CN106591301A - LAMP primer combination for detecting resistant genes of vancomycin, and applications thereof - Google Patents
LAMP primer combination for detecting resistant genes of vancomycin, and applications thereof Download PDFInfo
- Publication number
- CN106591301A CN106591301A CN201710024527.1A CN201710024527A CN106591301A CN 106591301 A CN106591301 A CN 106591301A CN 201710024527 A CN201710024527 A CN 201710024527A CN 106591301 A CN106591301 A CN 106591301A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- vanb
- following
- drug resistant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a LAMP primer combination for detecting two bacterial drug-resistant genes of vancomycin, and applications thereof, wherein the primer combination comprises 12 primers represented by sequences 1-12. According to the present invention, the primer combination can be used for detecting whether the drug-resistant genes vanA and vanB exist, can be used for detecting whether a sample to be detected contains the drug-resistant gene vanA and/or vanB, is used for detecting and identifying the two bacterial drug-resistant genes of vancomycin, and has advantages of high specificity, high sensitivity, simple, rapid and accurate detection, and significant promotional value.
Description
Technical field
The present invention relates in biological technical field, for detecting vancomycin tolerance gene LAMP primer composition and its answering
With.
Background technology
Antibacterials are the widest class medicines of clinical practice, but in recent years the case fatality rate of infectious disease is lifted rapidly,
It is abuse of antibiotics to trace it to its cause, and the medication that fastbacteria is brought is difficult.China is abuse of antibiotics situation state the most serious
One of family, however as the increasing of antibiotic usage amount, bacterial resistance situation is also serious all the more.
Antibiotics are various, and mechanism of action is various, and wherein vancomycin (vancomycin) is a kind of glycopeptide of three rings
Various gram positive bacterias are respectively provided with powerful antibacterial action, including staphylococcus aureuses, coagulase-negative by class antibiotic
Staphylococcuses, micrococcus scarlatinae, streptococcus pneumoniae, Streptococcus viridanss and Enterococcus etc..Its Antibacterial Mechanism be with directly
Connect and combined with whole cell peptidoglycan precursor pentapeptide side chain terminal D- alanyl-D-alanine, so as to prevent Peptidoglycan polymerase
Transpeptidation, disturbs the cross link of bacteria cell wall Peptidoglycan precursor, so that bacteria cell wall can not form three dimensions
Structure and play bactericidal effect；Can also have certain effect for damaging bacterial cell membrane and suppressing bacteria RNA synthesis simultaneously, also may be used
To antibacterial performance certain function.
The reason for antibacterial produces drug resistance is a lot, is broadly divided into generation inactivator, antibacterials target site and changes, changes
Bacterial outer membrane permeability, impact are actively pumped out six aspects such as system, the formation of impact Bacterial biofilm and cross resistance.
At present a large amount of Surveillance on antibiotic resistance data display vancomycins still keep preferable antibacterial activity, but for its drug resistance phenomenon
Also it is increasingly serious.Since the eighties in 20th century, the enterococcus of vancomycin resistance and coagulase negative staphylococcus are in clinic
Occur, and have and slowly increase trend, and in recent years certain areas are separated to declining to the glycopeptide class such as vancomycin sensitivity
Staphylococcus aureuses, have caused clinical attention.
Acquired drug-resistance and natural resistance are divided into the drug resistance mode of vancomycin, are compiled by drug resistance of vancomycin gene
The presence of the enzyme of code synthesizes the precursor of low-affinity, and the wherein D-alanine residue at C- ends is replaced by D-ALPHA-Hydroxypropionic acid or D-Ser,
So as to change the action site of vancomycin, eliminate by the precursor with high-affinity for appealing to generation, so as to eliminate and ten thousand
The target position that ancient mycin is combined, causes the generation for drug resistance of vancomycin.
Mainly there is following several method with regard to the detection to bacterial drug resistance at present：Bacterial resistance phenotype detection (including
Drug resistance screening test, the instrumentation of break sensitization test and drug sensitive test and automatization etc.), beta-lactamase detection is special resistance to
Medicine bacterium detects and drug resistant gene is detected etc..Wherein the most intuitively detection method is, with the drug detection of In vitro culture, but still to deposit
In defects such as incubation time length.As the research of resistance mechanism is progressively goed deep into, molecular biology method detection bacterium drug resistance is gradually
By clinical acceptance.The method of common detection bacterium drug resistant gene mainly has：Restricted of polymerase chain reaction (PCR), PCR-
Segment length polymorphism analysis (PCR-RFLP), PCR- single-strand conformation polymorphism analysis (PCR-SSCP), biochip technology (gene
Chip), automated DNA sequencing (DNA sequencing) etc..Traditional gene identification method is PCR methods and DNA sequencing method, wherein
Traditional PCR method detection cycles are longer, it usually needs 3-4 hour；SangerDNA sequencing to primer specificity require compared with
Height, and price is costly, later data analysis is more complicated, is not suitable for clinical expansion and uses.In recent years nucleic acid that new development is got up etc.
Warm amplification technique, either in terms of response time or instrument requirements, all than round pcr advantageously.It is numerous etc. at these
It is in warm amplification technique and the most ripe, the most extensive with the application of ring mediated isothermal amplification (LAMP), its high sensitivity, Gao Te
The opposite sex, quickly amplification have obtained the inspection and accreditation in market.
The content of the invention
It is an object of the invention to provide a kind of drug resistant gene LAMP primer composition and its application for detecting vancomycin.
Present invention firstly provides a kind of primer combination, is following (a1) or (a2)：
(a1) it is made up of primer sets I and primer sets II；
(a2) primer sets I or the primer sets II；
The primer sets I are by-the F3 of the primer I ,-B3 of the primer I ,-FIP of the primer I ,-BIP of the primer I ,-LF of primer I and the-LB of primer I
Composition；
- the F3 of the primer I is following (b1) or (b2)；
(b1) single strand dna shown in the sequence 1 of sequence table；
(b2) by sequence 1 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 1
The DNA molecular of identical function；
- the B3 of the primer I is following (b3) or (b4)；
(b3) single strand dna shown in the sequence 2 of sequence table；
(b4) by sequence 2 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 2
The DNA molecular of identical function；
- the FIP of the primer I is following (b5) or (b6)；
(b5) single strand dna shown in the sequence 3 of sequence table；
(b6) by sequence 3 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 3
The DNA molecular of identical function；
- the BIP of the primer I is following (b7) or (b8)；
(b7) single strand dna shown in the sequence 4 of sequence table；
(b8) by sequence 4 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 4
The DNA molecular of identical function；
- the LF of the primer I is following (b9) or (b10)；
(b9) single strand dna shown in the sequence 5 of sequence table；
(b10) by sequence 5 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 5
The DNA molecular of identical function；
- the LB of the primer I is following (b11) or (b12)；
(b11) single strand dna shown in the sequence 6 of sequence table；
(b12) by sequence 6 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 6
The DNA molecular of identical function.
The primer sets II are by-the F3 of the primer II ,-B3 of the primer II ,-FIP of the primer II ,-BIP of the primer II ,-LF of primer II and draw
- the LB of thing II is constituted；
- the F3 of the primer II is following (c1) or (c2)；
(c1) single strand dna shown in the sequence 7 of sequence table；
(c2) by sequence 7 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 7
The DNA molecular of identical function；
- the B3 of the primer II is following (c3) or (c4)；
(c3) single strand dna shown in the sequence 8 of sequence table；
(c4) by sequence 8 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 8
The DNA molecular of identical function；
- the FIP of the primer II is following (c5) or (c6)；
(c5) single strand dna shown in the sequence 9 of sequence table；
(c6) by sequence 9 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 9
The DNA molecular of identical function；
- the BIP of the primer II is following (c7) or (c8)；
(c7) single strand dna shown in the sequence 10 of sequence table；
(c8) by sequence 10 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 10
There is the DNA molecular of identical function；
- the LF of the primer II is following (c9) or (c10)；
(c9) single strand dna shown in the sequence 11 of sequence table；
(c10) by sequence 11 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 11
There is the DNA molecular of identical function；
- the LB of the primer II is following (c11) or (c12)；
(c11) single strand dna shown in the sequence 12 of sequence table；
(c12) by sequence 12 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 12
There is the DNA molecular of identical function.
In the primer sets I ,-the F3 of the primer I ,-the B3 of the primer I ,-the FIP of the primer I ,-the BIP of the primer I,
The mol ratio of-the LF of the primer I and the-LB of the primer I can be 0.5：0.5：2：2：1：1.
In the primer sets II ,-the F3 of the primer II ,-B3 of the primer II ,-FIP of the primer II, the primer II-
The mol ratio of the BIP ,-LF of the primer II and the-LB of the primer II can be 0.5：0.5：2：2：1：1.
In the primer sets I, the amount of each primer is as follows：- the F3 of primer I described in 0.5 μm of ol ,-the B3 of primer I described in 0.5 μm of ol,
Draw described in-the FIP of primer I described in 2.0 μm of ol ,-BIP of primer I, I-LF and 1.0 μm of ol of primer described in 1.0 μm of ol described in 2.0 μm of ol
- the LB of thing I；
In the primer sets II, the amount of each primer is as follows：- the F3 of primer II, primer II described in 0.5 μm of ol described in 0.5 μm of ol-
The B3 ,-FIP of the primer II ,-BIP of primer II, II-LF and 1.0 μm of ol of primer described in 1.0 μm of ol described in 2.0 μm of ol described in 2.0 μm of ol
- the LB of the primer II；
The present invention also protects application of the primer combination in reagent preparation box；The purposes of the test kit is as follows
Or (d2) or (d3) (d1)：
(d1) bacterium to be measured whether the drug resistant gene vanA genes containing vancomycin and/or vanB genes are detected；
(d2) the drug resistant gene vanA genes and/or vanB genes of vancomycin are identified；
(d3) whether the drug resistant gene vanA genes containing vancomycin and/or vanB genes are detected in sample to be tested.
The present invention also test kit of the protection containing primer combination；The purposes of the test kit is following (d1) or (d2)
Or (d3)：
(d1) bacterium to be measured whether the drug resistant gene vanA genes containing vancomycin and/or vanB genes are detected；
(d2) the drug resistant gene vanA genes and/or vanB genes of vancomycin are identified；
(d3) whether the drug resistant gene vanA genes containing vancomycin and/or vanB genes are detected in sample to be tested.
The test kit may also include reactant liquor, the reactant liquor concretely Capitalbio Corporation Co., Ltd.'s product,
Its catalog number is CP.440020.
The present invention also protects the preparation method of the test kit, the step of including each bar primer is individually packed.
The present invention also protects a kind of detection bacterium to be measured whether the drug resistant gene vanA genes containing vancomycin and/or vanB
The method of gene, including：
(1) genomic DNA of bacterium to be measured is extracted；
(2) genomic DNA with step (1) extraction is respectively adopted each primer sets in the primer combination as template
Ring mediated isothermal amplification is carried out, is then made the following judgment：
If adopting the primer sets I to realize the specific amplification with the genomic DNA as template, bacterium to be measured contains
Have or candidate contains drug resistant gene vanA genes；
If adopting the primer sets II to realize the specific amplification with the genomic DNA as template, bacterium to be measured
Containing or candidate contain drug resistant gene vanB genes.
The present invention also protect in a kind of detection sample to be tested whether the drug resistant gene vanA genes containing vancomycin and/or
The method of vanB genes, including：
(1) STb gene of sample to be tested is extracted；
(2) as template, each primer sets being respectively adopted in the primer combination are carried out the STb gene with step (1) extraction
Ring mediated isothermal amplification, then makes the following judgment：
If adopting the primer sets I to realize the specific amplification with the STb gene as template, contain in sample to be tested
Have or doubtful containing drug resistant gene vanA genes；
If adopting the primer sets II to realize the specific amplification with the STb gene as template, in sample to be tested
Containing or it is doubtful containing drug resistant gene vanB genes.
In any of the above methods described, during using the primer sets I, draw in the reaction system of the ring mediated isothermal amplification
The molar concentration of-the F3 of the thing I ,-B3 of the primer I ,-FIP of the primer I ,-BIP of the primer I ,-LF of primer I and the-LB of primer I be followed successively by 0.5 μM,
0.5μM、2μM、2μM、1μM、1μM。
In any of the above methods described, during using the primer sets II, in the reaction system of the ring mediated isothermal amplification
The molar concentration of-the F3 of the primer II ,-B3 of the primer II ,-FIP of the primer II ,-BIP of the primer II ,-LF of primer II and the-LB of primer II is successively
For 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any of the above methods described, loop-mediated isothermal amplification condition is：65 DEG C of constant temperature 50min.
The sample to be tested can be the puss of people (Homo sapiens).
Above, it is described to realize that ring mediated isothermal amplification specifically be presented as：When being detected using quantitative fluorescent PCR
May occur in which ring mediated isothermal amplification curve.The ring mediated isothermal amplification curve can be typical " S types " amplification curve.
The present invention also protects the primer combination whether detecting bacterium to be measured containing drug resistant gene vanA genes and/or vanB
Application in gene.
The present invention also protect primer combination in detection sample to be tested whether containing drug resistant gene vanA genes and/or
Application in vanB genes.
The present invention also protects the primer to combine drug resistant gene vanA genes and/or vanB genes in identification vancomycin
In application.
Above, No. Genebank of drug resistant gene vanA genes is JN207933.1.Drug resistant gene vanB genes
No. Genebank is AY958220.1.Drug resistant gene vanA genes and vanB genes belong to the drug resistant gene of anti-vancocin.
Loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) is in recent years
Come a kind of sensitive, special, the simple, fast nucleic acid amplification technologies for developing, its principle is that have strand-displacement activity a kind of
Archaeal dna polymerase in the presence of, recognize 6-8 region 4-6 bar primers, purpose quickly, is specifically expanded under isothermal conditions
Gene, can be applied to and fast and accurately detect common Carbapenem-resistant gene.LAMP method has susceptiveness
It is high, specificity is good, the response time is short, result of determination is convenient, need not the advantage such as costliness instrument.
The primer combination identification that the present invention is provided is used to detect the drug resistance base of common two kind Macrolide vancomycin
Cause, with high specific and high sensitivity, it is possible to achieve easy, quick, accurately detection.The present invention has great promotion price
Value.
Description of the drawings
Fig. 1 is using the testing result of primer sets I in embodiment 2.
Fig. 2 is using the testing result of primer sets II in embodiment 2.
Fig. 3 is the testing result of sample one in embodiment 4.
Fig. 4 is the testing result of sample two in embodiment 4.
Specific embodiment
The present invention is further described in detail with reference to specific embodiment, the embodiment for being given is only for explaining
The bright present invention, rather than in order to limit the scope of the present invention.
Experimental technique in following embodiments, if no special instructions, is conventional method.
Material used, reagent etc. in following embodiments, if no special instructions, commercially obtain.
Quantitative test in following examples, is respectively provided with three repetitions and tests, results averaged.
Reactant liquor is Capitalbio Corporation Co., Ltd.'s product, and catalog number is CP.440020.
The computational methods of DNA copy number are as follows：
The 1 A260 absorbances=μ g/ml of ds DNA 50；
Nucleic acid concentration=(OD260) × (extension rate) × (50)=x ng/ μ l；
Mean molecule quantity (MW) representative gram/mol, unit dalton (dolton), i.e. 1dolton=1g/mol；
Mole=6.02 × 1023；
Mean molecule quantity (MW):DsDNA=(base number) × (660 dalton/base)；
Copy number computing formula:
(6.02×1023Copies/ mole) × (x ng/ μ l × 10-9)/(DNA length × 660)=copies/ μ l.
The preparation of embodiment 1, primer sets I and primer sets II
Test kit is made up of two LAMP primer groups, and each primer sets is used to detect a kind of drug resistance of vancomycin gene.
For detecting that drug resistant gene vanA primer sets are following (5 ' → 3 ')：
Outer primer F3 (sequence 1)：CAATTGCTATTCAGCTGTACT；
Outer primer B3 (sequence 2)：CGATTTGTCCATACAAATTGCT；
Inner primer FIP (sequence 3)：GCTACATCAACATGGTTGATTTCATCTCGCCGGATAAAAAAATGCA；
Inner primer BIP (sequence 4)：GCAAGTCAGGTGAAGATGGATCGAGCTTTGAATATCGCAGCCTA；
Ring primer LF (sequence 5)：GGTTCTTTTTAACAAGTAATCCG；
Ring primer LB (sequence 6)：ACAAGGTCTGTTTGAATTGTC.
For detecting that drug resistant gene vanB primer sets are following (5 ' → 3 ')：
Outer primer F3 (sequence 7)：AGAAGCGGCAGGACAAT；
Outer primer B3 (sequence 8)：CTCGACCGGAATGTCTG；
Inner primer FIP (sequence 9)：CCATGACCGCACACCCGAGGAAAAATCTTAATTGAGCAAGCG；
Inner primer BIP (sequence 10)：GGCTGAGCCACGGTATCTTCCGGGAACTGTAATCATCGCAT；
Ring primer LF (sequence 11)：CTCACAGCCCGAAAT；
Ring primer LB (sequence 12)：CATCAGGAAAACGAGC.
For detecting that the primer sets of drug resistant gene vanA are named as primer sets I.For detecting the primer of drug resistant gene vanB
Group is named as primer sets II.
The primer combination of the drug resistant gene of detection vancomycin is made up of primer sets I and primer sets II, in the primer combination,
The each independent packaging of each single stranded DNA.
In primer sets I ,-the F3 of the primer I ,-B3 of the primer I ,-FIP of the primer I ,-BIP of the primer I ,-LF of primer I and the-LB's of primer I
Mol ratio is 0.5：0.5：2：2：1：1；
In primer sets II ,-the F3 of the primer II ,-B3 of the primer II ,-FIP of the primer II ,-BIP of the primer II ,-LF of primer II and primer
The mol ratio of II-LB is 0.5：0.5：2：2：1：1.
The specificity of the primer combination of the drug resistant gene of embodiment 2, vancomycin
First, the preparation of sample to be tested
Sample to be tested 1：Drug resistant gene vanA gene plasmids.
Sample to be tested 2：Drug resistant gene vanB gene plasmids.
The preparation method of each plasmid is as follows：
Drug resistant gene vanA gene plasmids：WillDNA between the EcoRI and SpeI of-T Easy plasmids (Promega)
Fragment replaces with the DNA molecular shown in the nucleotide sequence that No. Genebank is JN207933.1, obtains recombiant plasmid, the plasmid
As drug resistant gene vanA gene plasmids.
Drug resistant gene vanB gene plasmids：WillDNA between the EcoRI and SpeI of-T Easy plasmids (Promega)
Fragment replaces with the DNA molecular shown in the nucleotide sequence that No. Genebank is AY958220.1, obtains recombiant plasmid, the plasmid
As drug resistant gene vanB gene plasmids.
2nd, the detection of sample to be tested
Each sample to be tested carries out respectively following steps and is detected：
Plasmid DNA with step one is respectively adopted the primer sets I and primer sets II of the preparation of embodiment 1 to step as template
The one 2 plasmids-drug resistant gene vanA gene plasmids for preparing and drug resistant gene vanB gene plasmids carry out ring mediated isothermal amplification
Detection, each primer combination detects 2 kinds of plasmids.
Reaction system (10 μ L)：(Capitalbio Corporation Co., Ltd.'s product, its catalog number is 7.0 μ L reactant liquors
CP.440020), 1 μ L primer mixtures, 1 μ L template DNAs (5pg-50pg), moisturizing to 10 μ L.Primer mixture is primer sets I
Or the mixture of each bar primer composition in primer sets II.In reaction system, the final concentration of outer primer F3 and outer primer B3 is
0.5 μM, the final concentration of inner primer FIP and inner primer BIP is 2 μM, and the final concentration of ring primer LF and ring primer LB is 1 μM.
Reaction condition：65 DEG C of constant temperature 50min.
In course of reaction, fluorescence signal is detected using fluorescent PCR instrument.
Fig. 1 is shown in using the result of primer sets I.Only show when sample to be tested is drug resistant gene vanA gene plasmids
Positive amplification curve (i.e. amplification curve is typical " S types " amplification curve).Do not show when sample to be tested is sample to be tested 2
Show positive amplification curve." S types " amplification curve is the result of sample to be tested 1 in Fig. 1；Have one in " S types " amplification curve non-in Fig. 1
Bar is the result of sample to be tested 2, and remaining is the result for being not added with template.
Fig. 2 is shown in using the result of primer sets II.It is aobvious only when sample to be tested is drug resistant gene vanB gene plasmids
Show positive amplification curve (i.e. amplification curve is typical " S types " amplification curve).When sample to be tested is sample to be tested 1 not
Show positive amplification curve." S types " amplification curve is the result of sample to be tested 2 in Fig. 2；Have in " S types " amplification curve non-in Fig. 2
One result for sample to be tested 1, remaining is the result for being not added with template.
Result above shows, 2 primer components in the primer combination of the drug resistant gene of the vancomycin that the present invention is provided
It is other to have very high specificity to its target gene.
The susceptiveness of the primer combination of the drug resistant gene of embodiment 3, vancomycin
Sample to be tested 1：The drug resistant gene vanA gene plasmids of embodiment 2.
Sample to be tested 2：The drug resistant gene vanB gene plasmids of embodiment 2.
1st, the plasmid DNA of sample to be tested is extracted, with sterilized water gradient dilution is carried out, obtain each diluent.
2nd, the diluent for being obtained with step 1 as template, enter by the primer sets I and primer sets II that the preparation of embodiment 1 is respectively adopted
Row ring mediated isothermal amplification.
When sample to be tested is sample to be tested 1, using primer sets I ring mediated isothermal amplification is carried out.Sample to be tested is to treat test sample
During sheet 2, using primer sets II ring mediated isothermal amplification is carried out.
Reaction system (10 μ L)：(Capitalbio Corporation Co., Ltd.'s product, its catalog number is 7.0 μ L reactant liquors
CP.440020), (genome copy numbers contained in 1 μ L diluents are respectively 10 for 1 μ L primer mixtures, 1 μ L diluents3、5×
102、102Or 101), moisturizing to 10 μ L.Primer mixture is the mixing of primer sets I or the composition of each bar primer in primer sets II
Thing.In reaction system, the final concentration of outer primer F3 and outer primer B3 is 0.5 μM, and the end of inner primer FIP and inner primer BIP is dense
Degree is 2 μM, and the final concentration of ring primer LF and ring primer LB is 1 μM.
Reaction condition：65 DEG C of constant temperature 50min.
In course of reaction, fluorescence signal is detected using fluorescent PCR instrument.
If occurring positive amplification curve (i.e. amplification curve is typical " S types " amplification curve) in 50min, show anti-
The corresponding gene group content in system is answered to be detected.If not occurring positive amplification curve in 50min (to expand
Increase curve for typical " S types " amplification curve), show that the corresponding gene group content in reaction system can not be detected.
The sensitivity of the detection target gene of primer sets I is 5 × 102Individual copy number/reaction system, the detection target of primer sets II
The sensitivity of gene is 5 × 102Individual copy number/reaction system.
Embodiment 4, using vancomycin drug resistant gene primer combine detection clinical sample
Sample to be tested is following sample one or sample two：
Sample one：The puss of the people containing vanA genes are confirmed by susceptibility identification and PCR sequencing identifications；
Sample two：The puss of the people containing vanB genes are confirmed by susceptibility identification and PCR sequencing identifications.
1st, the STb gene of sample to be tested is extracted.
2nd, the STb gene with step 1 extraction is respectively adopted each primer sets of the preparation of embodiment 1 to these three samples as template
Originally ring mediated isothermal amplification is carried out, each primer combination detects two kinds of samples.
Reaction system is with reaction condition with embodiment 2.
In course of reaction, fluorescence signal is detected using fluorescent PCR instrument.
The result of sample one is shown in Fig. 3.Positive amplification curve is shown when only detection using primer sets I.Draw when adopting
Positive amplification curve is not shown when other primer sets beyond thing group I, it is consistent with practical situation." S types " expands in Fig. 3
Increase result of the curve for primer sets I；There is a result for being primer sets II in " S types " amplification curve non-in Fig. 3, remaining is not
The result of addition template.
The result of sample two is shown in Fig. 4.Positive amplification curve is shown when only detection using primer sets II.Draw when adopting
Positive amplification curve is not shown when other primer sets beyond thing group II, it is consistent with practical situation.In Fig. 4 " S types "
Amplification curve is the result of primer sets II；There is a result for being primer sets I in " S types " amplification curve non-in Fig. 4, remaining is
It is not added with the result of template.
Result above shows that the primer combination of the drug resistant gene of the vancomycin provided using the present invention can carry out two kinds
The detection of common drug resistance of vancomycin gene, as a result accurately and reliably.
<110>Capitalbio Corporation Co., Ltd.
<120>For detecting vancomycin tolerance gene LAMP primer composition and its application
<160> 12
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 1
caattgctat tcagctgtac t 21
<210> 2
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 2
cgatttgtcc atacaaattg ct 22
<210> 3
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 3
gctacatcaa catggttgat ttcatctcgc cggataaaaa aatgca 46
<210> 4
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 4
gcaagtcagg tgaagatgga tcgagctttg aatatcgcag ccta 44
<210> 5
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 5
ggttcttttt aacaagtaat ccg 23
<210> 6
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 6
acaaggtctg tttgaattgt c 21
<210> 7
<211> 17
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 7
agaagcggca ggacaat 17
<210> 8
<211> 17
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 8
ctcgaccgga atgtctg 17
<210> 9
<211> 42
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 9
ccatgaccgc acacccgagg aaaaatctta attgagcaag cg 42
<210> 10
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 10
ggctgagcca cggtatcttc cgggaactgt aatcatcgca t 41
<210> 11
<211> 15
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 11
ctcacagccc gaaat 15
<210> 12
<211> 16
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 12
catcaggaaa acgagc 16
Claims (9)
1. primer combination, is following (a1) or (a2)：
(a1) it is made up of primer sets I and primer sets II；
(a2) primer sets I or the primer sets II；
The primer sets I are by-the F3 of the primer I ,-B3 of the primer I ,-FIP of the primer I ,-BIP of the primer I ,-LF of primer I and the-LB groups of primer I
Into；
- the F3 of the primer I is following (b1) or (b2)；
(b1) single strand dna shown in the sequence 1 of sequence table；
(b2) by sequence 1 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 1 identical
The DNA molecular of function；
- the B3 of the primer I is following (b3) or (b4)；
(b3) single strand dna shown in the sequence 2 of sequence table；
(b4) by sequence 2 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 2 identical
The DNA molecular of function；
- the FIP of the primer I is following (b5) or (b6)；
(b5) single strand dna shown in the sequence 3 of sequence table；
(b6) by sequence 3 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 3 identical
The DNA molecular of function；
- the BIP of the primer I is following (b7) or (b8)；
(b7) single strand dna shown in the sequence 4 of sequence table；
(b8) by sequence 4 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 4 identical
The DNA molecular of function；
- the LF of the primer I is following (b9) or (b10)；
(b9) single strand dna shown in the sequence 5 of sequence table；
(b10) by sequence 5 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 5 identical
The DNA molecular of function；
- the LB of the primer I is following (b11) or (b12)；
(b11) single strand dna shown in the sequence 6 of sequence table；
(b12) by sequence 6 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 6 identical
The DNA molecular of function；
The primer sets II are by-the F3 of the primer II ,-B3 of the primer II ,-FIP of the primer II ,-BIP of the primer II ,-LF of primer II and primer
II-LB is constituted；
- the F3 of the primer II is following (c1) or (c2)；
(c1) single strand dna shown in the sequence 7 of sequence table；
(c2) by sequence 7 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 7 identical
The DNA molecular of function；
- the B3 of the primer II is following (c3) or (c4)；
(c3) single strand dna shown in the sequence 8 of sequence table；
(c4) by sequence 8 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 8 identical
The DNA molecular of function；
- the FIP of the primer II is following (c5) or (c6)；
(c5) single strand dna shown in the sequence 9 of sequence table；
(c6) by sequence 9 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has with sequence 9 identical
The DNA molecular of function；
- the BIP of the primer II is following (c7) or (c8)；
(c7) single strand dna shown in the sequence 10 of sequence table；
(c8) by sequence 10 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has phase with sequence 10
The DNA molecular of congenerous；
- the LF of the primer II is following (c9) or (c10)；
(c9) single strand dna shown in the sequence 11 of sequence table；
(c10) by sequence 11 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has phase with sequence 11
The DNA molecular of congenerous；
- the LB of the primer II is following (c11) or (c12)；
(c11) single strand dna shown in the sequence 12 of sequence table；
(c12) by sequence 12 is through the replacement of one or several nucleotide and/or disappearance and/or adds and has phase with sequence 12
The DNA molecular of congenerous.
2. application of the primer combination in reagent preparation box described in claim 1；The purposes of the test kit for following (d1) or
Or (d3) (d2)：
(d1) bacterium to be measured whether drug resistant gene vanA and/or vanB containing vancomycin are detected；
(d2) the drug resistant gene vanA and/or vanB of vancomycin are identified；
(d3) whether drug resistant gene vanA and/or vanB containing vancomycin are detected in sample to be tested.
3. containing the test kit of primer combination described in claim 1；The purposes of the test kit for following (d1) or (d2) or
(d3)：
(d1) bacterium to be measured whether drug resistant gene vanA and/or vanB containing vancomycin are detected；
(d2) the drug resistant gene vanA and/or vanB of vancomycin are identified；
(d3) whether drug resistant gene vanA and/or vanB containing vancomycin are detected in sample to be tested.
4. the preparation method of test kit described in claim 3, the step of including each bar primer is individually packed.
5. whether there is the method for drug resistant gene vanA and/or vanB in a kind of detection bacterium to be measured, comprise the steps：
(1) genomic DNA of bacterium to be measured is extracted；
(2) as template, each primer sets being respectively adopted in the primer combination are carried out the genomic DNA with step (1) extraction
Ring mediated isothermal amplification, then makes the following judgment：
If adopting the primer sets I to realize the specific amplification with the genomic DNA as template, contain in bacterium to be measured
Or candidate contains vanA；
If adopting the primer sets II to realize the specific amplification with the genomic DNA as template, contain in bacterium to be measured
Have or candidate contains vanB.
6. whether contain the method containing drug resistant gene vanA and/or vanB in a kind of detection sample to be tested, comprise the steps：
(1) STb gene of sample to be tested is extracted；
(2) as template, each primer sets being respectively adopted in the primer combination carry out ring Jie to the STb gene with step (1) extraction
Isothermal duplication is led, is then made the following judgment：
If adopting the primer sets I to realize the specific amplification with the STb gene as template, in sample to be tested contain or
It is doubtful containing drug resistant gene vanA；
If adopting the primer sets II to realize the specific amplification with the STb gene as template, contain in sample to be tested
Or it is doubtful containing drug resistant gene vanB.
7. whether primer combination is detecting bacterium to be measured containing the application in drug resistant gene vanA and/or vanB described in claim 1.
8. whether primer described in claim 1 is combined in detection sample to be tested containing in drug resistant gene vanA and/or vanB
Using.
9. primer described in claim 1 combines the application in the drug resistant gene vanA and/or vanB of identification vancomycin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710024527.1A CN106591301A (en) | 2017-01-11 | 2017-01-11 | LAMP primer combination for detecting resistant genes of vancomycin, and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710024527.1A CN106591301A (en) | 2017-01-11 | 2017-01-11 | LAMP primer combination for detecting resistant genes of vancomycin, and applications thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106591301A true CN106591301A (en) | 2017-04-26 |
Family
ID=58584680
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710024527.1A Pending CN106591301A (en) | 2017-01-11 | 2017-01-11 | LAMP primer combination for detecting resistant genes of vancomycin, and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106591301A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107475364A (en) * | 2017-06-30 | 2017-12-15 | 北京百康芯生物科技有限公司 | Drug resistant gene micro-fluidic chip quick detection kit and detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177157A (en) * | 2015-10-14 | 2015-12-23 | 中国人民解放军疾病预防控制所 | LAMP kit for VanB gene detection and primer special for same |
-
2017
- 2017-01-11 CN CN201710024527.1A patent/CN106591301A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177157A (en) * | 2015-10-14 | 2015-12-23 | 中国人民解放军疾病预防控制所 | LAMP kit for VanB gene detection and primer special for same |
Non-Patent Citations (2)
| Title |
|---|
| HYE JIN KIM等: "Loop-mediated isothermal amplification of vanA gene enables a rapid and naked-eye detection of vancomycin-resistant enterococci infection", 《JOURNAL OF MICROBIOLOGICAL METHODS》 * |
| 吴绍熙等: "《现代医学真菌检验手册》", 30 June 2005, 中国协和医科大学出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107475364A (en) * | 2017-06-30 | 2017-12-15 | 北京百康芯生物科技有限公司 | Drug resistant gene micro-fluidic chip quick detection kit and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103173561B (en) | Detect primer and the probe of gene mecA in methicillin-resistant staphylococcus aureus | |
| EP3192878B1 (en) | Method for detecting mycoplasma | |
| Kurupati et al. | Rapid detection of Klebsiella pneumoniae from blood culture bottles by real-time PCR | |
| CN105793436A (en) | Detection of methicillin-resistant staphylococcus aureus in biological samples | |
| CN110669851A (en) | Primer and/or probe composition for detecting cocci causing bloodstream infections and use thereof | |
| CN106754906A (en) | LAMP primer composition and its application for detecting seven kinds of drug resistant genes of Carbapenem-resistant class antibiotic | |
| US20110287965A1 (en) | Methods and compositions to detect clostridium difficile | |
| CN105368943B (en) | A kind of kit and method for identification of mycobacterium strain | |
| CN109706145A (en) | Primer sets and its application | |
| CN113584191A (en) | Primer, probe and kit for multiplex PCR detection of 7 drug-resistant genes | |
| CN106754905A (en) | LAMP primer composition and its application for detecting methicillin-resistant staphylococcus aureus | |
| CN106591301A (en) | LAMP primer combination for detecting resistant genes of vancomycin, and applications thereof | |
| KR20180124619A (en) | Primers used for LAMP reaction for the detection of mycoplasma and its use | |
| CN106544445A (en) | For detecting LAMP primer composition and its application of two kinds of drug resistant genes of aminoglycoside-resistant antibiotic | |
| CN110684854A (en) | Primer and probe set for detecting helicobacter pylori drug-resistant mutation site and application | |
| CN108085408A (en) | The kit for detecting nucleic acid of quick detection bacterium sexual centre nervous system infection cause of disease | |
| CN112708658B (en) | Liquid chip primer group for detecting multiple drug-resistant genes and application thereof | |
| CN108642169A (en) | Detect ten kinds of trimethoprim class Drug-resistant genetic methods and used kit | |
| CN109988857A (en) | For detecting two kinds of cryptococcal LAMP primer compositions and its application | |
| JP6387500B2 (en) | E. coli genotyping method and primer set used therefor | |
| CN106636426A (en) | Glycopeptide antibiotic drug-resistance gene detection kit | |
| CN106636422A (en) | LAMP (loop-mediated isothermal amplification) primer composition for detecting drug-resistant genes of three bacteria generating AmpC enzymes and application of primer composition | |
| CN106754907A (en) | LAMP primer composition and its application for detecting three kinds of bacterial resistance genes of Extended-spectrum β-lactamases | |
| CN106591300A (en) | LAMP primer combination used for detecting two macrolide antibiotic-resistant anti-drug genes, and application thereof | |
| CN102676646A (en) | Reverse dot-blot hybridization gene chip and production method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170426 |
|
| RJ01 | Rejection of invention patent application after publication |