CN109706145B

CN109706145B - Primer set and application thereof

Info

Publication number: CN109706145B
Application number: CN201811631669.5A
Authority: CN
Inventors: 张岩; 王颢婷; 高占成; 邢婉丽; 陈燕旌; 程京
Original assignee: Boao Biological Group Co ltd
Current assignee: Boao Biological Group Co ltd
Priority date: 2018-12-29
Filing date: 2018-12-29
Publication date: 2021-02-19
Anticipated expiration: 2038-12-29
Also published as: CN109706145A

Abstract

The invention relates to the technical field of biology, in particular to a primer group and application thereof. The invention discloses a LAMP primer combination of 4 fungi for Mucor and application thereof. The primer combination provided by the invention consists of 24 primers shown in SEQ ID No. 1-24. The primer combination provided by the invention can be used for detecting whether the primer combination contains rhizopus oryzae, mucor umbellatus, mucor circinelloides and/or rhizomucor pusillus, and can be used for detecting whether a sample to be detected contains rhizopus oryzae, mucor umbellates, mucor circinelloides and/or rhizomucor pusillus. The primer combination provided by the invention is used for identifying 4 fungi for Mucor, has high specificity and high sensitivity, and can realize simple, convenient, rapid and accurate detection. The invention has great popularization value.

Description

Primer set and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a primer group and application thereof.

Background

Invasive Fungal Disease (IFD), also known as Invasive Fungal Infection (IFI), Deep Fungal Infection (DFI), refers to the pathophysiological process in which fungi invade human tissues and blood, grow and multiply therein, cause inflammatory reactions, and cause tissue damage and organ dysfunction. Over the last two thirty years, with the wide clinical application of new technologies such as solid organ and hematopoietic stem cell transplantation, tumor chemotherapy, immunosuppressants and the like, the incidence and fatality rate of invasive mycosis are increasing year by year, and the incidence and fatality rate become one of the main causes of death of hospitalized patients increasingly. Because the invasive mycosis is infected in the population such as ICU, senile, diabetes, malignant blood system diseases, candida colonization, invasive operation, application of antibacterial drugs, glucocorticoids, immunosuppressants and the like, the immunity of the organism is low, and the severe mortality rate is high, the method has very important significance for early detection of the invasive fungal infection and determination of the infected strain.

Mucorales fungi belong to the class zygomycetes, are of various types in nature, can exist in the oropharynx of a human body, and are opportunistic pathogens of the human body, wherein pathogens causing human infection mainly comprise rhizopus oryzae, trichoderma umbellatum, mucor circinelloides, rhizomucor pusillus and the like, and can cause mucormycosis (mucormycosis). The disease is acute in onset, rapid in progression and high in mortality rate. The susceptible population is immunosuppressor, diabetic ketoacid poisoning patients, and desferrioxamine-treated chronic nephropathy patients.

The existing invasive fungal infection detection methods mainly comprise a conventional detection method and a special detection method. The conventional inspection method mainly comprises the following steps: 1) microscopic examination of fungi, namely direct smear staining microscopic examination; 2) culturing and identifying fungi; 3) and (5) histopathological examination. The special inspection method mainly comprises the following steps: 1) serological examination; 2) and (5) molecular biological examination. The conventional inspection method is still regarded as a foundation stone for determining invasive fungal infection, but the conventional inspection method has the problems of low sensitivity, complicated operation, incapability of excluding diagnosis due to negative results, long detection period (usually requiring several days to several weeks), and the like, so that the condition and medication are delayed, the death rate is increased, and the like; serological tests have difficulty excluding interspecies antigen-antibody cross-reactions of certain genera of fungi, leading to false positives. Compared with the former two methods, the molecular biology technology has the advantages of high specificity and high accuracy, and can elucidate the taxonomic relation between and in fungal populations from the gene level, so that the molecular biology technology is more and more widely accepted and applied in recent years. The related molecular diagnosis methods established at present comprise a common PCR method, a pulse field gel electrophoresis typing (PFGE), a multi-site sequence typing (MLST), restriction fragment length polymorphism analysis (RFLP), a real-time fluorescence quantitative PCR technology (RTFQ-PCR) and the like, and have the common problems of higher requirements on experimental operation and longer detection time (about 2.5h-3 h). Therefore, it is the key to solve the current situation to establish a fast and accurate molecular diagnosis method and provide an early diagnosis and treatment basis for clinical application.

Disclosure of Invention

In view of the above, the present invention provides a primer set and applications thereof. The primer combination identification is used for detecting four common mucorales fungi, has high specificity and high sensitivity, and can realize simple, convenient, rapid and accurate detection. The invention has great popularization value.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a primer combination which is (a1), (a2) or (a 3):

(a1) the primer group I, the primer group II, the primer group III and the primer group IV are included;

(a2) any two of the primer group I, the primer group II, the primer group III and the primer group IV;

(a3) the primer group I, the primer group II, the primer group III and the primer group IV are included;

wherein the primer group I consists of a primer I-F3, a primer I-B3, a primer I-FIP, a primer I-BIP, a primer I-LF and a primer I-LB;

the primer I-F3 has any one of the nucleotide sequences shown as follows:

(b1) the nucleotide sequence shown as SEQ ID NO. 1;

(b2) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 1;

(b3) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 1;

(b4) the complement of the sequence set forth in (b1), (b2) or (b 3);

the primer I-B3 has any one of the nucleotide sequences shown as follows:

(b5) the nucleotide sequence shown as SEQ ID NO. 2;

(b6) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 2;

(b7) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 2;

(b8) the complement of the sequence set forth in (b5), (b6) or (b 7);

the primer I-FIP has any one of the nucleotide sequences shown as follows:

(b9) the nucleotide sequence shown as SEQ ID NO. 3;

(b10) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 3;

(b11) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 3;

(b12) the complement of the sequence set forth in (b9), (b10) or (b 11);

the primer I-BIP has any one of the nucleotide sequences shown as follows:

(b13) the nucleotide sequence shown as SEQ ID NO. 4;

(b14) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 4;

(b15) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 4;

(b16) the complement of the sequence set forth in (b13), (b14) or (b 15);

the primer I-LF has any one of the nucleotide sequences shown as follows:

(b17) the nucleotide sequence shown as SEQ ID NO. 5;

(b18) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 5;

(b19) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 5;

(b20) the complement of the sequence set forth in (b17), (b18) or (b 19);

the primer I-LB has any one of the nucleotide sequences shown as follows:

(b21) the nucleotide sequence shown as SEQ ID NO. 6;

(b22) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 6;

(b23) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 6;

(b24) the complement of the sequence set forth in (b21), (b22) or (b 23);

the primer group II consists of a primer II-F3, a primer II-B3, a primer II-FIP, a primer II-BIP, a primer II-LF and a primer II-LB;

the primer II-F3 has any one of the nucleotide sequences shown as follows:

(c1) the nucleotide sequence shown as SEQ ID NO. 7;

(c2) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 7;

(c3) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 7;

(c4) the complement of the sequence set forth in (c1), (c2) or (c 3);

the primer II-B3 has any one of the nucleotide sequences shown as follows:

(c5) the nucleotide sequence shown as SEQ ID NO. 8;

(c6) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 8;

(c7) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 8;

(c8) the complement of the sequence set forth in (c5), (c6) or (c 7);

the primer II-FIP has any one of the nucleotide sequences shown as follows:

(c9) the nucleotide sequence shown as SEQ ID NO. 9;

(c10) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 9;

(c11) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 9;

(c12) the complement of the sequence set forth in (c9), (c10) or (c 11);

the primer II-BIP has any one of the nucleotide sequences shown as follows:

(c13) the nucleotide sequence shown as SEQ ID NO. 10;

(c14) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 10;

(c15) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 10;

(c16) the complement of the sequence set forth in (c13), (c14) or (c 15);

the primer II-LF has any one of the nucleotide sequences shown as follows:

(c17) the nucleotide sequence shown as SEQ ID NO. 11;

(c18) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 11;

(c19) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 11;

(c20) the complement of the sequence set forth in (c17), (c18) or (c 19);

the primer II-LB has any one of the nucleotide sequences shown as follows:

(c21) the nucleotide sequence shown as SEQ ID NO. 12;

(c22) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 12;

(c23) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 12;

(c24) the complement of the sequence set forth in (c21), (c22) or (c 23);

the primer group III consists of a primer III-F3, a primer III-B3, a primer III-FIP, a primer III-BIP, a primer III-LF and a primer III-LB;

the primer III-F3 has any one of the nucleotide sequences shown as follows:

(d1) the nucleotide sequence shown as SEQ ID NO. 13;

(d2) 13 by modifying, substituting, deleting and/or adding one or more bases;

(d3) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 13;

(d4) the complement of the sequence set forth in (d1), (d2) or (d 3);

the primer III-B3 has any one of the nucleotide sequences shown as follows:

(d5) 14 in SEQ ID NO;

(d6) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 14;

(d7) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 14;

(d8) the complement of the sequence set forth in (d5), (d6) or (d 7);

the primer III-FIP has any one of the nucleotide sequences shown as follows:

(d9) the nucleotide sequence shown as SEQ ID NO. 15;

(d10) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 15;

(d11) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 15;

(d12) the complement of the sequence set forth in (d9), (d10) or (d 11);

the primer III-BIP has any one of the nucleotide sequences shown as follows:

(d13) the nucleotide sequence shown as SEQ ID NO. 16;

(d14) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 16;

(d15) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 16;

(d16) the complement of the sequence set forth in (d13), (d14) or (d 15);

the primer III-LF has any one of the nucleotide sequences shown as follows:

(d17) has a nucleotide sequence shown as SEQ ID NO. 17;

(d18) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 17;

(d19) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 17;

(d20) the complement of the sequence set forth in (d17), (d18) or (d 19);

the primer III-LB has any one of the nucleotide sequences shown as follows:

(d21) has a nucleotide sequence shown as SEQ ID NO. 18;

(d22) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 18;

(d23) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 18;

(d24) the complement of the sequence set forth in (d21), (d22) or (d 23);

the primer group IV consists of a primer IV-F3, a primer IV-B3, a primer IV-FIP, a primer IV-BIP, a primer IV-LF and a primer IV-LB;

the primer IV-F3 has any one of the nucleotide sequences shown as follows:

(e1) the nucleotide sequence shown as SEQ ID NO. 19;

(e2) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 19;

(e3) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 19;

(e4) a sequence complementary to the sequence set forth in (e1), (e2) or (e 3);

the primer IV-B3 has any one of the nucleotide sequences shown as follows:

(e5) 20 in SEQ ID NO;

(e6) 20 is obtained by modifying, substituting, deleting and/or adding one or more bases;

(e7) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 20;

(e8) a sequence complementary to the sequence set forth in (e5), (e6) or (e 7);

the primer IV-FIP has any one of the nucleotide sequences shown as follows:

(e9) the nucleotide sequence shown as SEQ ID NO. 21;

(e10) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 21;

(e11) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 21;

(e12) a sequence complementary to the sequence set forth in (e9), (e10) or (e 11);

the primer IV-BIP has any one of the nucleotide sequences shown as follows:

(e13) 22 in SEQ ID NO;

(e14) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 22;

(e15) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 22;

(e16) a sequence complementary to the sequence set forth in (e13), (e14) or (e 15);

the primer IV-LF has any one of the nucleotide sequences shown as follows:

(e17) 23 has a nucleotide sequence shown as SEQ ID NO;

(e18) the nucleotide sequence is obtained by modifying, substituting, deleting and/or adding one or more bases in the nucleotide sequence shown in SEQ ID NO. 23;

(e19) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 23;

(e20) a sequence complementary to the sequence set forth in (e17), (e18) or (e 19);

the primer IV-LB has any one of the nucleotide sequences shown as follows:

(e21) 24 in the sequence shown in SEQ ID NO;

(e22) 24 is obtained by modifying, substituting, deleting and/or adding one or more bases;

(e23) a sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO. 24;

(e24) the complement of the sequence shown in (e21), (e22) or (e 23).

In some embodiments of the invention, the molar ratio of the primer I-F3, the primer I-B3, the primer I-FIP, the primer I-BIP, the primer I-LF and the primer I-LB in the primer set I is 0.5: 0.5: 2: 2: 1: 1;

in the primer group II, the molar ratio of the primer II-F3 to the primer II-B3 to the primer II-FIP to the primer II-BIP to the primer II-LF to the primer II-LB is 0.5: 0.5: 2: 2: 1: 1.

in the primer group III, the molar ratio of the primer III-F3 to the primer III-B3 to the primer III-FIP to the primer III-BIP to the primer III-LF to the primer III-LB is 0.5: 0.5: 2: 2: 1: 1.

the primer group IV, the primer IV-F3, the primer IV-B3, the primer IV-FIP, the primer IV-BIP, the primer IV-LF and the primer IV-LB have a molar ratio of 0.5: 0.5: 2: 2: 1: 1.

in some embodiments of the invention, in the primer set i, the amount of each primer is as follows: 0.5. mu. mol of the primer I-F3, 0.5. mu. mol of the primer I-B3, 2.0. mu. mol of the primer I-FIP, 2.0. mu. mol of the primer I-BIP, 1.0. mu. mol of the primer I-LF and 1.0. mu. mol of the primer I-LB.

In the primer group II, the amount of each primer is as follows: 0.5 mu mol of the primer II-F3, 0.5 mu mol of the primer II-B3, 2.0 mu mol of the primer II-FIP, 2.0 mu mol of the primer II-BIP, 1.0 mu mol of the primer II-LF and 1.0 mu mol of the primer II-LB.

In the primer group III, the amount of each primer is as follows: 0.5. mu. mol of the primer III-F3, 0.5. mu. mol of the primer III-B3, 2.0. mu. mol of the primer III-FIP, 2.0. mu. mol of the primer III-BIP, 1.0. mu. mol of the primer III-LF and 1.0. mu. mol of the primer III-LB.

In the primer group IV, the amount of each primer is as follows: 0.5 mu mol of the primer IV-F3, 0.5 mu mol of the primer IV-B3, 2.0 mu mol of the primer IV-FIP, 2.0 mu mol of the primer IV-BIP, 1.0 mu mol of the primer IV-LF and 1.0 mu mol of the primer IV-LB.

The invention also provides application of the primer combination in amplification of nucleic acid molecules of Rhizopus oryzae, Mucor umbellatus, Mucor circinelloides and/or Rhizomucor pusillus.

The invention also provides application of the primer combination in detecting and/or identifying Rhizopus oryzae, Mucor umbellatus, Mucor circinelloides and/or Rhizomucor pusillus.

The invention also provides application of the primer combination in preparation of a kit for detecting and/or identifying Rhizopus oryzae, Mucor umbellatus, Mucor circinelloides and/or Rhizomucor pusillus.

The invention also provides a kit of the primer combination, and the application of the kit comprises:

i, identifying rhizopus oryzae, trichoderma umbellatum, trichoderma circinelloides and/or rhizomucor pusillus;

and II, detecting whether the sample to be detected contains rhizopus oryzae, mucor umbellatus, mucor circinelloides and/or rhizomucor pusillus.

The kit can also comprise a reaction liquid, and the reaction liquid can be specifically a product of Boao biological group, Inc., and the catalog number of the product is CP.440020.

The invention also provides a preparation method of the kit, which comprises the step of packaging each primer independently.

The invention also provides a method for identifying rhizopus oryzae, mucor umbellate, mucor circinelloides and/or rhizomucor pusillus, which comprises the following steps:

(1) obtaining plasmid DNA of a gene to be detected of a bacterium to be detected;

(2) taking the plasmid DNA extracted in the step (1) as a template, and respectively adopting the primers in the primer combination to carry out loop-mediated isothermal amplification to obtain an amplification result;

(3) and obtaining an identification result according to the amplification result.

In some embodiments of the present invention, if the primer set i is used to achieve specific amplification using the plasmid DNA as a template, the test bacterium contains or is a candidate for containing rhizopus oryzae;

if the primer group II is adopted, the specific amplification with the plasmid DNA as a template can be realized, and the bacteria to be detected contain or are candidate to contain trichoderma umbellatum;

if the primer group III is adopted, the specific amplification with the plasmid DNA as a template can be realized, and the bacteria to be detected contain or are candidate to contain mucor circinelloides;

if the primer group IV is adopted, the specific amplification with the plasmid DNA as a template can be realized, and the bacteria to be detected contain or are candidate to contain rhizomucor pusillus.

The invention also provides a method for detecting whether a sample to be detected contains rhizopus oryzae, mucor umbellate, mucor circinelloides and/or rhizomucor pusillus, which comprises the following steps:

(1) obtaining the total DNA of a sample to be detected;

(2) taking the total DNA extracted in the step (1) as a template, and respectively adopting the primers in the primer combination to carry out loop-mediated isothermal amplification to obtain an amplification result;

(3) and obtaining a detection result according to the amplification result.

In some embodiments of the present invention, if the primer set i is used to achieve specific amplification using the total DNA as a template, a sample to be tested contains or is suspected to contain rhizopus oryzae;

if the primer group II is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain trichoderma umbellatum;

if the primer group III is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain mucor circinelloides;

if the primer group IV is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain rhizomucor pusillus.

In any of the above methods, when the primer set I is used, the molar concentrations of the primer I-F3, the primer I-B3, the primer I-FIP, the primer I-BIP, the primer I-LF and the primer I-LB in the reaction system of the LAMP are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.

In any of the above methods, when the primer set II is used, the molar concentrations of the primer II-F3, the primer II-B3, the primer II-FIP, the primer II-BIP, the primer II-LF and the primer II-LB in the reaction system of the loop-mediated isothermal amplification are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.

In any of the above methods, when the primer set III is used, the molar concentrations of the primer III-F3, the primer III-B3, the primer III-FIP, the primer III-BIP, the primer III-LF and the primer III-LB in the reaction system of the LAMP are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.

In any of the above methods, when the primer set IV is used, the molar concentrations of the primer IV-F3, the primer IV-B3, the primer IV-FIP, the primer IV-BIP, the primer IV-LF and the primer IV-LB in the reaction system of the loop-mediated isothermal amplification are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M in sequence.

In any of the above methods, the loop-mediated isothermal amplification reaction conditions are: keeping the temperature at 65 ℃ for 50 min.

In the present invention, the sample to be tested may be alveolar lavage fluid of human (Homo sapiens).

In the present invention, the implementation of loop-mediated isothermal amplification specifically can be embodied as: a loop-mediated isothermal amplification curve can appear when the fluorescence quantitative PCR is used for detection. The loop-mediated isothermal amplification curve can be a typical "sigmoidal" amplification curve.

Loop-mediated isothermal amplification (LAMP) is a sensitive, specific, simple and fast nucleic acid amplification technology developed in recent years, and the principle is that under the action of a DNA polymerase with strand displacement activity, 4-6 primers of 6-8 regions are identified, a target gene is amplified rapidly and specifically under an isothermal condition, and the loop-mediated isothermal amplification technology can be popularized and applied to rapid and accurate detection of common strains. The LAMP method has the advantages of high sensitivity, good specificity, short reaction time, convenient judgment result, no need of expensive instruments and the like.

The reaction system of the invention comprises the following components in percentage by weight: reaction system 10 μ L: (6.7 to 7.3) uL of the reaction mixture (product catalog number CP.440020 of Boo Bio Inc.), (0.8 to 1.2) uL of the primer combination, and 1 uL of the diluent (genome copy number 5 x 10 contained in 1 uL of the diluent)²copies), water to 10 μ L.

The primer combination provided by the invention is used for detecting four common mucorales fungi, has high specificity and high sensitivity, and can realize simple, convenient, rapid and accurate detection. The invention has great popularization value.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows the results of detection using primer set I in example 2;

FIG. 2 shows the results of detection using the primer set II in example 2;

FIG. 3 shows the results of detection using the primer set III in example 2;

FIG. 4 shows the results of detection using the primer set IV in example 2;

FIG. 5 shows the results of detection of the reaction system 1 in example 3;

FIG. 6 shows the results of detection of reaction system 2 in example 3;

FIG. 7 shows the results of detection in reaction system 3 in example 3;

FIG. 8 shows the results of detection of the reaction system 4 in example 3;

FIG. 9 shows the results of detection of reaction system 5 in example 3;

FIG. 10 shows the results of detection of the reaction system 6 in example 3;

FIG. 11 shows the results of detection of reaction system 7 in example 3;

FIG. 12 shows the results of detection of the reaction system 8 in example 3;

FIG. 13 shows the results of detection of the reaction system 9 in example 3;

FIG. 14 shows the results of detection of the reaction system 10 in example 3;

FIG. 15 shows the results of detection of the reaction system 11 in example 3;

FIG. 16 shows the results of detection of the reaction system 12 in example 3;

FIG. 17 shows the results of detection of the reaction system 1 in example 4;

FIG. 18 shows the results of detection of the reaction system 2 in example 4;

FIG. 19 shows the results of detection of reaction system 3 in example 4;

FIG. 20 shows the results of detection of the reaction system 4 in example 4;

FIG. 21 shows the results of detection of reaction system 5 in example 4;

FIG. 22 shows the results of detection of sample one in example 5;

FIG. 23 shows the detection results of sample two in example 5;

FIG. 24 shows the results of detection of sample three in example 5;

FIG. 25 shows the detection results of sample four in example 5;

FIG. 26 shows the results of sensitivity of detection of Mucor umbellatus using primers provided by the invention in a comparative experiment;

FIG. 27 shows the results of sensitivity of detection of Mucor umbellatus using control primers in a control experiment;

FIG. 28 shows the results of specificity of detection of Mucor umbellatus using primers provided by the invention in a comparative experiment;

FIG. 29 shows the results of specificity of detection of Mucor umbellatus using control primers in a control assay;

FIG. 30 shows the results of sensitivity in a comparative experiment for detecting Rhizopus oryzae using the primers provided by the present invention;

FIG. 31 shows the results of sensitivity of detection of Rhizopus oryzae using a control primer in a control experiment;

FIG. 32 shows the results of the specificity of detection of Rhizopus oryzae using the primers provided by the present invention in a comparative experiment;

FIG. 33 shows the results of detecting specificity of Rhizopus oryzae using the control primers in the control experiment;

FIG. 34 shows the results of sensitivity of a comparative experiment for detecting Mucor circinelloides using the primers provided herein;

FIG. 35 shows the results of sensitivity of detection of Mucor circinelloides using a control primer in a control experiment;

FIG. 36 shows the results of the specificity of detection of Mucor circinelloides using the primers provided by the present invention in a comparative experiment;

FIG. 37 shows the results of specificity of detection of Mucor circinelloides using a control primer in a control experiment;

FIG. 38 shows the results of sensitivity in comparative experiments for detecting Rhizomucor pusillus using the primers provided by the present invention;

FIG. 39 shows the results of sensitivity of detection of Rhizomucor pusillus using control primers in a control experiment;

FIG. 40 shows the results of the specificity of detection of Rhizomucor pusillus using the primers provided by the present invention in a comparative experiment;

FIG. 41 shows the results of specificity of detection of Rhizomucor pusillus using control primers in a control experiment.

Detailed Description

The invention discloses a primer group and application thereof, and can be realized by appropriately improving process parameters by referring to the content in the text by a person skilled in the art. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The primer group and the raw materials, auxiliary materials and reagents used in the application of the primer group can be purchased from the market.

The experimental procedures in the following examples are conventional unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The quantitative tests in the following examples, all set up three replicates and the results averaged.

The reaction solution is a product of Boao biological group, Inc., and the catalog number is CP.440020.

The DNA copy number was calculated as follows:

1a260 absorbance value ds DNA 50 μ g/ml;

nucleic acid concentration (OD260) × (dilution factor) × (50) × ng/μ l;

average Molecular Weight (MW) represents grams per mole in daltons (dolton), i.e., 1dolton ═ 1 g/mol;

molar ratio is 6.02X 10²³；

Average Molecular Weight (MW) dsDNA ═ (number of bases) x (660 daltons/base);

copy number calculation formula:

(6.02×10²³copies/mole) × (x ng/. mu.l.times.10^-9) /(DNA length. times.660) ═ copies/. mu.l.

The invention is further illustrated by the following examples:

EXAMPLE 1 preparation of primer set I, primer set II, primer set III, primer set IV and primer set V

The kit consists of four LAMP primer groups, and each primer group is used for detecting candida.

Primer sets for detecting rhizopus oryzae were as follows (5 '→ 3'):

outer primer F3(SEQ ID No. 1): GGTAGCAAATCCAGTC, respectively;

outer primer B3(SEQ ID No. 2): CCTCCCAAGCGATC, respectively;

inner primer FIP (SEQ ID No. 3):

ACGGGTCGTGTCAAGGTTCTGGACTGCCTCCAA；

inner primer BIP (SEQ ID No. 4):

CGTCCATCTTGGCGATGTTGGGAATCCCCATGTTCA；

loop primer LF (SEQ ID No. 5): CCGGAGCCAATGACCT, respectively;

loop primer LB (SEQ ID No. 6): CTCAATCGGTCCATGC are provided.

Primer sets for detection of trichoderma umbellatum were as follows (5 '→ 3'):

outer primer F3(SEQ ID No. 7): GGGTAAAAAAGGTGGATG, respectively;

outer primer B3(SEQ ID No. 8): CATTGGATCCCTTTTTC, respectively;

inner primer FIP (SEQ ID No. 9):

CCAAGAGGTGAGGTTGGGATGTTGCCTCTTCAGCTTC；

inner primer BIP (SEQ ID No. 10):

TTCTGGTATTCACGAGACTGATGTTGGAGTACAAGTCCTTAC；

loop primer LF (SEQ ID No. 11): AGAGAGCCTCGGGA, respectively;

loop primer LB (SEQ ID No. 12): CATCATGAAGTGCGAT are provided.

Primer sets for detecting mucor circinelloides were as follows (5 '→ 3'):

outer primer F3(SEQ ID No. 13): GTTTGCTAGACCTGAATGG, respectively;

outer primer B3(SEQ ID No. 14): CTGCAAGAGCTGTTCGAA, respectively;

inner primer FIP (SEQ ID No. 15):

CACGACTGGTGCCATCGCCTGTTCCTCCACCTC；

inner primer BIP (SEQ ID No. 16):

ACTCACAAATTGTCTGACGTGCGAGCACCCTCTGATTCACAA；

loop primer LF (SEQ ID No. 17): ATTTGAATAGAGGGACGA, respectively;

loop primer LB (SEQ ID No. 18): AAGGCGAATGGTAACG are provided.

Primer sets for detection of rhizomucor pusillus were as follows (5 '→ 3'):

outer primer F3(SEQ ID No. 19): GGGTACGTCTAGTTC, respectively;

outer primer B3(SEQ ID No. 20): AAGTTCAGATCCATAGTTG, respectively;

inner primer FIP (SEQ ID No. 21):

ACAACATACAAATTGTTCGGGTACTTTGGATTTGCGGTG；

inner primer BIP (SEQ ID No. 22):

CCTTGAGGGTTTGCATTGGTGGTTGATTGACCTTTATACTT；

loop primer LF (SEQ ID No. 23): TTGAACGGATGAAAATCCA, respectively;

loop primer LB (SEQ ID No. 24): TACCAGTGTGCTTCGA are provided.

The primer set for detecting Rhizopus oryzae was named primer set I. The primer group for detecting mucor umbellate is named as primer group II. The primer set for detecting mucor circinelloides was named primer set III. The primer set for detecting Rhizomucor pusillus was named primer set IV.

The primer combination for detecting candida consists of a primer group I, a primer group II, a primer group III and a primer group IV, wherein in the primer combination, each single-stranded DNA is independently packaged.

In the primer group I, the molar ratio of a primer I-F3 to a primer I-B3 to a primer I-FIP to a primer I-BIP to a primer I-LF to a primer I-LB is 0.5: 0.5: 2: 2: 1: 1;

in the primer group II, the molar ratio of the primer II-F3 to the primer II-B3 to the primer II-FIP to the primer II-BIP to the primer II-LF to the primer II-LB is 0.5: 0.5: 2: 2: 1: 1;

in the primer group III, the molar ratio of a primer III-F3 to a primer III-B3 to a primer III-FIP to a primer III-BIP to a primer III-LF to a primer III-LB is 0.5: 0.5: 2: 2: 1: 1.

in the primer group IV, the molar ratio of a primer IV-F3 to a primer IV-B3 to a primer IV-FIP to a primer IV-BIP to a primer IV-LF to a primer IV-LB is 0.5: 0.5: 2: 2: 1: 1.

example 2 specificity of Mucor primer combination

Firstly, preparation of sample to be tested

1, sample to be tested: rhizopus oryzae plasmid

And 2, sample to be tested: mucor umbellatus plasmid

And 3, a sample to be detected: mucor circinelloides plasmid

And 4, sample to be detected: rhizomucor miehei plasmid

Rhizopus oryzae detection gene plasmid: DNA molecules of nucleotide with Genebank number AB167714.1 are inserted between MCS of pEasy-blunt plasmid (Beijing holotype gold biotechnology, Inc.) to obtain recombinant plasmid, namely the rhizopus oryzae detection gene plasmid.

Trichoderma umbellatum detection gene plasmid: DNA molecules of nucleotide with the GenBank number of GQ342716.1 are inserted between MCS of pEasy-blunt plasmid (Beijing all-type gold biotechnology, Inc.) to obtain recombinant plasmid, namely trichoderma umbellatum detection gene plasmid.

Detecting gene plasmid of mucor circinelloides: DNA molecules of nucleotide with Genebank number JF723861.2 are inserted between MCS of pUC57 plasmid (biological engineering (Shanghai) GmbH) to obtain recombinant plasmid, namely the plasmid of the detection gene of mucor circinelloides.

Rhizomucor pusillus detection gene plasmid: DNA molecules of nucleotide with the GenBank number of JQ683230.1 are inserted between MCS of pEasy-blunt plasmid (Beijing all-type gold biotechnology, Inc.) to obtain recombinant plasmid, and the plasmid is rhizomucor pusillus detection gene plasmid.

Second, detection of the sample to be detected

Each sample to be detected is detected by the following steps:

and (2) performing loop-mediated isothermal amplification detection on the plasmid DNA of the gene to be detected of rhizopus oryzae, the plasmid DNA of the gene to be detected of mucor umbellatus, the plasmid DNA of the gene to be detected of mucor circinelloides and the plasmid DNA of the gene to be detected of mucor microscopicus prepared in the step one by using the genome in the step one as a template and respectively adopting the primer group I, the primer group II, the primer group III and the primer group IV prepared in the embodiment 1, wherein each primer combination detects four plasmids.

Reaction system (10 μ L): 7.0. mu.L of the reaction mixture (product catalog No. CP.440020, product of Boo Bio Inc.), 1. mu.L of the primer mixture, 1. mu.L of the template DNA (5pg-50pg), and 10. mu.L of water were added. The primer mixture is a mixture consisting of each primer in a primer group I, a primer group II, a primer group III or a primer group IV. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 were 0.5. mu.M, the final concentrations of the inner primer FIP and the inner primer BIP were 2. mu.M, and the final concentrations of the loop primer LF and the loop primer LB were 1. mu.M.

Reaction conditions are as follows: keeping the temperature at 65 ℃ for 50 min.

In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.

The results using primer set I are shown in FIG. 1. The positive amplification curve is only shown when the sample to be tested is the Rhizopus oryzae genome (i.e., the amplification curve is a typical "sigmoid" amplification curve, as indicated by Rhizopus oryzae in FIG. 1). And when the sample to be detected is a sample 2, a sample 3 or a sample 4 to be detected, a positive amplification curve is not displayed. FIG. 1 shows the result of the sample 1; in fig. 1, one of the non-S-shaped amplification curves is the result of the sample to be detected 2, the sample to be detected 3, and the sample to be detected 4, and the others are the results without the template.

The results using primer set II are shown in FIG. 2. The positive amplification curve is only shown when the sample to be tested is the genome of trichoderma umbellatum (i.e. the amplification curve is a typical "S-shaped" amplification curve, as indicated by trichoderma umbellatum in FIG. 2). And when the samples to be detected are the samples 1, 3 and 4 to be detected, the positive amplification curve is not displayed. Fig. 2 shows the result of the sample 2; in fig. 2, one of the non-S-shaped amplification curves is the result of the sample 1 to be detected, the sample 3 to be detected, and the sample 4 to be detected, and the rest are the results without the template.

The results using primer set III are shown in FIG. 3. The positive amplification curve is only shown when the sample to be tested is the genome of mucor circinelloides (i.e., the amplification curve is a typical "S-shaped" amplification curve, as indicated by mucor circinelloides in FIG. 3). And when the samples to be detected are the samples 1, 2 and 4 to be detected, the positive amplification curve is not displayed. Fig. 3 shows the result of the sample 3; in fig. 3, one of the non-S-shaped amplification curves is the result of the sample 1 to be detected, the sample 2 to be detected, and the sample 4 to be detected, and the rest are the results without the template.

The results using primer set IV are shown in FIG. 4. The positive amplification curve is only shown when the sample to be tested is the Rhizomucor pusillus genome (i.e., the amplification curve is a typical "S-shaped" amplification curve, and the curve indicated by Rhizomucor pusillus in FIG. 4). And when the sample to be detected is the sample 1, the sample 2 or the sample 3 to be detected, a positive amplification curve is not displayed. Fig. 4 shows the result of the sample 4 to be tested; in fig. 4, one of the non-S-shaped amplification curves is the result of the sample 1 to be detected, the sample 2 to be detected, and the sample 3 to be detected, and the others are the results without the template.

The results show that the four primer groups in the primer combination for Mucor fungi provided by the invention have high specificity to the target genes of the primer combination.

Example 3 sensitivity of Mucor fungus identification primer combinations

1, sample to be tested: plasmid DNA of the gene to be tested for Rhizopus oryzae of example 2.

And 2, sample to be tested: plasmid DNA of the gene to be tested for Mucor umbellatus of example 2.

And 3, a sample to be detected: plasmid DNA of the gene to be tested for Mucor circinelloides of example 2.

And 4, sample to be detected: plasmid DNA of the Rhizomucor miehei test gene of example 2.

1. And (3) carrying out gradient dilution on the gene plasmid DNA to be detected by using sterile water to obtain each diluent.

2. The diluent obtained in step 1 was used as a template for loop-mediated isothermal amplification using the primer set I, the primer set II, the primer set III or the primer set IV prepared in example 1, respectively.

And when the sample to be detected is the sample 1 to be detected, performing loop-mediated isothermal amplification by using the primer group I. And when the sample to be detected is the sample 2 to be detected, performing loop-mediated isothermal amplification by using the primer group II. And when the sample to be detected is a sample 3 to be detected, performing loop-mediated isothermal amplification by using the primer group III. And when the sample to be detected is a sample 4 to be detected, performing loop-mediated isothermal amplification by using the primer group IV.

Reaction system (10 μ L): 7.0. mu.L of the reaction mixture (product catalog No. CP.440020, product of Boo Bio Inc.), 1. mu.L of the primer mixture, and 1. mu.L of the diluent (each 1. mu.L of the diluent contains 10 copies of the genome³、10²Or 10¹) Water was added to 10. mu.L. The primer mixture is a mixture consisting of each primer in a primer group I, a primer group II, a primer group III or a primer group IV. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 were 0.5. mu.M, the final concentrations of the inner primer FIP and the inner primer BIP were 2. mu.M, and the final concentrations of the loop primer LF and the loop primer LB were 1. mu.M.

According to the difference of genome copy number in dilution, the following 12 reaction systems are used in total:

reaction system 1: the copy numbers of the plasmid DNA of Rhizopus oryzae contained in 1. mu.L of the dilution were 10³；

Reaction system 2: the copy numbers of the plasmid DNA of Rhizopus oryzae contained in 1. mu.L of the dilution were 5X 10²；

Reaction system 3: the copy numbers of the plasmid DNA of Rhizopus oryzae contained in 1. mu.L of the dilution were 10²；

Reaction system 4: mucor umbellate plasmid contained in 1. mu.L of dilutionDNA copy numbers were 10 respectively³；

Reaction system 5: the copy numbers of the Mucor umbellatus plasmid DNA contained in 1. mu.L of the dilution were 5X 10²；

Reaction system 6: the copy numbers of the Mucor umbellatus plasmid DNA contained in 1. mu.L of the dilution were 10²；

Reaction system 7: the respective copy numbers of the plasmid DNA of Mucor circinelloides contained in 1. mu.L of the dilution were 10³；

Reaction system 8: the copy numbers of the plasmid DNA of Mucor circinelloides contained in 1. mu.L of the dilution were 5X 10²；

Reaction system 9: the respective copy numbers of the plasmid DNA of Mucor circinelloides contained in 1. mu.L of the dilution were 10²；

Reaction system 10: the copy numbers of the Rhizomucor miehei plasmid DNA contained in 1. mu.L of the dilution were 10 respectively³；

Reaction system 11: the copy numbers of the Rhizomucor miehei plasmid DNA contained in 1. mu.L of the dilution were 5X 10²；

Reaction system 12: the copy numbers of the Rhizomucor miehei plasmid DNA contained in 1. mu.L of the dilution were 10 respectively²。

Each reaction system was set up for 20 replicates.

If a positive amplification curve (i.e., an amplification curve that is typically a "sigmoid" amplification curve) appears within 50min, it indicates that the corresponding genomic content in the reaction system can be detected. If no positive amplification curve (i.e. amplification curve is typical "S-type" amplification curve) appears within 50min, it indicates that the corresponding genome content in the reaction system cannot be detected.

The results are shown in FIGS. 5 to 16.

Primer group I for detecting the genome copy number of target genes in 1 mu L of diluent to be 10³(FIG. 5) and 5X 10²(FIG. 6) 20 assays were all detectable with good reproducibility, 10²(FIG. 7) since 20 detections did not show complete peak and were poor in reproducibility, the sensitivity of the primer set I was 5X 10²Number of copies/reaction system.

Primer set II detectionThe number of copies of the target gene in the genome in 1. mu.L of the dilution was 10³(FIG. 8) and 5X 10²(FIG. 9) 20 assays were all detectable with good reproducibility, 10²FIG. 10 shows that 20 of the samples were not completely detected and had poor reproducibility, and thus the sensitivity of the primer set II was 5X 10²Number of copies/reaction system.

Primer group III for detecting genome copy number of target gene in 1 mu L diluent to be 10³(FIG. 11) and 5X 10²(FIG. 12) 20 assays were all detectable with good reproducibility, 10²(FIG. 13) since 20 detections did not show a complete peak and were poor in reproducibility, the sensitivity of primer set III was 5X 10²Number of copies/reaction system.

The genome copy number of the primer group IV detection target gene in 1 mu L diluent is 10³(FIG. 14) and 5X 10²(FIG. 15) 20 assays were all detectable with good reproducibility, 10²(FIG. 16) since 20 detections were incomplete and poor in reproducibility, the sensitivity of the primer set IV was 5X 10²Number of copies/reaction system.

EXAMPLE 4 screening of reaction systems

A sample to be detected: rhizomucor pusillus detection gene plasmid: DNA molecules of nucleotide with the GenBank number of JQ683230.1 are inserted between MCS of pEasy-blunt plasmid (Beijing all-type gold biotechnology, Inc.) to obtain recombinant plasmid, and the plasmid is rhizomucor pusillus detection gene plasmid.

1. And extracting plasmid DNA of a sample to be detected, and performing gradient dilution by using sterile water to obtain each diluent.

2. Using the dilution obtained in step 1 as a template, the primer set I prepared in example 1 was used to perform loop-mediated isothermal amplification.

Reaction 1(10 μ L): 7.0. mu.L of the reaction mixture (product of Boo Bio Inc., catalog No. CP.440020), 1. mu.L of the primer mixture, and 1. mu.L of the diluent (the number of copies of the genome contained in 1. mu.L of the diluent was 5X 10)²copies), water to 10 μ L.

Reaction 2(10 μ L): 6.7. mu.L of the reaction solution (product of Boo Bio Inc., catalog No. of Boo Bio Inc.)CP.440020), 1.2. mu.L of the primer mixture, and 1. mu.L of the dilution (the number of copies of the genome contained in 1. mu.L of the dilution was 5X 10)²copies), water to 10 μ L.

Reaction 3(10 μ L): 6.5. mu.L of the reaction mixture (product catalog No. CP.440020, product of Boo Bio Inc.), 1.3. mu.L of the primer mixture, and 1. mu.L of the dilution (the number of copies of the genome contained in 1. mu.L of the dilution is 5X 10)²copies), water to 10 μ L.

Reaction 4(10 μ L): 7.3. mu.L of the reaction mixture (product catalog No. CP.440020, product of Boo Bio Inc.), 0.8. mu.L of the primer mixture, and 1. mu.L of the dilution (the number of copies of the genome contained in 1. mu.L of the dilution is 5X 10)²copies), water to 10 μ L.

Reaction 5(10 μ L): 7.5. mu.L of the reaction mixture (product catalog No. CP.440020, product of Boo Bio Inc.), 0.7. mu.L of the primer mixture, and 1. mu.L of the dilution (the number of copies of the genome contained in 1. mu.L of the dilution is 5X 10)²copies), water to 10 μ L.

The primer mixture is a mixture consisting of the primers of the primer group I. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 were 0.5. mu.M, the final concentrations of the inner primer FIP and the inner primer BIP were 2. mu.M, and the final concentrations of the loop primer LF and the loop primer LB were 1. mu.M.

In the reaction process, a constant temperature amplification instrument is adopted to detect the fluorescence signal.

Each reaction system was set up for 8 replicates.

The results are shown in FIGS. 17-21. The primer combination can detect 8 detection target genes in the reaction system 1, the reaction system 2 and the reaction system 4, and has good repeatability, and the primer combination can detect 8 detection target genes in the reaction system 3 and the reaction system 5, and can not completely peak and has poor repeatability.

Therefore, the proportion of the reaction system is determined as follows: reaction system 10 μ L: (6.7 to 7.3) uL of the reaction mixture (product catalog number CP.440020 of Boo Bio Inc.), (0.8 to 1.2) uL of the primer combination, and 1 uL of the diluent (genome copy number 5 x 10 contained in 1 uL of the diluent)²copies), water to 10 μ L.

Example 5 detection of clinical specimens Using Mucor-fungal identification primer combinations

The sample to be detected is the following sample I, sample II, sample III or sample IV:

a first sample: human alveolar lavage fluid containing Rhizopus oryzae has been identified by PCR sequencing;

sample two: human alveolar lavage fluid containing mucor umbellatus has been identified by PCR sequencing;

sample three: human alveolar lavage fluid containing mucor circinelloides has been confirmed by PCR sequencing identification;

sample four: human alveolar lavage fluid containing rhizomucor pusillus has been identified by PCR sequencing.

1. And extracting the total DNA of the sample to be detected.

2. Taking the total DNA extracted in the step 1 as a template, respectively adopting each primer group prepared in the embodiment 1 to perform loop-mediated isothermal amplification on the four samples, and detecting the four samples by each primer group.

The reaction system and reaction conditions were the same as in example 2.

The results for sample one are shown in FIG. 22. Only when the primer set I is used for detection, a positive amplification curve is shown. When three other primer groups except the primer group I are adopted, a positive amplification curve is not shown, and the conditions are consistent with the actual conditions. FIG. 22 shows the results of the primer set I; in FIG. 22, one of the non "S-type" amplification curves is the result of primer set II, primer set III and primer set IV, respectively, and the rest are the results without template.

The results for sample two are shown in FIG. 23. Only when the detection was carried out by using the primer set II, a positive amplification curve was shown. When three other primer groups except the primer group II are adopted, no positive amplification curve is shown, and the conditions are consistent with the actual conditions. FIG. 23 shows the results of the primer set II; in FIG. 23, one of the non "S-type" amplification curves is the result of primer set I, primer set III and primer set IV, respectively, and the rest are the results without template.

The results for sample three are shown in figure 24. A positive amplification curve was shown only when the detection was performed with primer set III. When three other primer groups except the primer group III are adopted, a positive amplification curve is not shown, and the conditions are consistent with the actual conditions. FIG. 24 shows the results of the primer set III; in FIG. 24, one of the non "S-type" amplification curves is the result of primer set I, primer set II and primer set IV, respectively, and the rest are the results without template.

The results for sample four are shown in FIG. 25. A positive amplification curve was shown only when the detection was performed with primer set IV. When three other primer groups except the primer group IV are adopted, a positive amplification curve is not shown, and the condition is consistent with the actual condition. FIG. 25 shows the results of the primer set IV; in FIG. 25, one of the non "S-type" amplification curves is the result of primer set I, primer set II and primer set III, respectively, and the rest are the results without template added.

The results show that the candida identification primer combination provided by the invention can be used for detecting 4 common mucorales, and the results are accurate and reliable.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Comparative test

Trichoderma umbellatum (Fr.) kummer

Comparing primer sequences:

TABLE 1

F3-1	SEQ ID No.25	gggtaacgagcggta
			B3-1	SEQ ID No.26	atccctttttccctttt
FIP-1	SEQ ID No.27	aagaggtgaggttgggatgttgcctcttcagcttcc
			BIP-1	SEQ ID No.28	gcttctggtattcacgagactgatgttggagtacaagtcctt
LF-1	SEQ ID No.29	agagagcctcgggagc
			LB-1	SEQ ID No.30	taactccatcatgaagt

And performing a comparison test by adopting the existing primer sequence and the comparison primer sequence.

And (3) sensitivity comparison:

experiment design: the present primers and the control primers were used to perform a detection-limited 20-repeat amplification.

Reaction system (10 μ L):7.0. mu.L of the reaction mixture (product catalog No. CP.440020 available from Boo Bio Inc.), 1. mu.L of the primer mixture, and 1. mu.L of the diluent (the number of copies of the genome contained in 1. mu.L of the diluent is 5X 10)²) Water was added to 10. mu.L. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 were 0.5. mu.M, the final concentrations of the inner primer FIP and the inner primer BIP were 2. mu.M, and the final concentrations of the loop primer LF and the loop primer LB were 1. mu.M.

Reaction primers: current primer and comparative primer

As a result: the repeatability of the primer adopted is superior to that of the comparative primer.

And (3) specific comparison:

experiment design: and (3) amplifying three unrelated bacterium templates by using the existing primer and the comparative primer.

The above three plasmids were prepared.

Reaction system (10 μ L): 7.0. mu.L of the reaction mixture (product catalog No. CP.440020 available from Boo Bio Inc.), 1. mu.L of the primer mixture, and 1. mu.L of the diluent (the number of copies of the template contained in 1. mu.L of the diluent is 10)⁴) Water was added to 10. mu.L. The primer mixture is the mixture of each primer in the primer group I or the primer group II. In the reaction system, the outer primer F3 and an external primerThe final concentrations of B3 were 0.5. mu.M, the final concentrations of the inner primers FIP and BIP were 2. mu.M, and the final concentrations of the loop primers LF and LB were 1. mu.M, respectively.

Reaction primers: current primer and comparative primer

As a result: the existing primers have good specificity and no non-specific amplification; the primers were compared for non-specific amplification of Rhizopus oryzae.

2 Rhizopus oryzae

Comparing primer sequences:

TABLE 2

F3-2	SEQ ID No.31	GACTGCCTCCAAACC
			B3-2	SEQ ID No.32	CGCTTTACCTGATATCGC
FIP-2	SEQ ID No.33	GCATGGACCGATTGAGGATTGACAGGCTCCGGTACCTA
			BIP-2	SEQ ID No.34	CTTGGGTGAACATGGGGAGGGAAACTTGTCAACGGCT
LF-2	SEQ ID No.35	AGACATCGCCAAGAT
			LB-2	SEQ ID No.36	GGAGGCTGCTTCGA

And (3) sensitivity comparison:

Reaction system (10 μ L): 7.0. mu.L of the reaction mixture (product catalog No. CP.440020 available from Boo Bio Inc.), 1. mu.L of the primer mixture, and 1. mu.L of the diluent (the number of copies of the genome contained in 1. mu.L of the diluent is 5X 10)²) Water was added to 10. mu.L. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 were 0.5. mu.M, the final concentrations of the inner primer FIP and the inner primer BIP were 2. mu.M, and the final concentrations of the loop primer LF and the loop primer LB were 1. mu.M.

Reaction primers: current primer and comparative primer

And (3) specific comparison:

The above three plasmids were prepared.

Reaction system (10 μ L): 7.0. mu.L of the reaction mixture (product catalog No. CP.440020 available from Boo Bio Inc.), 1. mu.L of the primer mixture, and 1. mu.L of the diluent (the number of copies of the template contained in 1. mu.L of the diluent is 10)⁴) Water was added to 10. mu.L. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 were 0.5. mu.M, the final concentrations of the inner primer FIP and the inner primer BIP were 2. mu.M, and the final concentrations of the loop primer LF and the loop primer LB were 1. mu.M.

Reaction primers: current primer and comparative primer

As a result: the existing primers have good specificity and no non-specific amplification; the control primer shows non-specific amplification of Rhizomucor miehei/Mucor circinelloides/Mucor umbellatus.

3 Mucor circinelloides

Comparing primer sequences:

TABLE 3

F3-3	SEQ ID No.37	CTCCACCTCAAGTTCG
			B3-3	SEQ ID No.38	CAAACATCCATTCAACATC
FIP-3	SEQ ID No.39	GCACGTCAGACAATTTGTGAGTCACTCTATTCAAATGGATGG
			BIP-3	SEQ ID No.40	GAATGGTAACGTGAAGCTGCAAGAGCTGTTCGAATT
LF-3	SEQ ID No.41	TCGTCTTCACCACGA
			LB-3	SEQ ID No.42	CGTTGTGAATCAGAGGG

And (3) sensitivity comparison:

Reaction primers: current primer and comparative primer

And (3) specific comparison:

The above three plasmids were prepared.

Reaction system (10 μ L): 7.0. mu.L of the reaction mixture (product catalog No. CP.440020 available from Boo Bio Inc.), 1. mu.L of the primer mixture, and 1. mu.L of the diluent (the copy number of the mixed template contained in 1. mu.L of the diluent is 10)⁴) Water was added to 10. mu.L. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 were 0.5. mu.M, the final concentrations of the inner primer FIP and the inner primer BIP were 2. mu.M, and the final concentrations of the loop primer LF and the loop primer LB were 1. mu.M.

Reaction primers: current primer and comparative primer

4 Rhizomucor miehei

Comparing primer sequences:

F3-4	SEQ ID No.43	AGAAATGATTCAAGACGA
			B3-4	SEQ ID No.44	GGGGTTAATAAAGATACTGA
FIP-4	SEQ ID No.45	CATTTGCTACGCTCTTCAAAACAACTTTAAGCAATGGATCAC
			BIP-4	SEQ ID No.46	AAGTAATGCGATCTGCAGCCTTGACGTACCCAATGGATG
LF-4	SEQ ID No.47	TGCGAGAACCAA
			LB-4	SEQ ID No.48	TCATCGAATTCTCGAA

And (3) sensitivity comparison:

Reaction system (10 μ L): 7.0. mu.L of the reaction solution (product of Boo Bio Inc., catalog No. CP.440020), 1. mu.L of the primer mixture, and 1. mu.L of a diluentRelease solution (genome copy number contained in 1. mu.L dilution 5X 10)²) Water was added to 10. mu.L. The primer mixture is the mixture of each primer in the primer group I or the primer group II. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 were 0.5. mu.M, the final concentrations of the inner primer FIP and the inner primer BIP were 2. mu.M, and the final concentrations of the loop primer LF and the loop primer LB were 1. mu.M.

Reaction primers: current primer and comparative primer

The reaction was repeated: 20 repeat

And (3) specific comparison:

The above three plasmids were prepared.

Reaction system (10 μ L): 7.0. mu.L of the reaction mixture (product catalog No. CP.440020 available from Boo Bio Inc.), 1. mu.L of the primer mixture, and 1. mu.L of the diluent (the number of copies of the template contained in 1. mu.L of the diluent is 10)⁴) Water was added to 10. mu.L. In the reaction system, the final concentration of the outer primer F3 and the final concentration of the outer primer B3 are both 0.5 mu M, and the final concentration of the inner primer FIP and the final concentration of the inner primer BIP are both 0.5 mu MThe final concentrations of (A) and (B) were 2. mu.M, and the final concentrations of the loop primers LF and LB were 1. mu.M, respectively.

Reaction primers: current primer and comparative primer

Sequence listing

<110> Boao bionts Ltd

<120> primer set and use thereof

<130> MP1729047

<160> 48

<170> SIPOSequenceListing 1.0

<210> 1

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggtagcaaat ccagtc 16

<210> 2

<211> 14

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cctcccaagc gatc 14

<210> 3

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acgggtcgtg tcaaggttct ggactgcctc caa 33

<210> 4

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgtccatctt ggcgatgttg ggaatcccca tgttca 36

<210> 5

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccggagccaa tgacct 16

<210> 6

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctcaatcggt ccatgc 16

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gggtaaaaaa ggtggatg 18

<210> 8

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cattggatcc ctttttc 17

<210> 9

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ccaagaggtg aggttgggat gttgcctctt cagcttc 37

<210> 10

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ttctggtatt cacgagactg atgttggagt acaagtcctt ac 42

<210> 11

<211> 14

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

agagagcctc ggga 14

<210> 12

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

catcatgaag tgcgat 16

<210> 13

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gtttgctaga cctgaatgg 19

<210> 14

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ctgcaagagc tgttcgaa 18

<210> 15

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cacgactggt gccatcgcct gttcctccac ctc 33

<210> 16

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

actcacaaat tgtctgacgt gcgagcaccc tctgattcac aa 42

<210> 17

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

atttgaatag agggacga 18

<210> 18

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aaggcgaatg gtaacg 16

<210> 19

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gggtacgtct agttc 15

<210> 20

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aagttcagat ccatagttg 19

<210> 21

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

acaacataca aattgttcgg gtactttgga tttgcggtg 39

<210> 22

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ccttgagggt ttgcattggt ggttgattga cctttatact t 41

<210> 23

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

ttgaacggat gaaaatcca 19

<210> 24

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

taccagtgtg cttcga 16

<210> 25

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gggtaacgag cggta 15

<210> 26

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

atcccttttt ccctttt 17

<210> 27

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

aagaggtgag gttgggatgt tgcctcttca gcttcc 36

<210> 28

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

gcttctggta ttcacgagac tgatgttgga gtacaagtcc tt 42

<210> 29

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

agagagcctc gggagc 16

<210> 30

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

taactccatc atgaagt 17

<210> 31

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

gactgcctcc aaacc 15

<210> 32

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

cgctttacct gatatcgc 18

<210> 33

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

gcatggaccg attgaggatt gacaggctcc ggtaccta 38

<210> 34

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

cttgggtgaa catggggagg gaaacttgtc aacggct 37

<210> 35

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

agacatcgcc aagat 15

<210> 36

<211> 14

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

ggaggctgct tcga 14

<210> 37

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

ctccacctca agttcg 16

<210> 38

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

caaacatcca ttcaacatc 19

<210> 39

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

gcacgtcaga caatttgtga gtcactctat tcaaatggat gg 42

<210> 40

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

gaatggtaac gtgaagctgc aagagctgtt cgaatt 36

<210> 41

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

tcgtcttcac cacga 15

<210> 42

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

cgttgtgaat cagaggg 17

<210> 43

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

agaaatgatt caagacga 18

<210> 44

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

ggggttaata aagatactga 20

<210> 45

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

catttgctac gctcttcaaa acaactttaa gcaatggatc ac 42

<210> 46

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

aagtaatgcg atctgcagcc ttgacgtacc caatggatg 39

<210> 47

<211> 12

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

tgcgagaacc aa 12

<210> 48

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

tcatcgaatt ctcgaa 16

Claims

1. A combination of the primers, wherein,

the primer set I, the primer set II, the primer set III and the primer set IV are combined;

the nucleotide sequence of the primer I-F3 is shown as SEQ ID NO. 1;

the nucleotide sequence of the primer I-B3 is shown as SEQ ID NO. 2;

the nucleotide sequence of the primer I-FIP is shown as SEQ ID NO. 3;

the nucleotide sequence of the primer I-BIP is shown as SEQ ID NO. 4;

the nucleotide sequence of the primer I-LF is shown as SEQ ID NO. 5;

the nucleotide sequence of the primer I-LB is shown in SEQ ID NO. 6;

the nucleotide sequence of the primer II-F3 is shown as SEQ ID NO. 7;

the nucleotide sequence of the primer II-B3 is shown as SEQ ID NO. 8;

the nucleotide sequence of the primer II-FIP is shown as SEQ ID NO. 9;

the nucleotide sequence of the primer II-BIP is shown as SEQ ID NO. 10;

the nucleotide sequence of the primer II-LF is shown as SEQ ID NO. 11;

the nucleotide sequence of the primer II-LB is shown in SEQ ID NO. 12;

the nucleotide sequence of the primer III-F3 is shown as SEQ ID NO. 13;

the nucleotide sequence of the primer III-B3 is shown as SEQ ID NO. 14;

the nucleotide sequence of the primer III-FIP is shown as SEQ ID NO. 15;

the nucleotide sequence of the primer III-BIP is shown as SEQ ID NO. 16;

the nucleotide sequence of the primer III-LF is shown as SEQ ID NO. 17;

the nucleotide sequence of the primer III-LB is shown in SEQ ID NO. 18;

the nucleotide sequence of the primer IV-F3 is shown as SEQ ID NO. 19;

the nucleotide sequence of the primer IV-B3 is shown as SEQ ID NO. 20;

the nucleotide sequence of the primer IV-FIP is shown as SEQ ID NO. 21;

the nucleotide sequence of the primer IV-BIP is shown as SEQ ID NO. 22;

the nucleotide sequence of the primer IV-LF is shown as SEQ ID NO. 23;

the nucleotide sequence of the primer IV-LB is shown in SEQ ID NO. 24.

2. The primer combination of claim 1, wherein the molar ratio of the primer I-F3, the primer I-B3, the primer I-FIP, the primer I-BIP, the primer I-LF and the primer I-LB in the primer set I is 0.5: 0.5: 2: 2: 1: 1;

in the primer group III, the molar ratio of the primer III-F3 to the primer III-B3 to the primer III-FIP to the primer III-BIP to the primer III-LF to the primer III-LB is 0.5: 0.5: 2: 2: 1: 1;

3. use of a primer combination according to claim 1 or 2 for the amplification of a nucleic acid molecule of Rhizopus oryzae, Mucor umbellatus, Mucor circinelloides and/or Rhizomucor pusillus for non-disease diagnostic purposes.

4. Use of a primer combination according to claim 1 or 2 for the detection and/or identification of Rhizopus oryzae, Mucor umbellatus, Mucor circinelloides and/or Rhizomucor pusillus for non-disease diagnostic purposes.

5. Use of a primer combination according to claim 1 or 2 for the preparation of a kit for the detection and/or identification of Rhizopus oryzae, Mucor umbellatus, Mucor circinelloides and/or Rhizomucor miehei.

6. A kit comprising a primer combination according to claim 1 or 2, wherein the use of the kit comprises:

7. A method for identifying rhizopus oryzae, mucor umbellate, mucor circinelloides and/or rhizomucor pusillus for non-disease diagnostic purposes, comprising the steps of:

(2) taking the plasmid DNA extracted in the step (1) as a template, and respectively adopting the primers in the primer combination according to claim 1 or 2 to carry out loop-mediated isothermal amplification to obtain an amplification result;

8. The method according to claim 7, wherein if the primer set I is used to achieve specific amplification using the plasmid DNA as a template, the test bacterium contains or is a candidate for containing Rhizopus oryzae;

9. A method for detecting whether a sample to be detected contains Rhizopus oryzae, Mucor umbellatus, Mucor circinelloides and/or Rhizomucor pusillus for non-disease diagnosis purposes is characterized by comprising the following steps:

(1) obtaining the total DNA of a sample to be detected;

(2) taking the total DNA extracted in the step (1) as a template, and respectively adopting the primers in the primer combination according to claim 1 or 2 to carry out loop-mediated isothermal amplification to obtain an amplification result;

(3) and obtaining a detection result according to the amplification result.

10. The method according to claim 9, wherein if the primer set i is used to achieve specific amplification using the total DNA as a template, a sample to be tested containing or suspected of containing rhizopus oryzae;