of kit and method for identification of mycobacterium strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105368943A CN105368943A (en) | 2016-03-02 |
| CN105368943B true CN105368943B (en) | 2018-10-16 |
Family
ID=55371569
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510812703.9A Active CN105368943B (en) | 2015-11-21 | 2015-11-21 | A kind of kit and method for identification of mycobacterium strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105368943B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119363B (en) * | 2016-07-01 | 2019-12-03 | 中国人民解放军第三〇九医院 | SNP combination, detection method and kit for the detection of antituberculotic hepatic injury susceptible genotype |
| CN106868171B (en) * | 2017-03-27 | 2020-12-25 | 温州迪安医学检验所有限公司 | Kit for detecting clinical common pathogenic bacteria by RNA isothermal amplification melting curve method and application thereof |
| CN106834520B (en) * | 2017-03-27 | 2020-12-18 | 杭州迪安生物技术有限公司 | Kit for identifying bacteria by using molecular beacon-melting curve technology and application thereof |
| CN110872614A (en) * | 2019-12-05 | 2020-03-10 | 深圳市第三人民医院 | Cas12 a/gRNA-based method for rapidly identifying mycobacteria |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102634575A (en) * | 2012-03-26 | 2012-08-15 | 中国人民解放军第三O九医院 | Rapid identification method and kit of novel mycobacterium strain |
| CN102770556A (en) * | 2009-09-03 | 2012-11-07 | Seegene株式会社 | Td probe and its uses |
| CN102782150A (en) * | 2009-11-07 | 2012-11-14 | Seegene株式会社 | THD primer target detection |
| WO2015049496A1 (en) * | 2013-10-01 | 2015-04-09 | Epistem Limited | Mutation analysis using melting temperature and universal bases |
-
2015
- 2015-11-21 CN CN201510812703.9A patent/CN105368943B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102770556A (en) * | 2009-09-03 | 2012-11-07 | Seegene株式会社 | Td probe and its uses |
| CN102782150A (en) * | 2009-11-07 | 2012-11-14 | Seegene株式会社 | THD primer target detection |
| CN102634575A (en) * | 2012-03-26 | 2012-08-15 | 中国人民解放军第三O九医院 | Rapid identification method and kit of novel mycobacterium strain |
| WO2015049496A1 (en) * | 2013-10-01 | 2015-04-09 | Epistem Limited | Mutation analysis using melting temperature and universal bases |
Non-Patent Citations (3)
| Title |
|---|
| 多位点PCR技术用于四川267株分枝杆菌临床分离株的鉴定;邓建平等;《疾病监测》;20120430;第27卷(第4期);第320-324页 * |
| 应用单个锁核酸修饰的探针提高对非互补杂交识别能力的研究;朴贤玉;《中国博士学位论文全文数据库 基础科学辑》;20091015(第10期);A006-17 * |
| 应用多重PCR方法快速鉴定结核分枝杆菌复合群与非结核分枝杆菌的研究;王桂荣等;《中国防痨杂志》;20140103;第35卷(第9期);第686-689页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105368943A (en) | 2016-03-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2017200433B2 (en) | Multivariate diagnostic assays and methods for using same | |
| AU2011227110B2 (en) | Methods, kits and compositions for detection of MRSA | |
| CN102634575B (en) | Rapid identification method and kit of novel mycobacterium strain | |
| CN106399517B (en) | Nucleic acid detection technology combining multi-cross constant-temperature amplification with gold nano biosensing | |
| CN105368943B (en) | A kind of kit and method for identification of mycobacterium strain | |
| CN107488711A (en) | The method and its kit of the genotype detection of point mutation | |
| CN102229989B (en) | Method and kit for detecting ethambutol resistance mutation of Mycobacterium tuberculosis | |
| CN111004862A (en) | Primer and probe for rapidly detecting and identifying cryptococcus and application thereof | |
| CN107760764A (en) | A kind of target nucleic acid detection method and kit based on primer fluorescence and quenched label | |
| CN104928355A (en) | Method and kit thereof for detecting BRAF gene mutation | |
| CN103562405A (en) | Compositions, methods, and kits for detecting and identifying mycobacteria | |
| CN117363767A (en) | Probe combination, primer set and kit for real-time fluorescence PCR detection of target genes and application of probe combination and primer set and kit | |
| KR20190017698A (en) | Kit For Detecting Tuberculosis and Method of Detecting Tuberculosis Using the Same | |
| JP2009543582A (en) | Generalized methods-high-throughput mutation screening methods and kits using sequential adapter ligation and amplification enabled by specific sequence complementation (DSF) | |
| CN103045717A (en) | Method for detecting rifampin drug resistance of mycobacterium tuberculosis by using pyrosequencing technology | |
| CN106319079A (en) | Method for detecting 22q11.2 copy number deletion | |
| CN113215325B (en) | Reaction system, method and kit for detecting multiple HPV subtypes by two-dimensional PCR single tube closed tube | |
| CN103045716A (en) | Method for detecting isoniazid drug resistance of mycobacterium tuberculosis by using pyrosequencing technology | |
| CN106520948A (en) | Inverse probe for visually detecting single-nucleotide polymorphism site in gene sequence, kit and detection method thereof | |
| FI126289B (en) | Method for detecting the presence of a hypervirulent strain of Clostridium difficile | |
| CN103757110A (en) | Vibrio cholera analysis typing kit | |
| KR101158665B1 (en) | Methods for identification and detection of mycobacterium tuberculosis complex and nontuberculous mycobacteria using duplex real time polymerase chain reaction | |
| KR101227204B1 (en) | Methods for identification and detection of mycobacterium tuberculosis complex and nontuberculous mycobacteria using duplex real time polymerase chain reaction | |
| KR20180033911A (en) | Method for multiplex detection of target nucleic acid or genetic variation using multiple probes | |
| JP2024536115A (en) | Methods for testing nucleic acid amplification products |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |