CN109706145A

CN109706145A - Primer sets and its application

Info

Publication number: CN109706145A
Application number: CN201811631669.5A
Authority: CN
Inventors: 张岩; 王颢婷; 高占成; 邢婉丽; 陈燕旌; 程京
Original assignee: CapitalBio Corp
Current assignee: CapitalBio Corp
Priority date: 2018-12-29
Filing date: 2018-12-29
Publication date: 2019-05-03
Anticipated expiration: 2038-12-29
Also published as: CN109706145B

Abstract

The present invention relates to field of biotechnology, in particular to primer sets and its application.The invention discloses a kind of for 4 kinds of fungi LAMP primer compositions of Mucoales and its application.Primer combination provided by the invention, 24 primers shown in No.1~24 SEQ ID form.Primer combination provided by the invention can be applied to detect whether can be applied in detection sample to be tested whether contain rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and/or Rhizomucor pusillus containing rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and/or Rhizomucor pusillus.4 kinds of fungies for Mucoales are identified in primer combination provided by the invention, have high specific and high sensitivity, and simplicity may be implemented, quickly, accurately detect.The present invention has great promotional value.

Description

Primer sets and its application

Technical field

The present invention relates to field of biotechnology, in particular to primer sets and its application.

Background technique

Studies of invasive fungal infections (invasive fungal disease, IFD) is also known as invasive infections with fungi (invasive Fungal infection, IFI), deep fungal infection (deep fungal infection, DFI), refer to fungi invade people Body tissue, blood grow wherein and breed, cause inflammatory reaction, and cause the pathology of histologic lesion, organ dysfunction raw Reason process.Over nearly twenty or thirty year, with the new technologies such as solid organ and hematopoietic stem cell transplantation, chemotherapy of tumors, immunosuppressor Extensive use in clinic increases the disease incidence of studies of invasive fungal infections and case fatality rate year by year, and having become causes to be hospitalized One of the main reason for death.ICU is moved in since infection studies of invasive fungal infections is mainly in, advanced age, diabetes, hematologic Systemic disease, candida albicans field planting, invasion operation, using in the crowds such as antibacterials, glucocorticoid, immunosuppressor, Immunity of organisms is low, and the severe death rate is high, therefore early detection to invasive infections with fungi and determines that infection bacteria species have pole For important meaning.

Mucoales fungi belongs to Zygomycetes, and type is more in nature, may be present in the pars oralis pharyngis of people, is the machine of human body Can pathogenic bacteria, wherein the pathogen of human infection is caused mainly to include rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and small Root Mucor etc. can lead to mucormycosis (mucormycosis).Disease morbidity is anxious, and progress is fast, and the death rate is high.Susceptible population is to exempt from Epidemic disease inhibition person, diabetes ketoacidosis disease patient, the Patients with Chronic Renal Disease etc. of Deferoxamine treatment.

Existing invasive infections with fungi detection method mainly includes routine inspection method and two kinds of special examined method.Wherein often Rule inspection technique specifically includes that 1) fungi microscope inspection, i.e. direct smear dyeing microscopic examination；2) fungal culture is identified；3) histopathology It learns and checks.Special examined method specifically includes that 1) Serological testing；2) Bio-molecular analysis.Wherein routine inspection method is still regarded For the foundation stone for making a definite diagnosis invasive infections with fungi, but its that there are susceptibilitys is lower, operate complicated, negative findings can not rule out diagnosis, The problems such as detection cycle longer (it is generally necessary to time of a few days to a few weeks), and lead to delay treatment and medication, increase the death rate Deng；Serologic detection is difficult to exclude the inter-species antibody and antigen cross-reaction of the certain categories of fungi so as to cause erroneous judgement.Compare first two Method, Protocols in Molecular Biology have the advantages that high specific and high accuracy, and can be illustrated from gene level fungal population it Between and in taxonomic relation, thus be increasingly widely recognized and apply in recent years.The relevant molecule established at present Learning diagnostic method has regular-PCR method, Pulse field gel electrophoresis (PFGE), Multilocus sequence typing (MLST), restricted Fragment length polymorphism analyzes (RFLP), Real-Time Fluorescent Quantitative PCR Technique (RTFQ-PCR) etc., and shared problem is to experiment Operate more demanding, detection time longer (2.5h-3h) left and right.Therefore, fast and accurately molecular diagnosis method is established, for clinic There is provided early stage diagnosis and treatment foundation is the key that solve status.

Summary of the invention

In view of this, the present invention provides a kind of primer sets and its application.Primer combination identification is for detecting common four kinds Mucoales fungi has high specific and high sensitivity, and easy, quick, accurate detection may be implemented.The present invention has great Promotional value.

In order to achieve the above-mentioned object of the invention, the present invention the following technical schemes are provided:

The present invention provides primer combinations, for as follows (a1) or (a2) or (a3):

(a1), it is made of primer sets I, primer sets II, primer sets III and primer sets IV；

(a2), by any two in the primer sets I, the primer sets II, the primer sets III, the primer sets IV Composition；

(a3) including the primer sets I, the primer sets II, the primer sets III and the primer sets IV；

Wherein the primer sets I are by I-F3 of primer, I-B3 of primer, I-FIP of primer, I-BIP of primer, I-LF of primer and primer I-LB composition；

I-the F3 of primer has any one in nucleotide sequence as follows:

(b1), there is nucleotide sequence shown in SEQ ID NO:1；

(b2), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, deletion and/or addition one or more The nucleotide sequence that a base obtains；

(b3), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；

(b4), the complementary series of the sequence as shown in (b1), (b2) or (b3)；

I-the B3 of primer has any one in nucleotide sequence as follows:

(b5), there is nucleotide sequence shown in SEQ ID NO:2；

(b6), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, deletion and/or addition one or more The nucleotide sequence that a base obtains；

(b7), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；

(b8), the complementary series of the sequence as shown in (b5), (b6) or (b7)；

I-the FIP of primer has any one in nucleotide sequence as follows:

(b9), there is nucleotide sequence shown in SEQ ID NO:3；

(b10), have SEQ ID NO:3 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(b11), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:3；

(b12), the complementary series of the sequence as shown in (b9), (b10) or (b11)；

I-the BIP of primer has any one in nucleotide sequence as follows:

(b13), there is nucleotide sequence shown in SEQ ID NO:4；

(b14), have SEQ ID NO:4 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(b15), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；

(b16), the complementary series of the sequence as shown in (b13), (b14) or (b15)；

I-the LF of primer has any one in nucleotide sequence as follows:

(b17), there is nucleotide sequence shown in SEQ ID NO:5；

(b18), have SEQ ID NO:5 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(b19), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；

(b20), the complementary series of the sequence as shown in (b17), (b18) or (b19)；

I-the LB of primer has any one in nucleotide sequence as follows:

(b21), there is nucleotide sequence shown in SEQ ID NO:6；

(b22), have SEQ ID NO:6 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(b23), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:6；

(b24), the complementary series of the sequence as shown in (b21), (b22) or (b23)；

The primer sets II are by II-F3 of primer, II-B3 of primer, II-FIP of primer, II-BIP of primer, II-LF of primer and draw II-LB of object composition；

II-the F3 of primer has any one in nucleotide sequence as follows:

(c1), there is nucleotide sequence shown in SEQ ID NO:7；

(c2), have nucleotide sequence shown in SEQ ID NO:7 through modification, substitution, deletion and/or addition one or more The nucleotide sequence that a base obtains；

(c3), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:7；

(c4), the complementary series of the sequence as shown in (c1), (c2) or (c3)；

II-the B3 of primer has any one in nucleotide sequence as follows:

(c5), there is nucleotide sequence shown in SEQ ID NO:8；

(c6), have nucleotide sequence shown in SEQ ID NO:8 through modification, substitution, deletion and/or addition one or more The nucleotide sequence that a base obtains；

(c7), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:8；

(c8), the complementary series of the sequence as shown in (c5), (c6) or (c7)；

II-the FIP of primer has any one in nucleotide sequence as follows:

(c9), there is nucleotide sequence shown in SEQ ID NO:9；

(c10), have SEQ ID NO:9 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(c11), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:9；

(c12), the complementary series of the sequence as shown in (c9), (c10) or (c11)；

II-the BIP of primer has any one in nucleotide sequence as follows:

(c13), there is nucleotide sequence shown in SEQ ID NO:10；

(c14), have SEQ ID NO:10 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(c15), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:10；

(c16), the complementary series of the sequence as shown in (c13), (c14) or (c15)；

II-the LF of primer has any one in nucleotide sequence as follows:

(c17), there is nucleotide sequence shown in SEQ ID NO:11；

(c18), have SEQ ID NO:11 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(c19), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:11；

(c20), the complementary series of the sequence as shown in (c17), (c18) or (c19)；

II-the LB of primer has any one in nucleotide sequence as follows:

(c21), there is nucleotide sequence shown in SEQ ID NO:12；

(c22), have SEQ ID NO:12 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(c23), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:12；

(c24), the complementary series of the sequence as shown in (c21), (c22) or (c23)；

The primer sets III are by III-F3 of primer, III-B3 of primer, III-FIP of primer, III-BIP of primer, III-LF of primer and draw III-LB of object composition；

III-the F3 of primer has any one in nucleotide sequence as follows:

(d1), there is nucleotide sequence shown in SEQ ID NO:13；

(d2), have SEQ ID NO:13 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(d3), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:13；

(d4), the complementary series of the sequence as shown in (d1), (d2) or (d3)；

III-the B3 of primer has any one in nucleotide sequence as follows:

(d5), there is nucleotide sequence shown in SEQ ID NO:14；

(d6), have SEQ ID NO:14 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(d7), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:14；

(d8), the complementary series of the sequence as shown in (d5), (d6) or (d7)；

III-the FIP of primer has any one in nucleotide sequence as follows:

(d9), there is nucleotide sequence shown in SEQ ID NO:15；

(d10), have SEQ ID NO:15 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(d11), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:15；

(d12), the complementary series of the sequence as shown in (d9), (d10) or (d11)；

III-the BIP of primer has any one in nucleotide sequence as follows:

(d13), there is nucleotide sequence shown in SEQ ID NO:16；

(d14), have SEQ ID NO:16 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(d15), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:16；

(d16), the complementary series of the sequence as shown in (d13), (d14) or (d15)；

III-the LF of primer has any one in nucleotide sequence as follows:

(d17), there is nucleotide sequence shown in SEQ ID NO:17；

(d18), have SEQ ID NO:17 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(d19), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:17；

(d20), the complementary series of the sequence as shown in (d17), (d18) or (d19)；

III-the LB of primer has any one in nucleotide sequence as follows:

(d21), there is nucleotide sequence shown in SEQ ID NO:18；

(d22), have SEQ ID NO:18 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(d23), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:18；

(d24), the complementary series of the sequence as shown in (d21), (d22) or (d23)；

The primer sets IV are by IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-BIP of primer, IV-LF of primer and draw IV-LB of object composition；

IV-the F3 of primer has any one in nucleotide sequence as follows:

(e1), there is nucleotide sequence shown in SEQ ID NO:19；

(e2), have SEQ ID NO:19 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(e3), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:19；

(e4), the complementary series of the sequence as shown in (e1), (e2) or (e3)；

IV-the B3 of primer has any one in nucleotide sequence as follows:

(e5), there is nucleotide sequence shown in SEQ ID NO:20；

(e6), have SEQ ID NO:20 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(e7), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:20；

(e8), the complementary series of the sequence as shown in (e5), (e6) or (e7)；

IV-the FIP of primer has any one in nucleotide sequence as follows:

(e9), there is nucleotide sequence shown in SEQ ID NO:21；

(e10), have SEQ ID NO:21 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(e11), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:21；

(e12), the complementary series of the sequence as shown in (e9), (e10) or (e11)；

IV-the BIP of primer has any one in nucleotide sequence as follows:

(e13), there is nucleotide sequence shown in SEQ ID NO:22；

(e14), have SEQ ID NO:22 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(e15), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:22；

(e16), the complementary series of the sequence as shown in (e13), (e14) or (e15)；

IV-the LF of primer has any one in nucleotide sequence as follows:

(e17), there is nucleotide sequence shown in SEQ ID NO:23；

(e18), have SEQ ID NO:23 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(e19), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:23；

(e20), the complementary series of the sequence as shown in (e17), (e18) or (e19)；

IV-the LB of primer has any one in nucleotide sequence as follows:

(e21), there is nucleotide sequence shown in SEQ ID NO:24；

(e22), have SEQ ID NO:24 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(e23), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:24；

(e24), the complementary series of the sequence as shown in (e21), (e22) or (e23).

In some specific embodiments of the invention, I-F3 of primer described in the primer sets I, I-B3 of the primer, I-the FIP of primer, I-LB of I-BIP of the primer, I-LF of the primer and the primer molar ratio be 0.5:0.5:2:2: 1:1；

II-F3 of primer described in the primer sets II, II-B3 of the primer, II-FIP of the primer, the primer II- The molar ratio of II-LB of BIP, II-LF of the primer and the primer is 0.5:0.5:2:2:1:1.

III-F3 of primer described in the primer sets III, III-B3 of the primer, III-FIP of the primer, the primer III- The molar ratio of III-LB of BIP, III-LF of the primer and the primer is 0.5:0.5:2:2:1:1.

IV-F3 of primer, IV-B3 of the primer described in the primer sets IV, IV-FIP of the primer, the primer IV- The molar ratio of IV-LB of BIP, IV-LF of the primer and the primer is 0.5:0.5:2:2:1:1.

In some specific embodiments of the invention, in the primer sets I, the amount of each primer is as follows: described in 0.5 μm of ol I-B3 of primer described in I-F3 of primer, 0.5 μm of ol, I-BIP of primer, 1.0 μ described in I-FIP of primer, 2.0 μm of ol described in 2.0 μm of ol I-LB of primer described in I-LF and 1.0 μm of ol of primer described in mol.

In the primer sets II, the amount of each primer is as follows: primer II-described in II-F3 of primer, 0.5 μm of ol described in 0.5 μm of ol II-FIP of primer described in B3,2.0 μm of ol, II-LF and 1.0 μm of ol of primer described in II-BIP of primer, 1.0 μm of ol described in 2.0 μm of ol II-the LB of primer.

In the primer sets III, the amount of each primer is as follows: primer III-described in III-F3 of primer, 0.5 μm of ol described in 0.5 μm of ol III-FIP of primer described in B3,2.0 μm of ol, III-LF and 1.0 μm of ol of primer described in III-BIP of primer, 1.0 μm of ol described in 2.0 μm of ol III-the LB of primer.

In the primer sets IV, the amount of each primer is as follows: primer IV-described in IV-F3 of primer, 0.5 μm of ol described in 0.5 μm of ol IV-FIP of primer described in B3,2.0 μm of ol, IV-LF and 1.0 μm of ol of primer described in IV-BIP of primer, 1.0 μm of ol described in 2.0 μm of ol IV-the LB of primer.

The present invention also provides the primer combination amplification rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and/or Application in the nucleic acid molecules of Rhizomucor pusillus.

The present invention also provides primer combinations to detect and/or identify rhizopus oryzae, Lichtheimia corymbifera, volume branch hair Application in mould and/or Rhizomucor pusillus.

The present invention also provides primer combinations in preparation detection and/or identification rhizopus oryzae, Lichtheimia corymbifera, volume Application in the kit of branch mucor and/or Rhizomucor pusillus.

The present invention also provides the kit of primer combination, the purposes of the kit includes:

I, rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and/or Rhizomucor pusillus are identified；

II, it detects in sample to be tested and whether contains rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and/or small hair It is mould.

The kit may also include reaction solution, the reaction solution concretely Capitalbio Corporation Co., Ltd.'s product, Its catalog number is CP.440020.

The present invention also protects the preparation method of the kit, includes the steps that individually packing each primer.

The present invention also provides a kind of identification rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and/or Rhizomucor pusillus Method includes the following steps:

(1) Plasmid DNA of the testing gene of bacterium to be measured is obtained；

(2) for the Plasmid DNA extracted using step (1) as template, the primer being respectively adopted in the primer combination carries out ring Jie Isothermal duplication is led, amplification is obtained；

(3) qualification result is obtained according to the amplification.

In some specific embodiments of the invention, if the primer sets I is used to may be implemented with the Plasmid DNA For the specific amplification of template, contains in bacterium to be measured or candidate contains rhizopus oryzae；

If using the primer sets II to may be implemented using the Plasmid DNA as the specific amplification of template, in bacterium to be measured Contain or candidate contains Lichtheimia corymbifera；

If using the primer sets III to may be implemented using the Plasmid DNA as the specific amplification of template, in bacterium to be measured Contain or candidate contains Mucor circinelloides；

If using the primer sets IV to may be implemented using the Plasmid DNA as the specific amplification of template, in bacterium to be measured Contain or candidate contains Rhizomucor pusillus.

The present invention also provides whether contain rhizopus oryzae, Lichtheimia corymbifera, volume branch Mucor in a kind of detection sample to be tested The method of bacterium and/or Rhizomucor pusillus, includes the following steps:

(1) total DNA of sample to be tested is obtained；

(2) for the total DNA extracted using step (1) as template, the primer being respectively adopted in the primer combination carries out ring mediation Isothermal duplication obtains amplification；

(3) testing result is obtained according to the amplification.

In some specific embodiments of the invention, if use the primer sets I may be implemented be with the total DNA The specific amplification of template contains in sample to be tested or doubtful containing rhizopus oryzae；

If using the primer sets II to may be implemented using the total DNA as the specific amplification of template, in sample to be tested Contain or doubtful containing Lichtheimia corymbifera；

If using the primer sets III to may be implemented using the total DNA as the specific amplification of template, in sample to be tested Contain or doubtful containing Mucor circinelloides；

If using the primer sets IV to may be implemented using the total DNA as the specific amplification of template, in sample to be tested Contain or doubtful containing Rhizomucor pusillus.

In any description above method, when using the primer sets I, draw in the reaction system of the ring mediated isothermal amplification I-F3 of object, I-B3 of primer, I-FIP of primer, I-LB of I-BIP of primer, I-LF of primer and primer molar concentration be followed successively by 0.5 μM, 0.5μM、2μM、2μM、1μM、1μM。

In any description above method, when using the primer sets II, in the reaction system of the ring mediated isothermal amplification II-F3 of primer, II-B3 of primer, II-FIP of primer, II-LB of II-BIP of primer, II-LF of primer and primer molar concentration successively It is 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.

In any description above method, when using the primer sets III, in the reaction system of the ring mediated isothermal amplification III-F3 of primer, III-B3 of primer, III-FIP of primer, III-LB of III-BIP of primer, III-LF of primer and primer molar concentration successively It is 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.

In any description above method, when using the primer sets IV, in the reaction system of the ring mediated isothermal amplification IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-LB of IV-BIP of primer, IV-LF of primer and primer molar concentration successively It is 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.

In any description above method, loop-mediated isothermal amplification condition are as follows: 65 DEG C of constant temperature 50min.

In the present invention, the sample to be tested can be the bronchoalveolar lavage fluid of people (Homo sapiens).

In the present invention, the realization ring mediated isothermal amplification can specifically embody are as follows: be detected using quantitative fluorescent PCR When may occur in which ring mediated isothermal amplification curve.The ring mediated isothermal amplification curve can be typical " S type " amplification curve.

Loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) is in recent years Come a kind of sensitive, special, the simple, fast nucleic acid amplification technologies developed, principle is that have strand-displacement activity in one kind Archaeal dna polymerase under the action of, identify 6-8 region 4-6 primer, under isothermal conditions quickly, specifically expand purpose Gene can be applied to and fast and accurately detect common strain.LAMP method has sensitivity height, specific good, reaction Time is short, determines that result is convenient, does not need the advantages such as expensive instrument.

Reaction system proportion of the invention are as follows: 10 L:(6.7~7.3 μ of reaction system) (rich biological group difficult to understand has μ L reaction solution Limit Products, catalog number CP.440020), (0.8~1.2) μ L primer combine, 1 μ L dilution (1 μ L dilution In the genome copy numbers that contain be 5*10²Copies), moisturizing is to 10 μ L.

Primer combination identification provided by the invention has high specific and height for detecting four kinds of common Mucoales fungies Easy, quick, accurate detection may be implemented in sensitivity.The present invention has great promotional value.

Detailed description of the invention

In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described.

Fig. 1 shows the testing result that primer sets I are used in embodiment 2；

Fig. 2 shows the testing result that primer sets II are used in embodiment 2；

Fig. 3 shows the testing result that primer sets III are used in embodiment 2；

Fig. 4 shows the testing result that primer sets IV are used in embodiment 2；

Fig. 5 shows the testing result of reaction system 1 in embodiment 3；

Fig. 6 shows the testing result of reaction system 2 in embodiment 3；

Fig. 7 shows the testing result of reaction system 3 in embodiment 3；

Fig. 8 shows the testing result of reaction system 4 in embodiment 3；

Fig. 9 shows the testing result of reaction system 5 in embodiment 3；

Figure 10 shows the testing result of reaction system 6 in embodiment 3；

Figure 11 shows the testing result of reaction system 7 in embodiment 3；

Figure 12 shows the testing result of reaction system 8 in embodiment 3；

Figure 13 shows the testing result of reaction system 9 in embodiment 3；

Figure 14 shows the testing result of reaction system 10 in embodiment 3；

Figure 15 shows the testing result of reaction system 11 in embodiment 3；

Figure 16 shows the testing result of reaction system 12 in embodiment 3；

Figure 17 shows the testing result of reaction system 1 in embodiment 4；

Figure 18 shows the testing result of reaction system 2 in embodiment 4；

Figure 19 shows the testing result of reaction system 3 in embodiment 4；

Figure 20 shows the testing result of reaction system 4 in embodiment 4；

Figure 21 shows the testing result of reaction system 5 in embodiment 4；

Figure 22 shows the testing result of sample one in embodiment 5；

Figure 23 shows the testing result of sample two in embodiment 5；

Figure 24 shows the testing result of sample three in embodiment 5；

Figure 25 shows the testing result of sample four in embodiment 5；

Figure 26 shows the sensitivity results that primer detection Lichtheimia corymbifera provided by the invention is used in comparative test；

Figure 27 shows in comparative test using the sensitivity results of comparison primer detection Lichtheimia corymbifera；

Figure 28 shows the specific outcome that primer detection Lichtheimia corymbifera provided by the invention is used in comparative test；

Figure 29 shows in comparative test using the specific outcome of comparison primer detection Lichtheimia corymbifera；

Figure 30 shows the sensitivity results that primer detection rhizopus oryzae provided by the invention is used in comparative test；

Figure 31 shows in comparative test using the sensitivity results of comparison primer detection rhizopus oryzae；

Figure 32 shows the specific outcome that primer detection rhizopus oryzae provided by the invention is used in comparative test；

Figure 33 shows in comparative test using the specific outcome of comparison primer detection rhizopus oryzae；

Figure 34 shows the sensitivity results that primer detection Mucor circinelloides provided by the invention are used in comparative test；

Figure 35 shows in comparative test using the sensitivity results of comparison primer detection Mucor circinelloides；

Figure 36 shows the specific outcome that primer detection Mucor circinelloides provided by the invention are used in comparative test；

Figure 37 shows in comparative test using the specific outcome of comparison primer detection Mucor circinelloides；

Figure 38 shows the sensitivity results that primer detection Rhizomucor pusillus provided by the invention is used in comparative test；

Figure 39 shows in comparative test using the sensitivity results of comparison primer detection Rhizomucor pusillus；

Figure 40 shows the specific outcome that primer detection Rhizomucor pusillus provided by the invention is used in comparative test；

Figure 41 shows in comparative test using the specific outcome of comparison primer detection Rhizomucor pusillus.

Specific embodiment

The invention discloses a kind of primer sets and its application, those skilled in the art can use for reference present disclosure, suitably change Into realization of process parameters.In particular, it should be pointed out that all similar substitutions and modifications are aobvious for a person skilled in the art And be clear to, they are considered as being included in the present invention.Method and application of the invention is carried out by preferred embodiment Description, related personnel can obviously not depart from the content of present invention, carried out in spirit and scope to method described herein and application Change or appropriate changes and combinations, carry out implementation and application the technology of the present invention.

Raw materials used, auxiliary material and reagent are available on the market in primer sets provided by the invention and its application.

Experimental method in following embodiments is unless otherwise specified conventional method.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Quantitative test in following embodiment, is respectively provided with three repeated experiments, and results are averaged.

Reaction solution is Capitalbio Corporation Co., Ltd.'s product, catalog number CP.440020.

The calculation method of DNA copy number is as follows:

50 μ g/ml of 1A260 absorbance value=ds DNA；

Nucleic acid concentration=(OD260) × (extension rate) × (50)=x ng/ μ l；

Average molecular weight (MW) representative gram/mol, unit dalton (dolton), i.e. 1dolton=1g/mol；

Mole=6.02 × 10²³；

Average molecular weight (MW): dsDNA=(base number) × (660 dalton/base)；

Copy number calculation formula:

(6.02×10²³Copies/ moles) × (l × 10 x ng/ μ^-9)/(DNA length × 660)=copies/ μ l.

Below with reference to embodiment, the present invention is further explained:

The preparation of embodiment 1 primer sets I, primer sets II, primer sets III, primer sets IV and primer sets V

Kit is made of four LAMP primer groups, and each primer sets are for detecting a kind of candida albicans.

It is following (5 ' → 3 ') for detecting rhizopus oryzae primer sets:

Outer primer F3 (SEQ ID No.1): GGTAGCAAATCCAGTC；

Outer primer B3 (SEQ ID No.2): CCTCCCAAGCGATC；

Inner primer FIP (SEQ ID No.3):

ACGGGTCGTGTCAAGGTTCTGGACTGCCTCCAA；

Inner primer BIP (SEQ ID No.4):

CGTCCATCTTGGCGATGTTGGGAATCCCCATGTTCA；

Ring primer LF (SEQ ID No.5): CCGGAGCCAATGACCT；

Ring primer LB (SEQ ID No.6): CTCAATCGGTCCATGC.

It is following (5 ' → 3 ') for detecting Lichtheimia corymbifera primer sets:

Outer primer F3 (SEQ ID No.7): GGGTAAAAAAGGTGGATG；

Outer primer B3 (SEQ ID No.8): CATTGGATCCCTTTTTC；

Inner primer FIP (SEQ ID No.9):

CCAAGAGGTGAGGTTGGGATGTTGCCTCTTCAGCTTC；

Inner primer BIP (SEQ ID No.10):

TTCTGGTATTCACGAGACTGATGTTGGAGTACAAGTCCTTAC；

Ring primer LF (SEQ ID No.11): AGAGAGCCTCGGGA；

Ring primer LB (SEQ ID No.12): CATCATGAAGTGCGAT.

It is following (5 ' → 3 ') for detecting Mucor circinelloides primer sets:

Outer primer F3 (SEQ ID No.13): GTTTGCTAGACCTGAATGG；

Outer primer B3 (SEQ ID No.14): CTGCAAGAGCTGTTCGAA；

Inner primer FIP (SEQ ID No.15):

CACGACTGGTGCCATCGCCTGTTCCTCCACCTC；

Inner primer BIP (SEQ ID No.16):

ACTCACAAATTGTCTGACGTGCGAGCACCCTCTGATTCACAA；

Ring primer LF (SEQ ID No.17): ATTTGAATAGAGGGACGA；

Ring primer LB (SEQ ID No.18): AAGGCGAATGGTAACG.

It is following (5 ' → 3 ') for detecting Rhizomucor pusillus primer sets:

Outer primer F3 (SEQ ID No.19): GGGTACGTCTAGTTC；

Outer primer B3 (SEQ ID No.20): AAGTTCAGATCCATAGTTG；

Inner primer FIP (SEQ ID No.21):

ACAACATACAAATTGTTCGGGTACTTTGGATTTGCGGTG；

Inner primer BIP (SEQ ID No.22):

CCTTGAGGGTTTGCATTGGTGGTTGATTGACCTTTATACTT；

Ring primer LF (SEQ ID No.23): TTGAACGGATGAAAATCCA；

Ring primer LB (SEQ ID No.24): TACCAGTGTGCTTCGA.

Primer sets for detecting rhizopus oryzae are named as primer sets I.Primer sets for detecting Lichtheimia corymbifera are named For primer sets II.Primer sets for detecting Mucor circinelloides are named as primer sets III.For detecting the primer of Rhizomucor pusillus Group is named as primer sets IV.

Detection candida albicans primer combination is made of primer sets I, primer sets II, primer sets III and primer sets IV, the primer sets In conjunction, the respectively independent packaging of each single stranded DNA.

In primer sets I, I-F3 of primer, I-B3 of primer, I-FIP of primer, I-BIP of primer, I-LF of primer and primer I-LB Molar ratio is 0.5:0.5:2:2:1:1；

In primer sets II, II-F3 of primer, II-B3 of primer, II-FIP of primer, II-BIP of primer, II-LF of primer and primer The molar ratio of II-LB is 0.5:0.5:2:2:1:1；

In primer sets III, III-F3 of primer, III-B3 of primer, III-FIP of primer, III-BIP of primer, III-LF of primer and primer The molar ratio of III-LB is 0.5:0.5:2:2:1:1.

In primer sets IV, IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-BIP of primer, IV-LF of primer and primer The molar ratio of IV-LB is 0.5:0.5:2:2:1:1.

The specificity of 2 mucor primer of embodiment combination

One, the preparation of sample to be tested

Sample to be tested 1: rhizopus oryzae plasmid

Sample to be tested 2: Lichtheimia corymbifera plasmid

Sample to be tested 3: Mucor circinelloides plasmid

Sample to be tested 4: Rhizomucor pusillus plasmid

Rhizopus oryzae detects gene plasmid: in pEasy-blunt plasmid (Beijing Quanshijin Biotechnology Co., Ltd) It is inserted into the DNA molecular of No. Genebank nucleotide for AB167714.1 between MCS, obtains recombinant plasmid, which is rice root Mould detects gene plasmid.

Lichtheimia corymbifera detects gene plasmid: in pEasy-blunt plasmid (Beijing Quanshijin Biotechnology Co., Ltd) MCS between insertion No. Genebank for GQ342716.1 nucleotide DNA molecular, obtain recombinant plasmid, which is umbrella Shape mucor detects gene plasmid.

Mucor circinelloides detect gene plasmid: in pUC57 plasmid (Sangon Biotech (Shanghai) Co., Ltd.) It is inserted into the DNA molecular of No. Genebank nucleotide for JF723861.2 between MCS, obtains recombinant plasmid, which is to roll up branch Mucor detects gene plasmid.

Rhizomucor pusillus detects gene plasmid: in pEasy-blunt plasmid (Beijing Quanshijin Biotechnology Co., Ltd) MCS between insertion No. Genebank for JQ683230.1 nucleotide DNA molecular, obtain recombinant plasmid, the plasmid is as micro- Rootlet Mucor detects gene plasmid.

Two, the detection of sample to be tested

Each sample to be tested carries out following steps respectively and is detected:

Using the genome of step 1 as template, primer sets I, the primer sets II, primer sets III of the preparation of embodiment 1 are respectively adopted Four plasmids with primer sets IV prepared by step 1-rhizopus oryzae testing gene Plasmid DNA, Lichtheimia corymbifera testing gene Plasmid DNA, Mucor circinelloides testing gene Plasmid DNA and Rhizomucor pusillus testing gene Plasmid DNA carry out ring mediated isothermal expansion Increase detection, each primer combination detects four kinds of plasmids.

Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions CP.440020), 1 μ L primer mixture, 1 μ L template DNA (5pg-50pg), moisturizing to 10 μ L.Primer mixture, that is, primer sets I, The mixture of each primer composition in primer sets II, primer sets III or primer sets IV.In reaction system, outer primer F3 and draw outside The final concentration of object B3 is 0.5 μM, and the final concentration of inner primer FIP and inner primer BIP are 2 μM, ring primer LF and ring primer LB Final concentration be 1 μM.

Reaction condition: 65 DEG C of constant temperature 50min.

In reaction process, fluorescence signal is detected using fluorescent PCR instrument.

Using the result is shown in Figure 1 of primer sets I.Positive expansion is only shown when sample to be tested is rhizopus oryzae genome Increase curve (i.e. amplification curve is typical " S type " amplification curve, rhizopus oryzae meaning curve in Fig. 1).When sample to be tested be to Positive amplification curve is not shown when test sample sheet 2,3 or 4.It is the result of sample to be tested 1 in Fig. 1；" S type " non-in Fig. 1 expands It is respectively sample to be tested 2, sample to be tested 3 and sample to be tested 4 as a result, remaining is to be not added with mould that having in increasing curve, which respectively has one, The result of plate.

Result using primer sets II is shown in Fig. 2.Only sun is shown when sample to be tested is Lichtheimia corymbifera genome Property amplification curve (i.e. amplification curve is typical " S type " amplification curve, Lichtheimia corymbifera meaning curve in Fig. 2).When to test sample This does not show positive amplification curve when being sample to be tested 1,3,4.It is the result of sample to be tested 2 in Fig. 2；" S non-in Fig. 2 Have in type " amplification curve respectively have one be respectively sample to be tested 1, sample to be tested 3, sample to be tested 4 as a result, remaining is not add Add the result of template.

Result using primer sets III is shown in Fig. 3.Only sun is shown when sample to be tested is Mucor circinelloides genome Property amplification curve (i.e. amplification curve is typical " S type " amplification curve, Mucor circinelloides meaning curve in Fig. 3).When to test sample This does not show positive amplification curve when being sample to be tested 1,2,4.It is the result of sample to be tested 3 in Fig. 3；" S non-in Fig. 3 Have in type " amplification curve respectively have one be respectively sample to be tested 1, sample to be tested 2, sample to be tested 4 as a result, remaining is not add Add the result of template.

Result using primer sets IV is shown in Fig. 4.Only sun is shown when sample to be tested is Rhizomucor pusillus genome Property amplification curve (i.e. amplification curve is typical " S type " amplification curve, Rhizomucor pusillus meaning curve in Fig. 4).When to test sample This does not show positive amplification curve when being sample to be tested 1,2,3.It is the result of sample to be tested 4 in Fig. 4；" S non-in Fig. 4 Have in type " amplification curve respectively have one be respectively sample to be tested 1, sample to be tested 2, sample to be tested 3 as a result, remaining is not add Add the result of template.

The above result shows that four primer sets in Mucoales fungi primer combination provided by the invention are respectively to its target Gene has very high specificity.

The sensitivity of 3 Mucoales Fungal identification primer of embodiment combination

Sample to be tested 1: the rhizopus oryzae testing gene Plasmid DNA of embodiment 2.

Sample to be tested 2: the Lichtheimia corymbifera testing gene Plasmid DNA of embodiment 2.

Sample to be tested 3: the Mucor circinelloides testing gene Plasmid DNA of embodiment 2.

Sample to be tested 4: the Rhizomucor pusillus testing gene Plasmid DNA of embodiment 2.

1, testing gene Plasmid DNA carries out gradient dilution with sterile water, obtains each dilution.

2, the dilution obtained using step 1 is respectively adopted the primer sets I of the preparation of embodiment 1, primer sets II, drawn as template Object group III or primer sets IV carry out ring mediated isothermal amplification.

When sample to be tested is sample to be tested 1, ring mediated isothermal amplification is carried out using primer sets I.Sample to be tested is to test sample When sheet 2, ring mediated isothermal amplification is carried out using primer sets II.When sample to be tested is sample to be tested 3, ring is carried out using primer sets III Mediated isothermality amplification.When sample to be tested is sample to be tested 4, ring mediated isothermal amplification is carried out using primer sets IV.

Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions CP.440020), (genome copy numbers contained in 1 μ L dilution are respectively 10 for 1 μ L primer mixture, 1 μ L dilution³、10² Or 10¹), moisturizing to 10 μ L.Each primer in primer mixture, that is, primer sets I, primer sets II, primer sets III or primer sets IV The mixture of composition.In reaction system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, inner primer FIP and inner primer The final concentration of BIP is 2 μM, and the final concentration of ring primer LF and ring primer LB are 1 μM.

Reaction condition: 65 DEG C of constant temperature 50min.

According to the difference of genome copy numbers in dilution, total following 12 reaction systems:

The rhizopus oryzae plasmid DNA copies number contained in reaction system 1:1 μ L dilution is respectively 10³；

The rhizopus oryzae plasmid DNA copies number contained in reaction system 2:1 μ L dilution is respectively 5 × 10²；

The rhizopus oryzae plasmid DNA copies number contained in reaction system 3:1 μ L dilution is respectively 10²；

The Lichtheimia corymbifera plasmid DNA copies number contained in reaction system 4:1 μ L dilution is respectively 10³；

The Lichtheimia corymbifera plasmid DNA copies number contained in reaction system 5:1 μ L dilution is respectively 5 × 10²；

The Lichtheimia corymbifera plasmid DNA copies number contained in reaction system 6:1 μ L dilution is respectively 10²；

The Mucor circinelloides plasmid DNA copies number contained in reaction system 7:1 μ L dilution is respectively 10³；

The Mucor circinelloides plasmid DNA copies number contained in reaction system 8:1 μ L dilution is respectively 5 × 10²；

The Mucor circinelloides plasmid DNA copies number contained in reaction system 9:1 μ L dilution is respectively 10²；

The Rhizomucor pusillus plasmid DNA copies number contained in reaction system 10:1 μ L dilution is respectively 10³；

The Rhizomucor pusillus plasmid DNA copies number contained in reaction system 11:1 μ L dilution is respectively 5 × 10²；

The Rhizomucor pusillus plasmid DNA copies number contained in reaction system 12:1 μ L dilution is respectively 10²。

20 repetitions are arranged in each reaction system.

If occurring positive amplification curve (i.e. amplification curve is typical " S type " amplification curve) in 50min, show anti- Answer the corresponding gene group content in system that can be detected.If not occurring positive amplification curve in 50min (to expand Increasing curve is typical " S type " amplification curve), show that the corresponding gene group content in reaction system cannot be detected.

As a result see Fig. 5~Figure 16.

It is 10 that primer sets I, which detect target gene genome copy numbers in 1 μ L dilution,³(Fig. 5) and 5 × 10²When (Fig. 6) 20 detections are detectable out and reproducible, and 10²When (Fig. 7) 20 detections can not appearance and less reproducible completely, because The sensitivity of this primer sets I is 5 × 10²A copy number/reaction system.

It is 10 that primer sets II, which detect target gene genome copy numbers in 1 μ L dilution,³(Fig. 8) and 5 × 10²When (Fig. 9) 20 detections are detectable out and reproducible, and 10²When (Figure 10) 20 detections can not appearance and less reproducible completely, because The sensitivity of this primer sets II is 5 × 10²A copy number/reaction system.

It is 10 that primer sets III, which detect target gene genome copy numbers in 1 μ L dilution,³(Figure 11) and 5 × 10²(Figure 12) When 20 detections are detectable comes out and reproducible, 10²When (Figure 13) 20 detections can not appearance and less reproducible completely, Therefore the sensitivity of primer sets III is 5 × 10²A copy number/reaction system.

It is 10 that primer sets IV, which detect target gene genome copy numbers in 1 μ L dilution,³(Figure 14) and 5 × 10²(Figure 15) When 20 detections are detectable comes out and reproducible, 10²When (Figure 16) 20 detections can not appearance and less reproducible completely, Therefore the sensitivity of primer sets IV is 5 × 10²A copy number/reaction system.

The screening of 4 reaction system of embodiment

Sample to be tested: Rhizomucor pusillus detects gene plasmid: in pEasy-blunt plasmid (Beijing Quan Shijin biotechnology Co., Ltd) MCS between insertion No. Genebank for JQ683230.1 nucleotide DNA molecular, obtain recombinant plasmid, the matter Grain is that Rhizomucor pusillus detects gene plasmid.

1, the Plasmid DNA for extracting sample to be tested, carries out gradient dilution with sterile water, obtains each dilution.

2, the dilution obtained using step 1 carries out ring mediated isothermal expansion using primer sets I prepared by embodiment 1 as template Increase.

Reaction system 1 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 1 μ L primer mixture, 1 μ L dilution 10²Copies), moisturizing is to 10 μ L.

Reaction system 2 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 6.7 μ L reaction solutions CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 1.2 μ L primer mixtures, 1 μ L dilution 10²Copies), moisturizing is to 10 μ L.

Reaction system 3 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 6.5 μ L reaction solutions CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 1.3 μ L primer mixtures, 1 μ L dilution 10²Copies), moisturizing is to 10 μ L.

Reaction system 4 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.3 μ L reaction solutions CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 0.8 μ L primer mixture, 1 μ L dilution 10²Copies), moisturizing is to 10 μ L.

Reaction system 5 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.5 μ L reaction solutions CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 0.7 μ L primer mixture, 1 μ L dilution 10²Copies), moisturizing is to 10 μ L.

The mixture of each primer composition of primer mixture, that is, primer sets I.In reaction system, outer primer F3 and outer primer The final concentration of B3 is 0.5 μM, and the final concentration of inner primer FIP and inner primer BIP are 2 μM, ring primer LF and ring primer LB's Final concentration is 1 μM.

Reaction condition: 65 DEG C of constant temperature 50min.

In reaction process, fluorescence signal is detected using constant-temperature amplification instrument.

8 repetitions are arranged in each reaction system.

The result is shown in Figure 1 7- Figure 21.Primer combine detection target gene is in reaction system 1, reaction system 2 and reaction system 4 When 8 detections are detectable comes out and reproducible, primer combine detection target gene is in reaction system 3 and reaction system 58 A detection can not appearance and less reproducible completely.

It is thus determined that reaction system matches are as follows: 10 L:(6.7~7.3 μ of reaction system) (rich biological group difficult to understand has μ L reaction solution Limit Products, catalog number CP.440020), (0.8~1.2) μ L primer combine, 1 μ L dilution (1 μ L dilution In the genome copy numbers that contain be 5*10²Copies), moisturizing is to 10 μ L.

Embodiment 5 utilizes Mucoales Fungal identification primer combine detection clinical sample

Sample to be tested is following sample one, sample two, sample three or sample four:

Sample one: the bronchoalveolar lavage fluid of people of the identification confirmation containing rhizopus oryzae is sequenced by PCR；

Sample two: the bronchoalveolar lavage fluid of people of the identification confirmation containing Lichtheimia corymbifera is sequenced by PCR；

Sample three: the bronchoalveolar lavage fluid of people of the identification confirmation containing Mucor circinelloides is sequenced by PCR；

Sample four: the bronchoalveolar lavage fluid of people of the identification confirmation containing Rhizomucor pusillus is sequenced by PCR.

1, the total DNA of sample to be tested is extracted.

2, each primer sets of the preparation of embodiment 1 are respectively adopted to this four samples as template in the total DNA extracted using step 1 This progress ring mediated isothermal amplification, each primer combination detect four kinds of samples.

Reaction system and reaction condition are the same as embodiment 2.

The result of sample one is shown in Figure 22.Positive amplification curve is shown when only detection using primer sets I.Draw when using Positive amplification curve is not shown when other three primer sets other than object group I, it is consistent with actual conditions.Figure 22 is primer The result of group I；Respectively having one in " S type " amplification curve non-in Figure 22 is respectively primer sets II, primer sets III and primer sets IV As a result, remaining is the result for being not added with template.

The result of sample two is shown in Figure 23.Positive amplification curve is shown when only detection using primer sets II.Work as use Positive amplification curve is not shown when other three primer sets other than primer sets II, it is consistent with actual conditions.Figure 23 is The result of primer sets II；Respectively having one in " S type " amplification curve non-in Figure 23 is respectively primer sets I, primer sets III and primer sets IV as a result, remaining is the result for being not added with template.

The result of sample three is shown in Figure 24.Positive amplification curve is shown when only detection using primer sets III.Work as use Positive amplification curve is not shown when other three primer sets other than primer sets III, it is consistent with actual conditions.Figure 24 is The result of primer sets III；Respectively having one in " S type " amplification curve non-in Figure 24 is respectively primer sets I, primer sets II and primer sets IV as a result, remaining is the result for being not added with template.

The result of sample four is shown in Figure 25.Positive amplification curve is shown when only detection using primer sets IV.Work as use Positive amplification curve is not shown when other three primer sets other than primer sets IV, it is consistent with actual conditions.Figure 25 is The result of primer sets IV；Respectively having one in " S type " amplification curve non-in Figure 25 is respectively primer sets I, primer sets II and primer sets III as a result, remaining is the result for being not added with template.

The above result shows that 4 kinds of common Mucoales can be carried out using Candida primer provided by the invention combination The detection of fungi, as a result accurately and reliably.

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.

Comparative test

1 Lichtheimia corymbifera

Compare primer sequence:

Table 1

F3-1	SEQ ID No.25	gggtaacgagcggta
			B3-1	SEQ ID No.26	atccctttttccctttt
FIP-1	SEQ ID No.27	aagaggtgaggttgggatgttgcctcttcagcttcc
			BIP-1	SEQ ID No.28	gcttctggtattcacgagactgatgttggagtacaagtcctt
LF-1	SEQ ID No.29	agagagcctcgggagc
			LB-1	SEQ ID No.30	taactccatcatgaagt

Using existing primer sequence and comparison primer sequence, test is compared.

Sensitivity comparison:

Experimental design: using existing primer and comparison primer, 20 repeat amplification protcols of detection limit grade are carried out.

Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions CP.440020), (genome copy numbers contained in 1 μ L dilution are 5 × 10 for 1 μ L primer mixture, 1 μ L dilution²), it mends Water is to 10 μ L.In reaction system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, inner primer FIP and inner primer BIP Final concentration be 2 μM, the final concentration of ring primer LF and ring primer LB are 1 μM.

Reaction condition: 65 DEG C of constant temperature 50min.

React primer: current primer and comparison primer

As a result: now using primer repeatability better than comparison primer.

Specificity comparison:

Experimental design: using existing primer and comparison primer, the amplification of three kinds of unrelated bacterium templates is carried out.

Prepare above-mentioned three kinds of plasmids.

Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions CP.440020), (template copy numbers contained in 1 μ L dilution are 10 for 1 μ L primer mixture, 1 μ L dilution⁴), moisturizing to 10 μL.The mixture of each primer composition in primer mixture, that is, primer sets I or primer sets II.In reaction system, outer primer F3 Final concentration with outer primer B3 is 0.5 μM, and the final concentration of inner primer FIP and inner primer BIP are 2 μM, ring primer LF and ring The final concentration of primer LB is 1 μM.

Reaction condition: 65 DEG C of constant temperature 50min.

React primer: current primer and comparison primer

As a result: now good using primer specificity, no non-specific amplification；There is the expansion of rhizopus oryzae non-specificity in comparison primer Increase.

2 rhizopus oryzaes

Compare primer sequence:

Table 2

F3-2	SEQ ID No.31	GACTGCCTCCAAACC
			B3-2	SEQ ID No.32	CGCTTTACCTGATATCGC
FIP-2	SEQ ID No.33	GCATGGACCGATTGAGGATTGACAGGCTCCGGTACCTA
			BIP-2	SEQ ID No.34	CTTGGGTGAACATGGGGAGGGAAACTTGTCAACGGCT
LF-2	SEQ ID No.35	AGACATCGCCAAGAT
			LB-2	SEQ ID No.36	GGAGGCTGCTTCGA

Sensitivity comparison:

Reaction condition: 65 DEG C of constant temperature 50min.

React primer: current primer and comparison primer

As a result: now using primer repeatability better than comparison primer.

Specificity comparison:

Prepare above-mentioned three kinds of plasmids.

Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions CP.440020), (template copy numbers contained in 1 μ L dilution are 10 for 1 μ L primer mixture, 1 μ L dilution⁴), moisturizing to 10 μL.In reaction system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, and the end of inner primer FIP and inner primer BIP are dense Degree is 2 μM, and the final concentration of ring primer LF and ring primer LB are 1 μM.

Reaction condition: 65 DEG C of constant temperature 50min.

React primer: current primer and comparison primer

As a result: now good using primer specificity, no non-specific amplification；There is Rhizomucor pusillus/volume branch hair in comparison primer Mould/Lichtheimia corymbifera non-specific amplification.

3 Mucor circinelloides

Compare primer sequence:

Table 3

F3-3	SEQ ID No.37	CTCCACCTCAAGTTCG
			B3-3	SEQ ID No.38	CAAACATCCATTCAACATC
FIP-3	SEQ ID No.39	GCACGTCAGACAATTTGTGAGTCACTCTATTCAAATGGATGG
			BIP-3	SEQ ID No.40	GAATGGTAACGTGAAGCTGCAAGAGCTGTTCGAATT
LF-3	SEQ ID No.41	TCGTCTTCACCACGA
			LB-3	SEQ ID No.42	CGTTGTGAATCAGAGGG

Sensitivity comparison:

Reaction condition: 65 DEG C of constant temperature 50min.

React primer: current primer and comparison primer

As a result: now using primer repeatability better than comparison primer.

Specificity comparison:

Prepare above-mentioned three kinds of plasmids.

Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions CP.440020), (the hybrid template copy number contained in 1 μ L dilution is 10 for 1 μ L primer mixture, 1 μ L dilution⁴), moisturizing To 10 μ L.In reaction system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, inner primer FIP and inner primer BIP's Final concentration is 2 μM, and the final concentration of ring primer LF and ring primer LB are 1 μM.

Reaction condition: 65 DEG C of constant temperature 50min.

React primer: current primer and comparison primer

4 Rhizomucor pusillus

Compare primer sequence:

F3-4	SEQ ID No.43	AGAAATGATTCAAGACGA
			B3-4	SEQ ID No.44	GGGGTTAATAAAGATACTGA
FIP-4	SEQ ID No.45	CATTTGCTACGCTCTTCAAAACAACTTTAAGCAATGGATCAC
			BIP-4	SEQ ID No.46	AAGTAATGCGATCTGCAGCCTTGACGTACCCAATGGATG
LF-4	SEQ ID No.47	TGCGAGAACCAA
			LB-4	SEQ ID No.48	TCATCGAATTCTCGAA

Sensitivity comparison:

Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions CP.440020), (genome copy numbers contained in 1 μ L dilution are 5 × 10 for 1 μ L primer mixture, 1 μ L dilution²), it mends Water is to 10 μ L.The mixture of each primer composition in primer mixture, that is, primer sets I or primer sets II.In reaction system, outside The final concentration of primers F 3 and outer primer B3 are 0.5 μM, and the final concentration of inner primer FIP and inner primer BIP are 2 μM, ring primer The final concentration of LF and ring primer LB are 1 μM.

Reaction condition: 65 DEG C of constant temperature 50min.

React primer: current primer and comparison primer

Reaction repeats: 20 repeat

As a result: now using primer repeatability better than comparison primer.

Specificity comparison:

Prepare above-mentioned three kinds of plasmids.

Reaction condition: 65 DEG C of constant temperature 50min.

React primer: current primer and comparison primer

Sequence table

<110>Capitalbio Corporation Co., Ltd.

<120>primer sets and its application

<130> MP1729047

<160> 48

<170> SIPOSequenceListing 1.0

<210> 1

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

ggtagcaaat ccagtc 16

<210> 2

<211> 14

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

cctcccaagc gatc 14

<210> 3

<211> 33

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

acgggtcgtg tcaaggttct ggactgcctc caa 33

<210> 4

<211> 36

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

cgtccatctt ggcgatgttg ggaatcccca tgttca 36

<210> 5

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

ccggagccaa tgacct 16

<210> 6

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

ctcaatcggt ccatgc 16

<210> 7

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

gggtaaaaaa ggtggatg 18

<210> 8

<211> 17

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

cattggatcc ctttttc 17

<210> 9

<211> 37

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

ccaagaggtg aggttgggat gttgcctctt cagcttc 37

<210> 10

<211> 42

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

ttctggtatt cacgagactg atgttggagt acaagtcctt ac 42

<210> 11

<211> 14

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

agagagcctc ggga 14

<210> 12

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

catcatgaag tgcgat 16

<210> 13

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

gtttgctaga cctgaatgg 19

<210> 14

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

ctgcaagagc tgttcgaa 18

<210> 15

<211> 33

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

cacgactggt gccatcgcct gttcctccac ctc 33

<210> 16

<211> 42

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 16

actcacaaat tgtctgacgt gcgagcaccc tctgattcac aa 42

<210> 17

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 17

atttgaatag agggacga 18

<210> 18

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 18

aaggcgaatg gtaacg 16

<210> 19

<211> 15

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 19

gggtacgtct agttc 15

<210> 20

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 20

aagttcagat ccatagttg 19

<210> 21

<211> 39

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 21

acaacataca aattgttcgg gtactttgga tttgcggtg 39

<210> 22

<211> 41

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 22

ccttgagggt ttgcattggt ggttgattga cctttatact t 41

<210> 23

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 23

ttgaacggat gaaaatcca 19

<210> 24

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 24

taccagtgtg cttcga 16

<210> 25

<211> 15

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 25

gggtaacgag cggta 15

<210> 26

<211> 17

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 26

atcccttttt ccctttt 17

<210> 27

<211> 36

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 27

aagaggtgag gttgggatgt tgcctcttca gcttcc 36

<210> 28

<211> 42

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 28

gcttctggta ttcacgagac tgatgttgga gtacaagtcc tt 42

<210> 29

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 29

agagagcctc gggagc 16

<210> 30

<211> 17

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 30

taactccatc atgaagt 17

<210> 31

<211> 15

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 31

gactgcctcc aaacc 15

<210> 32

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 32

cgctttacct gatatcgc 18

<210> 33

<211> 38

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 33

gcatggaccg attgaggatt gacaggctcc ggtaccta 38

<210> 34

<211> 37

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 34

cttgggtgaa catggggagg gaaacttgtc aacggct 37

<210> 35

<211> 15

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 35

agacatcgcc aagat 15

<210> 36

<211> 14

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 36

ggaggctgct tcga 14

<210> 37

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 37

ctccacctca agttcg 16

<210> 38

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 38

caaacatcca ttcaacatc 19

<210> 39

<211> 42

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 39

gcacgtcaga caatttgtga gtcactctat tcaaatggat gg 42

<210> 40

<211> 36

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 40

gaatggtaac gtgaagctgc aagagctgtt cgaatt 36

<210> 41

<211> 15

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 41

tcgtcttcac cacga 15

<210> 42

<211> 17

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 42

cgttgtgaat cagaggg 17

<210> 43

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 43

agaaatgatt caagacga 18

<210> 44

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 44

ggggttaata aagatactga 20

<210> 45

<211> 42

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 45

catttgctac gctcttcaaa acaactttaa gcaatggatc ac 42

<210> 46

<211> 39

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 46

aagtaatgcg atctgcagcc ttgacgtacc caatggatg 39

<210> 47

<211> 12

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 47

tgcgagaacc aa 12

<210> 48

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 48

tcatcgaatt ctcgaa 16

Claims

1. primer combines, for as follows (a1) or (a2) or (a3):

(a2), by any two group in the primer sets I, the primer sets II, the primer sets III, the primer sets IV At；

Wherein the primer sets I are by I-F3 of primer, I-B3 of primer, I-FIP of primer, I-LB of I-BIP of primer, I-LF of primer and primer Composition；

I-the F3 of primer has any one in nucleotide sequence as follows:

(b1), there is nucleotide sequence shown in SEQ ID NO:1；

(b2), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, one or more alkali are deleted and/or added The nucleotide sequence that base obtains；

I-the B3 of primer has any one in nucleotide sequence as follows:

(b5), there is nucleotide sequence shown in SEQ ID NO:2；

(b6), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, one or more alkali are deleted and/or added The nucleotide sequence that base obtains；

I-the FIP of primer has any one in nucleotide sequence as follows:

(b9), there is nucleotide sequence shown in SEQ ID NO:3；

(b10), have nucleotide sequence shown in SEQ ID NO:3 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

I-the BIP of primer has any one in nucleotide sequence as follows:

(b13), there is nucleotide sequence shown in SEQ ID NO:4；

(b14), have nucleotide sequence shown in SEQ ID NO:4 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

I-the LF of primer has any one in nucleotide sequence as follows:

(b17), there is nucleotide sequence shown in SEQ ID NO:5；

(b18), have nucleotide sequence shown in SEQ ID NO:5 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

I-the LB of primer has any one in nucleotide sequence as follows:

(b21), there is nucleotide sequence shown in SEQ ID NO:6；

(b22), have nucleotide sequence shown in SEQ ID NO:6 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

The primer sets II are by II-F3 of primer, II-B3 of primer, II-FIP of primer, II-BIP of primer, II-LF of primer and primer II-LB composition；

II-the F3 of primer has any one in nucleotide sequence as follows:

(c1), there is nucleotide sequence shown in SEQ ID NO:7；

(c2), have nucleotide sequence shown in SEQ ID NO:7 through modification, substitution, one or more alkali are deleted and/or added The nucleotide sequence that base obtains；

II-the B3 of primer has any one in nucleotide sequence as follows:

(c5), there is nucleotide sequence shown in SEQ ID NO:8；

(c6), have nucleotide sequence shown in SEQ ID NO:8 through modification, substitution, one or more alkali are deleted and/or added The nucleotide sequence that base obtains；

II-the FIP of primer has any one in nucleotide sequence as follows:

(c9), there is nucleotide sequence shown in SEQ ID NO:9；

(c10), have nucleotide sequence shown in SEQ ID NO:9 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

II-the BIP of primer has any one in nucleotide sequence as follows:

(c13), there is nucleotide sequence shown in SEQ ID NO:10；

(c14), have nucleotide sequence shown in SEQ ID NO:10 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

II-the LF of primer has any one in nucleotide sequence as follows:

(c17), there is nucleotide sequence shown in SEQ ID NO:11；

(c18), have nucleotide sequence shown in SEQ ID NO:11 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

II-the LB of primer has any one in nucleotide sequence as follows:

(c21), there is nucleotide sequence shown in SEQ ID NO:12；

(c22), have nucleotide sequence shown in SEQ ID NO:12 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

The primer sets III are by III-F3 of primer, III-B3 of primer, III-FIP of primer, III-BIP of primer, III-LF of primer and primer III-LB composition；

III-the F3 of primer has any one in nucleotide sequence as follows:

(d1), there is nucleotide sequence shown in SEQ ID NO:13；

(d2), have nucleotide sequence shown in SEQ ID NO:13 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

III-the B3 of primer has any one in nucleotide sequence as follows:

(d5), there is nucleotide sequence shown in SEQ ID NO:14；

(d6), have nucleotide sequence shown in SEQ ID NO:14 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

III-the FIP of primer has any one in nucleotide sequence as follows:

(d9), there is nucleotide sequence shown in SEQ ID NO:15；

(d10), have nucleotide sequence shown in SEQ ID NO:15 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

III-the BIP of primer has any one in nucleotide sequence as follows:

(d13), there is nucleotide sequence shown in SEQ ID NO:16；

(d14), have nucleotide sequence shown in SEQ ID NO:16 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

III-the LF of primer has any one in nucleotide sequence as follows:

(d17), there is nucleotide sequence shown in SEQ ID NO:17；

(d18), have nucleotide sequence shown in SEQ ID NO:17 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

III-the LB of primer has any one in nucleotide sequence as follows:

(d21), there is nucleotide sequence shown in SEQ ID NO:18；

(d22), have nucleotide sequence shown in SEQ ID NO:18 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

The primer sets IV are by IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-BIP of primer, IV-LF of primer and primer IV-LB composition；

IV-the F3 of primer has any one in nucleotide sequence as follows:

(e1), there is nucleotide sequence shown in SEQ ID NO:19；

(e2), have nucleotide sequence shown in SEQ ID NO:19 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

IV-the B3 of primer has any one in nucleotide sequence as follows:

(e5), there is nucleotide sequence shown in SEQ ID NO:20；

(e6), have nucleotide sequence shown in SEQ ID NO:20 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

IV-the FIP of primer has any one in nucleotide sequence as follows:

(e9), there is nucleotide sequence shown in SEQ ID NO:21；

(e10), have nucleotide sequence shown in SEQ ID NO:21 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

IV-the BIP of primer has any one in nucleotide sequence as follows:

(e13), there is nucleotide sequence shown in SEQ ID NO:22；

(e14), have nucleotide sequence shown in SEQ ID NO:22 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

IV-the LF of primer has any one in nucleotide sequence as follows:

(e17), there is nucleotide sequence shown in SEQ ID NO:23；

(e18), have nucleotide sequence shown in SEQ ID NO:23 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

IV-the LB of primer has any one in nucleotide sequence as follows:

(e21), there is nucleotide sequence shown in SEQ ID NO:24；

(e22), have nucleotide sequence shown in SEQ ID NO:24 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

2. primer according to claim 1 combination, which is characterized in that I-F3 of primer described in the primer sets I, described draw I-B3 of object, I-FIP of the primer, I-LB of I-BIP of the primer, I-LF of the primer and the primer molar ratio be 0.5: 0.5:2:2:1:1；

II-F3 of primer described in the primer sets II, II-B3 of the primer, II-FIP of the primer, II-BIP of the primer, The molar ratio of II-LB of the II-LF of primer and the primer is 0.5:0.5:2:2:1:1；

III-F3 of primer described in the primer sets III, III-B3 of the primer, III-FIP of the primer, III-BIP of the primer, The molar ratio of III-LB of the III-LF of primer and the primer is 0.5:0.5:2:2:1:1；

IV-F3 of primer, IV-B3 of the primer described in the primer sets IV, IV-FIP of the primer, IV-BIP of the primer, institute The molar ratio for stating IV-LB of IV-LF of primer and the primer is 0.5:0.5:2:2:1:1.

3. primer as claimed in claim 1 or 2 combination is in amplification rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and/or micro- Application in the nucleic acid molecules of rootlet Mucor.

4. primer combination as claimed in claim 1 or 2 is detecting and/or is identifying rhizopus oryzae, Lichtheimia corymbifera, volume branch Mucor Application in bacterium and/or Rhizomucor pusillus.

5. primer combination as claimed in claim 1 or 2 is in preparation detection and/or identification rhizopus oryzae, Lichtheimia corymbifera, volume branch Application in the kit of mucor and/or Rhizomucor pusillus.

6. including the kit of primer as claimed in claim 1 or 2 combination, which is characterized in that the purposes packet of the kit It includes:

II, it detects in sample to be tested and whether contains rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and/or Rhizomucor pusillus.

7. a kind of method for identifying rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and/or Rhizomucor pusillus, which is characterized in that Include the following steps:

(1) Plasmid DNA of the testing gene of bacterium to be measured is obtained；

(2) Plasmid DNA extracted using step (1) is respectively adopted in primer combination as claimed in claim 1 or 2 as template Primer carries out ring mediated isothermal amplification, obtains amplification；

(3) qualification result is obtained according to the amplification.

8. the method according to the description of claim 7 is characterized in that if the primer sets I is used to may be implemented with the matter Grain DNA is the specific amplification of template, contains in bacterium to be measured or candidate contains rhizopus oryzae；

If the primer sets II is used to may be implemented to contain in bacterium to be measured using the Plasmid DNA as the specific amplification of template Or candidate contains Lichtheimia corymbifera；

If the primer sets III is used to may be implemented to contain in bacterium to be measured using the Plasmid DNA as the specific amplification of template Or candidate contains Mucor circinelloides；

If the primer sets IV is used to may be implemented to contain in bacterium to be measured using the Plasmid DNA as the specific amplification of template Or candidate contains Rhizomucor pusillus.

9. whether containing rhizopus oryzae, Lichtheimia corymbifera, Mucor circinelloides and/or Rhizomucor pusillus in a kind of detection sample to be tested Method, which comprises the steps of:

(1) total DNA of sample to be tested is obtained；

(2) drawing in primer combination as claimed in claim 1 or 2 is respectively adopted as template in the total DNA extracted using step (1) Object carries out ring mediated isothermal amplification, obtains amplification；

(3) testing result is obtained according to the amplification.

10. according to the method described in claim 9, it is characterized in that, if using the primer sets I may be implemented with described total DNA is the specific amplification of template, is contained in sample to be tested or doubtful containing rhizopus oryzae；

If the primer sets II is used to may be implemented to contain in sample to be tested using the total DNA as the specific amplification of template Or doubtful contain Lichtheimia corymbifera；

If the primer sets III is used to may be implemented to contain in sample to be tested using the total DNA as the specific amplification of template Or doubtful contain Mucor circinelloides；

If the primer sets IV is used to may be implemented to contain in sample to be tested using the total DNA as the specific amplification of template Or doubtful contain Rhizomucor pusillus.