CN109988855B - LAMP primer combination for detecting six kinds of aspergillus and application thereof - Google Patents

LAMP primer combination for detecting six kinds of aspergillus and application thereof Download PDF

Info

Publication number
CN109988855B
CN109988855B CN201711471982.2A CN201711471982A CN109988855B CN 109988855 B CN109988855 B CN 109988855B CN 201711471982 A CN201711471982 A CN 201711471982A CN 109988855 B CN109988855 B CN 109988855B
Authority
CN
China
Prior art keywords
aspergillus
primer
sequence
detected
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201711471982.2A
Other languages
Chinese (zh)
Other versions
CN109988855A (en
Inventor
张岩
王颢婷
邢婉丽
蔡美静
盖伟
程京
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CapitalBio Corp
Original Assignee
CapitalBio Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CapitalBio Corp filed Critical CapitalBio Corp
Priority to CN201711471982.2A priority Critical patent/CN109988855B/en
Publication of CN109988855A publication Critical patent/CN109988855A/en
Application granted granted Critical
Publication of CN109988855B publication Critical patent/CN109988855B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a LAMP primer combination for detecting six kinds of aspergillus and application thereof. The primer combination provided by the invention consists of 36 primers shown in a sequence 1 to a sequence 36. The primer combination provided by the invention can be applied to detecting whether a sample to be detected contains Aspergillus fumigatus and/or Aspergillus terreus and/or Aspergillus nidulans and/or Aspergillus flavus and/or Aspergillus niger and/or Aspergillus calidus. The primer combination provided by the invention is used for detecting 6 aspergilli in aspergillus, has high specificity and high sensitivity, and can realize simple, quick and accurate detection. The invention has great popularization value.

Description

LAMP primer combination for detecting six kinds of aspergillus and application thereof
Technical Field
The invention relates to the technical field of biology, in particular to an LAMP primer combination for detecting six aspergilli and application thereof.
Background
Invasive Fungal Disease (IFD), also known as Invasive Fungal Infection (IFI), Deep Fungal Infection (DFI), refers to the pathophysiological process in which fungi invade human tissues and blood, grow and multiply therein, cause inflammatory reactions, and cause tissue damage and organ dysfunction. Over the last two thirty years, with the wide clinical application of new technologies such as solid organ and hematopoietic stem cell transplantation, tumor chemotherapy, immunosuppressants and the like, the incidence and fatality rate of invasive mycosis are increasing year by year, and the incidence and fatality rate become one of the main causes of death of hospitalized patients increasingly. Because the invasive mycosis is infected in the population such as ICU, senile, diabetes, malignant blood system diseases, candida colonization, invasive operation, application of antibacterial drugs, glucocorticoids, immunosuppressants and the like, the immunity of the organism is low, and the severe mortality rate is high, the method has very important significance for early detection of the invasive fungal infection and determination of the infected strain.
Aspergillosis is usually caused by Aspergillus (Aspergillus), often resulting in lung disease or damage to the immune system in humans. The spores of Aspergillus are about 2-5 μ M in size and are easily suspended in air. Most people do not infect diseases when inhaling spores, but patients with low immunity or lung diseases have higher infection rate and cause infection or secondary infection, such as allergic bronchial aspergillosis, allergic aspergillus nasosinusitis, aspergillus tumor, chronic pulmonary aspergillosis, invasive aspergillosis, skin aspergillosis and the like. 2011 Liu Zaoning et al, which was retrospectively investigated in many centers of patients with pulmonary mycosis clinically diagnosed in 1998 to 2007 in China, showed that pulmonary aspergillosis was 37.9%, ranking first.
The existing invasive fungal infection detection method mainly comprises a conventional detection method and a special detection method. The conventional inspection method mainly comprises the following steps: 1) microscopic examination of fungi, namely direct smear staining microscopic examination; 2) culturing and identifying fungi; 3) and (5) histopathological examination. The special inspection method mainly comprises the following steps: 1) serological examination; 2) and (5) molecular biological examination. The conventional inspection method is still regarded as a foundation stone for determining invasive fungal infection, but the conventional inspection method has the problems of low sensitivity, complicated operation, incapability of excluding diagnosis due to negative results, long detection period (usually requiring several days to several weeks), and the like, so that the condition and medication are delayed, the death rate is increased, and the like; serological tests have difficulty excluding interspecies antigen-antibody cross-reactions of certain genera of fungi, leading to false positives. Compared with the former two methods, the molecular biology technology has the advantages of high specificity and high accuracy, and can elucidate the taxonomic relation between and in fungal populations from the gene level, so that the molecular biology technology is more and more widely accepted and applied in recent years. The related molecular diagnosis methods established at present comprise a common PCR method, a pulse field gel electrophoresis typing (PFGE), a multi-site sequence typing (MLST), a restriction fragment length polymorphism analysis (RFLP), a real-time fluorescent quantitative PCR technology (RTFQ-PCR) and the like, and the common problems are that the requirements on experimental operation are high, and the detection time is long (about 2.5h-3 h). Therefore, it is the key to solve the current situation to establish a fast and accurate molecular diagnosis method and provide an early diagnosis and treatment basis for clinical application.
Disclosure of Invention
The invention aims to provide an LAMP primer combination for detecting six aspergilli and application thereof.
The invention firstly provides a primer combination, which consists of a primer group I, a primer group II, a primer group III, a primer group IV, a primer group V and a primer group VI;
the primer group I consists of a primer I-F3, a primer I-B3, a primer I-FIP, a primer I-BIP, a primer I-LF and a primer I-LB;
the primer I-F3 is (a1) or (a 2):
(a1) a single-stranded DNA molecule shown in sequence 1 of the sequence table;
(a2) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 1 and have the same functions as the sequence 1;
the primer I-B3 is (a3) or (a 4):
(a3) a single-stranded DNA molecule shown in a sequence 2 of a sequence table;
(a4) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 2 and have the same functions as the sequence 2;
the primer I-FIP is (a5) or (a 6):
(a5) a single-stranded DNA molecule shown in sequence 3 of the sequence table;
(a6) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 3 and have the same functions as the sequence 3;
the primer I-BIP is (a7) or (a 8):
(a7) a single-stranded DNA molecule shown in a sequence 4 of a sequence table;
(a8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 4 and having the same functions as the sequence 4;
the primers I-LF are (a9) or (a 10):
(a9) a single-stranded DNA molecule shown in sequence 5 of the sequence table;
(a10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 5 and having the same functions as the sequence 5;
the primer I-LB is (a11) or (a 12):
(a11) a single-stranded DNA molecule shown in sequence 6 of the sequence table;
(a12) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 6 and having the same functions as the sequence 6;
the primer group II consists of a primer II-F3, a primer II-B3, a primer II-FIP, a primer II-BIP, a primer II-LF and a primer II-LB;
the primer II-F3 is (b1) or (b 2):
(b1) a single-stranded DNA molecule shown in sequence 7 of the sequence table;
(b2) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 7 and having the same functions as the sequence 7;
the primer II-B3 is (B3) or (B4):
(b3) a single-stranded DNA molecule shown in a sequence 8 of a sequence table;
(b4) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 8 and have the same functions as the sequence 8;
the primer II-FIP is (b5) or (b6) as follows:
(b5) a single-stranded DNA molecule shown in sequence 9 of the sequence table;
(b6) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 9 and has the same function as the sequence 9;
the primer II-BIP is (b7) or (b 8):
(b7) a single-stranded DNA molecule shown in sequence 10 of the sequence table;
(b8) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 10 and has the same function as the sequence 10;
the primer II-LF is (b9) or (b10) as follows:
(b9) a single-stranded DNA molecule shown in sequence 11 of the sequence table;
(b10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 11 and having the same functions as the sequence 11;
the primer II-LB is (b11) or (b 12):
(b11) a single-stranded DNA molecule shown in sequence 12 of the sequence table;
(b12) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 12 and has the same function as the sequence 12;
the primer group III consists of a primer III-F3, a primer III-B3, a primer III-FIP, a primer III-BIP, a primer III-LF and a primer III-LB;
the primer III-F3 is (c1) or (c 2):
(c1) a single-stranded DNA molecule shown in sequence 13 of the sequence table;
(c2) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 13 and has the same function as the sequence 13;
the primer III-B3 is (c3) or (c 4):
(c3) a single-stranded DNA molecule shown as a sequence 14 in a sequence table;
(c4) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 14 and has the same function as the sequence 14;
the primer III-FIP is (c5) or (c6) as follows:
(c5) a single-stranded DNA molecule shown in sequence 15 of the sequence table;
(c6) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 15 and having the same functions as the sequence 15;
the primer III-BIP is (c7) or (c8) as follows:
(c7) a single-stranded DNA molecule shown in sequence 16 of the sequence table;
(c8) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 16 and has the same function as the sequence 16;
the primer III-LF is (c9) or (c 10):
(c9) a single-stranded DNA molecule shown in sequence 17 of the sequence table;
(c10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 17 and having the same functions as the sequence 17;
the primer III-LB is (c11) or (c 12):
(c11) a single-stranded DNA molecule shown in sequence 18 of the sequence table;
(c12) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 18 and has the same function as the sequence 18;
the primer group IV consists of a primer IV-F3, a primer IV-B3, a primer IV-FIP, a primer IV-BIP, a primer IV-LF and a primer IV-LB;
the primer IV-F3 is (d1) or (d 2):
(d1) a single-stranded DNA molecule shown as sequence 19 in the sequence table;
(d2) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 19 and having the same functions as the sequence 19;
the primer IV-B3 is (d3) or (d 4):
(d3) a single-stranded DNA molecule shown in sequence 20 of the sequence table;
(d4) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 20 and having the same functions as the sequence 20;
the primer IV-FIP is (d5) or (d 6):
(d5) a single-stranded DNA molecule shown in sequence 21 of the sequence table;
(d6) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 21 and has the same function as the sequence 21;
the primer IV-BIP is (d7) or (d 8):
(d7) a single-stranded DNA molecule shown as a sequence 22 in a sequence table;
(d8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 22 and having the same functions as the sequence 22;
the primer IV-LF is (d9) or (d 10):
(d9) a single-stranded DNA molecule shown as sequence 23 in the sequence table;
(d10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 23 and having the same functions as the sequence 23;
the primer IV-LB is (d11) or (d 12):
(d11) a single-stranded DNA molecule shown in sequence 24 of the sequence table;
(d12) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 24 and having the same functions as the sequence 24;
the primer group V consists of a primer V-F3, a primer V-B3, a primer V-FIP, a primer V-BIP, a primer V-LF and a primer V-LB;
the primer V-F3 is (e1) or (e 2):
(e1) a single-stranded DNA molecule shown as sequence 25 in the sequence table;
(e2) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 25 and having the same functions as the sequence 25;
the primer V-B3 is (e3) or (e 4):
(e3) a single-stranded DNA molecule shown as a sequence 26 in a sequence table;
(e4) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 26 and has the same function as the sequence 26;
the primer V-FIP is (e5) or (e6) as follows:
(e5) a single-stranded DNA molecule shown as sequence 27 in the sequence table;
(e6) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 27 and has the same function as the sequence 27;
the primer V-BIP is (e7) or (e8) as follows:
(e7) a single-stranded DNA molecule shown as sequence 28 in the sequence table;
(e8) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 28 and has the same function as the sequence 28;
the primer V-LF is (e9) or (e 10):
(e9) a single-stranded DNA molecule shown as sequence 29 in the sequence table;
(e10) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 29 and has the same function as the sequence 29;
the primer V-LB is (e11) or (e 12):
(e11) a single-stranded DNA molecule shown as a sequence 30 in a sequence table;
(e12) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 30 and has the same function as the sequence 30;
the primer group VI consists of a primer VI-F3, a primer VI-B3, a primer VI-FIP, a primer VI-BIP, a primer VI-LF and a primer VI-LB;
the primer VI-F3 is (F1) or (F2):
(f1) a single-stranded DNA molecule shown as sequence 31 in the sequence table;
(f2) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 31 and has the same function as the sequence 31;
the primer VI-B3 is (f3) or (f 4):
(f3) a single-stranded DNA molecule shown as a sequence 32 in a sequence table;
(f4) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 32 and has the same function as the sequence 32;
the primer VI-FIP is (f5) or (f 6):
(f5) a single-stranded DNA molecule shown as a sequence 33 in a sequence table;
(f6) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 33 and having the same functions as the sequence 33;
the primer VI-BIP is (f7) or (f 8):
(f7) a single-stranded DNA molecule shown in sequence 34 of the sequence table;
(f8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 34 and having the same functions as the sequence 34;
the primer VI-LF is (f9) or (f 10):
(f9) a single-stranded DNA molecule shown in sequence 35 of the sequence table;
(f10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 35 and having the same functions as the sequence 35;
the primer VI-LB is (f11) or (f 12):
(f11) a single-stranded DNA molecule shown as a sequence 36 in a sequence table;
(f12) and (b) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 36 and has the same function as the sequence 36.
The application of the primer combination is any one of the following (g1) - (g 6):
(g1) identifying Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger and Aspergillus calidoteus;
(g2) preparing a kit for identifying Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger and Aspergillus calidus;
(g3) identifying whether the microorganism to be detected is Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger or Aspergillus calidus;
(g4) preparing a kit for identifying whether the microorganism to be detected is Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger or Aspergillus calidus;
(g5) detecting whether the sample to be detected contains Aspergillus fumigatus and/or Aspergillus terreus and/or Aspergillus nidulans and/or Aspergillus flavus and/or Aspergillus niger and/or Aspergillus calidoteus;
(g6) preparing a kit for detecting whether a sample to be detected contains Aspergillus fumigatus and/or Aspergillus terreus and/or Aspergillus nidulans and/or Aspergillus flavus and/or Aspergillus niger and/or Aspergillus caliidus.
The invention also protects the application of the primer combination, which is any one of the following (g1) - (g 6):
(g1) identifying Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger and Aspergillus calidus;
(g2) preparing a kit for identifying Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger and Aspergillus calidus;
(g3) identifying whether the microorganism to be detected is Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger or Aspergillus calidus;
(g4) preparing a kit for identifying whether the microorganism to be detected is Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger or Aspergillus calidus;
(g5) detecting whether the sample to be detected contains Aspergillus fumigatus and/or Aspergillus terreus and/or Aspergillus nidulans and/or Aspergillus flavus and/or Aspergillus niger and/or Aspergillus calidoteus;
(g6) preparing a kit for detecting whether a sample to be detected contains Aspergillus fumigatus and/or Aspergillus terreus and/or Aspergillus nidulans and/or Aspergillus flavus and/or Aspergillus niger and/or Aspergillus caliidus.
The invention also protects a kit containing the primer combination; the application of the kit is as follows (h1), (h2) or (h 3):
(h1) identifying Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger and Aspergillus calidus;
(h2) identifying whether the microorganism to be detected is Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger or Aspergillus calidus;
(h3) and detecting whether the sample to be detected contains Aspergillus fumigatus and/or Aspergillus terreus and/or Aspergillus nidulans and/or Aspergillus flavus and/or Aspergillus niger and/or Aspergillus calidoteus.
The invention also provides a preparation method of the kit, which comprises the step of packaging each primer independently.
The invention also protects a method for identifying Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger and Aspergillus calidus, which is the method A or the method B.
The method A comprises the following steps: taking the genome DNA of aspergillus to be detected as a template, and respectively adopting a primer group I to a primer group VI in the primer combination to carry out loop-mediated isothermal amplification, wherein if the primer group I is adopted, the specific amplification taking the genome DNA as the template can be realized, and the aspergillus to be detected is or is selected as aspergillus fumigatus; if the primer group II is adopted, the specific amplification with the genome DNA as a template can be realized, and the aspergillus to be detected is or is selected as aspergillus terreus; if the primer group III is adopted, the specific amplification with the genome DNA as a template can be realized, and the aspergillus to be detected is or is selected as aspergillus nidulans; if the primer group IV is adopted, the specific amplification with the genome DNA as a template can be realized, and the aspergillus to be detected is or is selected as aspergillus flavus; if the primer group V is adopted, the specific amplification with the genome DNA as a template can be realized, and the aspergillus to be detected is the aspergillus niger or is a candidate of the aspergillus niger; if the primer group VI is adopted, the specific amplification with the genome DNA as a template can be realized, and the Aspergillus to be detected is or is selected as Aspergillus caliidus.
The method B comprises the following steps: detecting whether the genome DNA of the aspergillus to be detected contains the target sequences from the primer group I to the primer group VI or not, wherein if the genome DNA contains the target sequence of the primer group I, the aspergillus to be detected is or is selected as the aspergillus fumigatus; if the genome DNA contains the target sequence of the primer group II, the aspergillus to be detected is or is selected as aspergillus terreus; if the genome DNA contains the target sequence of the primer group III, the aspergillus to be detected is or is selected as aspergillus nidulans; if the genome DNA contains the target sequence of the primer group IV, the aspergillus to be detected is or is selected as aspergillus flavus; if the genome DNA contains the target sequence of the primer group V, the aspergillus to be detected is the aspergillus niger or the candidate aspergillus niger; if the genome DNA contains the target sequence of the primer group VI, the Aspergillus to be detected is or is selected as Aspergillus caliidus.
The invention also protects and identifies whether the microorganism to be detected is Aspergillus fumigatus or Aspergillus terreus or Aspergillus nidulans or Aspergillus flavus or Aspergillus niger or Aspergillus calidus, and the method is the method C or the method D.
The method C comprises the following steps: taking genome DNA of a microorganism to be detected as a template, and respectively adopting a primer group I to a primer group VI in the primer combination to carry out loop-mediated isothermal amplification, wherein if the primer group I is adopted, the specific amplification taking the genome DNA as the template can be realized, and the microorganism to be detected is or is selected as aspergillus fumigatus; if the primer group II is adopted, the specific amplification with the genome DNA as a template can be realized, and the microorganism to be detected is aspergillus terreus or is a candidate of aspergillus terreus; if the primer group III is adopted, the specific amplification with the genome DNA as a template can be realized, and the microorganism to be detected is or is selected as aspergillus nidulans; if the primer group IV is adopted, the specific amplification with the genome DNA as a template can be realized, and the microorganism to be detected is or is selected as aspergillus flavus; if the primer group V is adopted, the specific amplification with the genome DNA as a template can be realized, and the microorganism to be detected is Aspergillus niger or is candidate; if the primer set VI is adopted, the specific amplification with the genome DNA as a template can be realized, the microorganism to be detected is or is selected to be Aspergillus caliidus, if the primer pair I to the primer set VI is adopted, the specific amplification with the genome DNA as the template can not be realized, and the microorganism to be detected is Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger and Aspergillus caliidus.
The method D comprises the following steps: detecting whether the genome DNA of the microorganism to be detected contains the target sequences of the primer group I to the primer group VI or not, wherein if the genome DNA contains the target sequence of the primer group I, the microorganism to be detected is or is selected as aspergillus fumigatus; if the genome DNA contains the target sequence of the primer group II, the microorganism to be detected is aspergillus terreus or is a candidate for aspergillus terreus; if the genome DNA contains the target sequence of the primer group III, the microorganism to be detected is or is selected as aspergillus nidulans; if the genome DNA contains the target sequence of the primer group IV, the microorganism to be detected is or is selected as aspergillus flavus; if the genome DNA contains the target sequence of the primer group V, the microorganism to be detected is Aspergillus niger or is selected as Aspergillus niger candidate; if the genome DNA contains the target sequence of the primer group VI, the microorganism to be detected is or is selected as Aspergillus caliidus; if the genome DNA does not contain the target sequence of any primer group from the primer group I to the primer group VI, the microorganism to be detected is Aspergillus fumigatus and non-Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus and Aspergillus caliidus.
The invention also protects a method for detecting whether the sample to be detected contains Aspergillus fumigatus and/or Aspergillus terreus and/or Aspergillus nidulans and/or Aspergillus flavus and/or Aspergillus niger and/or Aspergillus calidus, which is method E or method F.
The method E comprises the following steps: taking total DNA of a sample to be detected as a template, and respectively adopting a primer group I to a primer group VI in the primer combination to carry out loop-mediated isothermal amplification, wherein if the primer group I is adopted, the specific amplification taking the total DNA as the template can be realized, and the sample to be detected contains aspergillus fumigatus; if the primer group II is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains aspergillus terreus; if the primer group III is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains aspergillus nidulans; if the primer group IV is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains aspergillus flavus; if the primer group V is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains Aspergillus niger; if the primer set VI is adopted, the specific amplification with the total DNA as a template can be realized, the sample to be detected contains Aspergillus caliidus, if the primer pair I to the primer set VI is adopted, the specific amplification with the total DNA as the template can not be realized, and the sample to be detected does not contain Aspergillus fumigatus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger and Aspergillus caliidus.
The method F comprises the following steps: detecting whether the total DNA of a sample to be detected contains target sequences of the primer group I to the primer group VI or not, wherein if the total DNA contains the target sequence of the primer group I, the sample to be detected contains aspergillus fumigatus; if the total DNA contains the target sequence of the primer group II, the sample to be detected contains aspergillus terreus; if the total DNA contains the target sequence of the primer group III, the sample to be detected contains aspergillus nidulans; if the total DNA contains the target sequence of the primer group IV, the sample to be detected contains aspergillus flavus; if the total DNA contains the target sequence of the primer group V, the sample to be detected contains Aspergillus niger; if the total DNA contains the target sequence of the primer group VI, the sample to be detected contains Aspergillus caliidus; if the total DNA does not contain the target sequence of any one of the primer group I to the primer group VI, the sample to be detected does not contain Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus niger and Aspergillus caliidus.
In any of the above methods, when the primer set I is used for loop-mediated isothermal amplification, the molar concentrations of the primers I-F3, I-B3, I-FIP, I-BIP, I-LF and I-LB in the reaction system are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.
In any of the above methods, when the primer set II is used for loop-mediated isothermal amplification, the molar concentrations of the primer II-F3, the primer II-B3, the primer II-FIP, the primer II-BIP, the primer II-LF and the primer II-LB in the reaction system are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.
In any of the above methods, when the primer set III is used for performing the LAMP, the molar concentrations of the primer III-F3, the primer III-B3, the primer III-FIP, the primer III-BIP, the primer III-LF and the primer III-LB in the reaction system are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.
In any of the above methods, when the primer set IV is used for loop-mediated isothermal amplification, the molar concentrations of the primer IV-F3, the primer IV-B3, the primer IV-FIP, the primer IV-BIP, the primer IV-LF and the primer IV-LB in the reaction system are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M in sequence.
In any of the above methods, when the primer set V is used for loop-mediated isothermal amplification, the molar concentrations of the primer V-F3, the primer V-B3, the primer V-FIP, the primer V-BIP, the primer V-LF and the primer V-LB in the reaction system are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.
In any of the above methods, when the primer set VI is used for loop-mediated isothermal amplification, the molar concentrations of the primer VI-F3, the primer VI-B3, the primer VI-FIP, the primer VI-BIP, the primer VI-LF and the primer VI-LB in the reaction system are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M in sequence.
In any of the above methods, the loop-mediated isothermal amplification reaction conditions are: keeping the temperature at 65 ℃ for 50 min.
The invention also protects the primer group I or II or III or IV or V or VI.
The invention also protects the application of the primer group I in the preparation of a kit A, or the application of the primer group II in the preparation of a kit B, or the application of the primer group III in the preparation of a kit C, or the application of the primer group IV in the preparation of a kit D, or the application of the primer group V in the preparation of a kit E, or the application of the primer group VI in the preparation of a kit F;
the application of the kit A is (i1) or (i 2):
(i1) identifying whether the microorganism to be detected is aspergillus fumigatus;
(i2) detecting whether the sample to be detected contains aspergillus fumigatus;
the application of the kit B is as follows (i3) or (i 4):
(i3) identifying whether the microorganism to be detected is aspergillus terreus;
(i4) detecting whether the sample to be detected contains aspergillus terreus;
the application of the kit C is (i5) or (i 6):
(i5) identifying whether the microorganism to be detected is aspergillus nidulans;
(i6) detecting whether the sample to be detected contains aspergillus nidulans or not;
the application of the kit D is as follows (i7) or (i 8):
(i7) identifying whether the microorganism to be detected is aspergillus flavus;
(i8) detecting whether the sample to be detected contains aspergillus flavus;
the application of the kit E is (i9) or (i 10):
(i9) identifying whether the microorganism to be detected is aspergillus niger or not;
(i10) detecting whether the sample to be detected contains aspergillus niger or not;
the application of the kit F is (i11) or (i 12):
(i11) identifying whether the microorganism to be detected is Aspergillus caliidostus;
(i12) and detecting whether the sample to be detected contains Aspergillus caliidostus.
The invention also protects a kit A containing the primer group I, or a kit B containing the primer group II, or a kit C containing the primer group III, or a kit D containing the primer group IV, or a kit E containing the primer group V, or a kit F containing the primer group VI;
the application of the kit A is (i1) or (i 2):
(i1) identifying whether the microorganism to be detected is aspergillus fumigatus;
(i2) detecting whether the sample to be detected contains aspergillus fumigatus;
the application of the kit B is as follows (i3) or (i 4):
(i3) identifying whether the microorganism to be detected is aspergillus terreus;
(i4) detecting whether the sample to be detected contains aspergillus terreus;
the application of the kit C is as follows (i5) or (i 6):
(i5) identifying whether the microorganism to be detected is aspergillus nidulans;
(i6) detecting whether the sample to be detected contains aspergillus nidulans or not;
the application of the kit D is as follows (i7) or (i 8):
(i7) identifying whether the microorganism to be detected is aspergillus flavus;
(i8) detecting whether the sample to be detected contains aspergillus flavus;
the application of the kit E is (i9) or (i 10):
(i9) identifying whether the microorganism to be detected is aspergillus niger or not;
(i10) detecting whether the sample to be detected contains aspergillus niger or not;
the application of the kit F is (i11) or (i 12):
(i11) identifying whether the microorganism to be detected is Aspergillus caliidostus;
(i12) and detecting whether the sample to be detected contains Aspergillus caliidostus.
Any one of the Aspergillus to be detected or the microorganism to be detected can be Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger or Aspergillus calidus. The aspergillus fumigatus can be specifically CGMCC, and the strain number is as follows: 3.08027 Aspergillus fumigatus. The aspergillus terreus can be specifically CGMCC, and the strain number is as follows: 3.08115 Aspergillus terreus. The aspergillus nidulans can be CGMCC specifically, and the strain number is as follows: 3.06379. The aspergillus flavus can be specifically CGMCC, and the strain number is as follows: 3.06434 Aspergillus flavus. The Aspergillus niger specifically can be CGMCC, and the strain number is as follows: 3.06478.
Any one of the above samples to be detected may specifically be human (Homo sapiens) sputum.
The loop-mediated isothermal amplification (LAMP) is a sensitive, specific, simple and rapid nucleic acid amplification technology developed in recent years, and the principle is that under the action of DNA polymerase with strand displacement activity, 4-6 primers of 6-8 regions are identified, a target gene is rapidly and specifically amplified under an isothermal condition, and the LAMP can be popularized and applied to rapid and accurate detection of common carbapenem drug-resistant genes. The LAMP method has the advantages of high sensitivity, good specificity, short reaction time, convenient judgment result, no need of expensive instruments and the like.
The primer combination provided by the invention is used for detecting common aspergillus hexaflumineus, has high specificity and high sensitivity, and can realize simple, convenient, rapid and accurate detection. The invention has great popularization value.
Drawings
FIG. 1 shows the results of detection using the primer set I in example 2.
FIG. 2 shows the results of detection using the primer set II in example 2.
FIG. 3 shows the results of detection using the primer set III in example 2.
FIG. 4 shows the results of detection using the primer set IV in example 2.
FIG. 5 shows the results of detection using the primer set V in example 2.
FIG. 6 shows the results of detection using the primer set VI in example 2.
FIG. 7 shows the results of the detection of sample one in example 4.
FIG. 8 shows the results of the detection of sample two in example 4.
FIG. 9 shows the results of the detection of sample three in example 4.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
The reaction solution is a product of Boao biological group, Inc., and the catalog number is CP.440020.
The DNA copy number was calculated as follows:
1a260 absorbance value ds DNA 50 μ g/ml;
nucleic acid concentration (OD260) × (dilution factor) × (50) × ng/μ l;
average Molecular Weight (MW) represents grams per mole in daltons (dolton), i.e., 1dolton ═ 1 g/mol;
molar ratio is 6.02X 1023；
Average Molecular Weight (MW) dsDNA ═ (number of bases) x (660 daltons/base);
copy number calculation formula:
(6.02×1023copies/mole) × (xng/μ l × 10-9) /(DNA length. times.660) ═ copies/. mu.l.
Example 1 preparation of primer combinations for detecting six species of Aspergillus
The primer combination for detecting six aspergilli consists of six LAMP primer groups, and each primer group is used for detecting one aspergilli.
Primer sets for detection of aspergillus fumigatus were as follows (5 '→ 3'):
primers I-F3 (SEQ ID NO: 1): GGATGCTGACAACAACGG, respectively;
primer I-B3 (SEQ ID NO: 2): GGTCGAAGACCTTGAAAGCT, respectively;
primer I-FIP (SEQ ID NO: 3): TGTTCTCTCCCCTCCCGAGCACCATCGATTTCCCCGG, respectively;
primer I-BIP (SEQ ID NO: 4): ATCAGAATTCCTTACCATGATGGCCCGAATTTCCTCTTCGGAGTC, respectively;
primers I-LF (sequence 5): TCATACCGAAAGTATCACATA, respectively;
primers I-LB (SEQ ID NO: 6): TCGGAAGATGAAGGACAC is added.
Primer sets for detection of aspergillus terreus were as follows (5 '→ 3'):
primer II-F3 (SEQ ID NO: 7): GATTGCCTCATGCGACC, respectively;
primer II-B3 (SEQ ID NO: 8): TTGTTGTCAGCATCAACCTC, respectively;
primer II-FIP (SEQ ID NO: 9): GGCCTACATGGTGTTAAATGATCGAATCGATTGCATCGTTCTATGTCG;
primer II-BIP (SEQ ID NO: 10): CACCACCAAGGAGCTGGGAGTTGATCATGTCCTGGAGC;
primer II-LF (SEQ ID NO: 11): ACAGAAGATAAAGTCAAGACTC, respectively;
primer II-LB (SEQ ID NO: 12): CAGAACCCCTCCGAGT are provided.
The primer sets for detection of aspergillus nidulans were as follows (5 '→ 3'):
primer III-F3 (SEQ ID NO: 13): ACGCGAACTCCCCA, respectively;
primer III-B3 (SEQ ID NO: 14): GTCATGACGTGACGC;
primer III-FIP (SEQ ID NO: 15): CTGGCCATCATGGTAAGGAACTCATCTACTTCGCACCAGC, respectively;
primer III-BIP (SEQ ID NO: 16): AGGACACCGATTCCGAGGAGAGCAGCGGAGATGAAAC;
primer III-LF (SEQ ID NO: 17): TTAGCATTAGTACATTTCT, respectively;
primer III-LB (SEQ ID NO: 18): GGCGTTCAAGGTCT are provided.
The primer set for detecting Aspergillus flavus was as follows (5 '→ 3'):
primer IV-F3 (SEQ ID NO: 19): ATCTCGGATGTGTCCTGTT, respectively;
primer IV-B3 (SEQ ID NO: 20): GATCGGAGGAGCCATTGT, respectively;
primer IV-FIP (SEQ ID NO: 21): ACACACCGGAGCCGTCAAGATATCTGCCACATGTTTGCT, respectively;
primer IV-BIP (SEQ ID NO: 22): AAGTACAGCCTGTATACACCTCGACCTTGCCGTCAGATCCATTC, respectively;
primer IV-LF (SEQ ID NO: 23): GGTTTGCCTGCAAAGTTG, respectively;
primer IV-LB (SEQ ID NO: 24): ACGAACGACGACCATATG are provided.
The primer set used for detection of A.niger was as follows (5 '→ 3'):
primer V-F3 (SEQ ID NO: 25): CCAGATCACCACCAAGGAG, respectively;
primer V-B3 (SEQ ID NO: 26): CGAGCCATCATGGTAAGGAATT;
primer V-FIP (SEQ ID NO: 27): GTTGATCATGTCCTGAAGCTCAGACCTCGGCACTGTGATGCG, respectively;
primer V-BIP (SEQ ID NO: 28): GACGCTGACAACAACGGAACGATCACAATCCAGCCCGCAT, respectively;
primer V-LF (sequence 29): GGTTCTGGCCAAGGGAG, respectively;
primer V-LB (SEQ ID NO: 30): CGACTTCCCCGGTATGT is added.
The primer set for detection of Aspergillus calidotustus was as follows (5 '→ 3'):
primer VI-F3 (SEQ ID NO: 31): CCCTATTTGTAAGTCG, respectively;
primer VI-B3 (SEQ ID NO: 32): CCTAAACGCATTCACAC;
primer VI-FIP (SEQ ID NO: 33): TCACCATCCTTGTCCTGTTCAAAGCACCGATCG, respectively;
primer VI-BIP (SEQ ID NO: 34): ACTCCGGCAACGTTAAGGCTAATTGATGGGGCTA, respectively;
primer VI-LF (sequence 35): GAAAAGGGTAAATAA, respectively;
primer VI-LB (SEQ ID NO: 36): CGCATACGCTCAGC are provided.
The primer set for detecting Aspergillus fumigatus was named primer set I.
The primer set for detecting Aspergillus terreus was designated as primer set II.
The primer set for detecting A.nidulans was designated as primer set III.
The primer set used for detecting Aspergillus flavus was named primer set IV.
The primer set for detecting Aspergillus niger was designated as primer set V.
The primer set for detecting Aspergillus caliidus was designated as primer set VI.
In the primer combination, each single-stranded DNA is independently packaged.
In the primer group I, the molar ratio of a primer I-F3 to a primer I-B3 to a primer I-FIP to a primer I-BIP to a primer I-LF to a primer I-LB is 0.5: 0.5: 2: 2: 1: 1;
in the primer group II, the molar ratio of the primer II-F3 to the primer II-B3 to the primer II-FIP to the primer II-BIP to the primer II-LF to the primer II-LB is 0.5: 0.5: 2: 2: 1: 1;
in the primer group III, the molar ratio of a primer III-F3 to a primer III-B3 to a primer III-FIP to a primer III-BIP to a primer III-LF to a primer III-LB is 0.5: 0.5: 2: 2: 1: 1.
in the primer group IV, the molar ratio of a primer IV-F3 to a primer IV-B3 to a primer IV-FIP to a primer IV-BIP to a primer IV-LF to a primer IV-LB is 0.5: 0.5: 2: 2: 1: 1.
in the primer group V, the molar ratio of the primer V-F3, the primer V-B3, the primer V-FIP, the primer V-BIP, the primer V-LF and the primer V-LB is 0.5: 0.5: 2: 2: 1: 1.
in the primer group VI, the molar ratio of the primer VI-F3 to the primer VI-B3 to the primer VI-FIP to the primer VI-BIP to the primer VI-LF to the primer VI-LB is 0.5: 0.5: 2: 2: 1: 1.
example 2 specificity
Firstly, preparation of sample to be tested
1, sample to be tested: aspergillus fumigatus (CGMCC, strain number: 3.08027) genomic DNA;
sample to be tested 2: aspergillus terreus (CGMCC, strain number: 3.08115) genomic DNA;
and 3, a sample to be detected: aspergillus nidulans (CGMCC, strain number: 3.06379) genomic DNA;
and 4, sample to be detected: aspergillus flavus (CGMCC, strain number: 3.06434) genomic DNA;
and 5, a sample to be detected: aspergillus niger (CGMCC, strain number: 3.06478) genomic DNA;
and 6, a sample to be detected: detecting gene plasmid DNA by Aspergillus calidolustus; the plasmid was prepared as follows: inserting a DNA molecule with the Genbank number of HE650910.1 into a SacI site of a pUC57 plasmid (biological engineering (Shanghai) Co., Ltd.) to obtain a recombinant plasmid, wherein the recombinant plasmid is an Aspergillus calildostus detection gene plasmid.
Second, detection of the sample to be detected
And (3) taking each sample to be detected in the step one as a template, and respectively adopting the primer group I, the primer group II, the primer group III, the primer group IV, the primer group V and the primer group VI prepared in the embodiment 1 to perform loop-mediated isothermal amplification detection on the template.
Reaction system (10 μ L): mu.L of the reaction mixture (product catalog number: CP.440020, product of Boo Bio Inc.), 1. mu.L of the primer mixture, 1. mu.L of the template DNA (5pg-50pg), and 10. mu.L of water. The primer mixture is a mixture consisting of the primers in the primer group I, the primer group II, the primer group III, the primer group IV, the primer group V or the primer group VI. In the reaction system, the final concentrations of the primer F3 and the primer B3 were 0.5. mu.M, the final concentrations of the primer FIP and the primer BIP were 2. mu.M, and the final concentrations of the primer LF and the primer LB were 1. mu.M, respectively.
The reaction conditions are as follows: keeping the temperature at 65 ℃ for 50 min.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.
If a positive amplification curve (i.e., an amplification curve that is typically a "sigmoid" amplification curve) appears within 50min, it indicates that the corresponding genomic content in the reaction system can be detected. If no positive amplification curve (i.e. amplification curve is typical "S-type" amplification curve) appears within 50min, it indicates that the corresponding genome content in the reaction system cannot be detected.
The results using primer set I are shown in FIG. 1. The results showed that a positive amplification curve (i.e., an amplification curve that is a typical "sigmoid" amplification curve) was shown only when the sample to be tested was Aspergillus fumigatus genomic DNA (sample 1 to be tested). And when the sample to be detected is a sample 2, 3, 4, 5 or 6 to be detected, a positive amplification curve is not displayed.
The results using primer set II are shown in FIG. 2. The results showed that a positive amplification curve (i.e., an amplification curve that is a typical "sigmoid" amplification curve) was shown only when the sample to be tested was aspergillus terreus genomic DNA (sample 2 to be tested). When the sample to be detected is the sample to be detected 1, 3, 4, 5 or 6, a positive amplification curve is not displayed.
The results using primer set III are shown in FIG. 3. The results showed that a positive amplification curve (i.e., an amplification curve that is typical of the "sigmoid" amplification curve) was shown only when the sample to be tested was Aspergillus nidulans genomic DNA (sample 3 to be tested). And when the sample to be detected is a sample 1, 2, 4, 5 or 6 to be detected, a positive amplification curve is not displayed.
The results using primer set IV are shown in FIG. 4. The results show that a positive amplification curve (i.e., an amplification curve that is a typical "sigmoid" amplification curve) is only shown when the sample to be tested is Aspergillus flavus genomic DNA (sample 4 to be tested). And when the sample to be detected is a sample 1, 2, 3, 5 or 6 to be detected, a positive amplification curve is not displayed.
The results using primer set V are shown in FIG. 5. The results show that a positive amplification curve (i.e.an amplification curve that is typically an "S-type" amplification curve) is only shown when the sample to be tested is Aspergillus niger genomic DNA (sample 5). When the sample to be detected is the sample to be detected 1, 2, 3, 4 or 6, a positive amplification curve is not displayed.
The results using primer set VI are shown in FIG. 6. The results showed that a positive amplification curve (i.e.an amplification curve which is typically an "S-shaped" amplification curve) was shown only when the sample to be tested was Aspergillus calidotatus test gene plasmid DNA (sample 6 to be tested). When the sample to be detected is the sample to be detected 1, 2, 3, 4 or 5, a positive amplification curve is not displayed.
The results show that the six primer groups in the Aspergillus primer combination provided by the invention have high specificity to the target genes of the primer groups.
Example 3 sensitivity
Sample to be tested 1: aspergillus fumigatus (CGMCC, strain number: 3.08027) genomic DNA;
and 2, sample to be tested: aspergillus terreus (CGMCC, strain number: 3.08115) genomic DNA;
and 3, a sample to be detected: aspergillus nidulans (CGMCC, strain number: 3.06379) genomic DNA;
sample to be tested 4: aspergillus flavus (CGMCC, strain number: 3.06434) genomic DNA;
and 5, a sample to be detected: aspergillus niger (CGMCC, strain number: 3.06478) genomic DNA;
and 6, a sample to be detected: detecting gene plasmid DNA by Aspergillus calidolustus; the plasmid was prepared as follows: inserting a DNA molecule with the Genbank number of HE650910.1 into a SacI site of a pUC57 plasmid (biological engineering (Shanghai) Co., Ltd.) to obtain a recombinant plasmid, wherein the recombinant plasmid is an Aspergillus calildostus detection gene plasmid.
1. And (4) carrying out gradient dilution on the sample to be detected by using sterile water to obtain each diluent.
2. The diluent obtained in step 1 was used as a template, and the primer set I, the primer set II, the primer set III, the primer set IV, the primer set V and the primer set VI prepared in example 1 were used for loop-mediated isothermal amplification.
And when the sample to be detected is the sample 1 to be detected, performing loop-mediated isothermal amplification by using the primer group I. And when the sample to be detected is the sample 2 to be detected, performing loop-mediated isothermal amplification by using the primer group II. And when the sample to be detected is a sample 3 to be detected, performing loop-mediated isothermal amplification by using the primer group III. And when the sample to be detected is a sample 4 to be detected, performing loop-mediated isothermal amplification by using the primer group IV. And when the sample to be detected is the sample 5 to be detected, performing loop-mediated isothermal amplification by using the primer group V. And when the sample to be detected is the sample 6 to be detected, performing loop-mediated isothermal amplification by using the primer group VI.
Reaction system (10 μ L): 7.0. mu.L of the reaction mixture (product catalog No. CP.440020, product of Boo Bio Inc.), 1. mu.L of the primer mixture, and 1. mu.L of the diluent (each 1. mu.L of the diluent contains 10 copies of the genome3、5×102、102、5×101Or 101) Water was added to 10. mu.L. The primer mixture is a mixture consisting of the primers in the primer group I, the primer group II, the primer group III, the primer group IV, the primer group V or the primer group VI. In the reaction system, the final concentrations of the primer F3 and the primer B3 were 0.5. mu.M, the final concentrations of the primer FIP and the primer BIP were 2. mu.M, and the final concentrations of the primer LF and the primer LB were 1. mu.M, respectively.
Reaction conditions are as follows: keeping the temperature at 65 ℃ for 50 min.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.
If a positive amplification curve (i.e., an amplification curve that is typically a "sigmoid" amplification curve) appears within 50min, it indicates that the corresponding genomic content in the reaction system can be detected. If no positive amplification curve (i.e. amplification curve is typical "S-type" amplification curve) appears within 50min, it indicates that the corresponding genome content in the reaction system cannot be detected.
The results showed that the sensitivity of primer set I for detecting the target gene was 5X 102The sensitivity of primer group II for detecting target genes is 5 multiplied by 101The sensitivity of primer group III for detecting target genes is 5 multiplied by 102The sensitivity of the primer group IV for detecting the target gene is 5 multiplied by 102The sensitivity of the primer group V for detecting the target gene is 5 multiplied by 102The sensitivity of the primer group VI for detecting the target gene is 5 multiplied by 102Number of copies/reaction system.
Example 4 clinical sample testing
The sample to be detected is the following sample I, sample II or sample III:
a first sample: human sputum containing aspergillus fumigatus has been sequenced, identified and confirmed;
sample two: sequencing, identifying and confirming human sputum containing aspergillus flavus;
sample three: human sputum containing Aspergillus niger has been identified by sequencing.
1. And extracting the total DNA of the sample to be detected.
2. Taking the total DNA extracted in the step 1 as a template, respectively adopting each primer group prepared in the embodiment 1 to perform loop-mediated isothermal amplification on the three samples, and detecting three samples by each primer combination.
The reaction system and reaction conditions were the same as in example 2.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.
If a positive amplification curve (i.e., an amplification curve that is typically a "sigmoid" amplification curve) appears within 50min, it indicates that the corresponding genomic content in the reaction system can be detected. If no positive amplification curve (i.e. the amplification curve is a typical "S-type" amplification curve) appears within 50min, it indicates that the corresponding genome content in the reaction system cannot be detected.
The results for sample one are shown in figure 7. The results showed that only the detection with primer set I showed a positive amplification curve. When other primer groups except the primer group I are adopted, the positive amplification curve is not shown, and the condition is consistent with the actual condition.
The results for sample two are shown in FIG. 8. The result shows that a positive amplification curve is shown only when the primer group IV is used for detection. When other primer groups except the primer group IV are adopted, no positive amplification curve is shown, and the conditions are consistent with the actual conditions.
The results for sample three are shown in FIG. 9. The results showed that only the detection with primer set V showed a positive amplification curve. When other primer sets than the primer set V are adopted, no positive amplification curve is shown, which is consistent with the actual situation.
The results show that the Aspergillus primer combination provided by the invention can be used for detecting 6 common Aspergillus, and the results are accurate and reliable.
<110> Boao bionts Ltd
<120> LAMP primer combination for detecting six aspergilli and application thereof
<160> 36
<210> 1
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 1
ggatgctgac aacaacgg 18
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 2
ggtcgaagac cttgaaagct 20
<210> 3
<211> 37
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 3
tgttctctcc cctcccgagc accatcgatt tccccgg 37
<210> 4
<211> 45
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 4
atcagaattc cttaccatga tggcccgaat ttcctcttcg gagtc 45
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 5
tcataccgaa agtatcacat a 21
<210> 6
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 6
tcggaagatg aaggacac 18
<210> 7
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 7
gattgcctca tgcgacc 17
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 8
ttgttgtcag catcaacctc 20
<210> 9
<211> 48
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 9
ggcctacatg gtgttaaatg atcgaatcga ttgcatcgtt ctatgtcg 48
<210> 10
<211> 38
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 10
caccaccaag gagctgggag ttgatcatgt cctggagc 38
<210> 11
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 11
acagaagata aagtcaagac tc 22
<210> 12
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 12
cagaacccct ccgagt 16
<210> 13
<211> 14
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 13
acgcgaactc ccca 14
<210> 14
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 14
gtcatgacgt gacgc 15
<210> 15
<211> 40
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 15
ctggccatca tggtaaggaa ctcatctact tcgcaccagc 40
<210> 16
<211> 37
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 16
aggacaccga ttccgaggag agcagcggag atgaaac 37
<210> 17
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 17
ttagcattag tacatttct 19
<210> 18
<211> 14
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 18
ggcgttcaag gtct 14
<210> 19
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 19
atctcggatg tgtcctgtt 19
<210> 20
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 20
gatcggagga gccattgt 18
<210> 21
<211> 39
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 21
acacaccgga gccgtcaaga tatctgccac atgtttgct 39
<210> 22
<211> 44
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 22
aagtacagcc tgtatacacc tcgaccttgc cgtcagatcc attc 44
<210> 23
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 23
ggtttgcctg caaagttg 18
<210> 24
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 24
acgaacgacg accatatg 18
<210> 25
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 25
ccagatcacc accaaggag 19
<210> 26
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 26
cgagccatca tggtaaggaa tt 22
<210> 27
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 27
gttgatcatg tcctgaagct cagacctcgg cactgtgatg cg 42
<210> 28
<211> 40
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 28
gacgctgaca acaacggaac gatcacaatc cagcccgcat 40
<210> 29
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 29
ggttctggcc aagggag 17
<210> 30
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 30
cgacttcccc ggtatgt 17
<210> 31
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 31
ccctatttgt aagtcg 16
<210> 32
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 32
cctaaacgca ttcacac 17
<210> 33
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 33
tcaccatcct tgtcctgttc aaagcaccga tcg 33
<210> 34
<211> 34
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 34
actccggcaa cgttaaggct aattgatggg gcta 34
<210> 35
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 35
gaaaagggta aataa 15
<210> 36
<211> 14
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 36
cgcatacgct cagc 14

Claims (6)

1. The primer combination comprises a primer group I, a primer group II, a primer group III, a primer group IV, a primer group V and a primer group VI;
the primer group I consists of a primer I-F3, a primer I-B3, a primer I-FIP, a primer I-BIP, a primer I-LF and a primer I-LB;
the primers I-F3 are single-stranded DNA molecules shown in a sequence 1 in a sequence table;
the primer I-B3 is a single-stranded DNA molecule shown in a sequence 2 in a sequence table;
the primer I-FIP is a single-stranded DNA molecule shown in a sequence 3 in a sequence table;
the primer I-BIP is a single-stranded DNA molecule shown in a sequence 4 of a sequence table;
the primers I-LF are single-stranded DNA molecules shown in a sequence 5 of a sequence table;
the primers I-LB are single-stranded DNA molecules shown in sequence 6 of a sequence table;
the primer group II consists of a primer II-F3, a primer II-B3, a primer II-FIP, a primer II-BIP, a primer II-LF and a primer II-LB;
the primer II-F3 is a single-stranded DNA molecule shown in a sequence 7 in a sequence table;
the primer II-B3 is a single-stranded DNA molecule shown in a sequence 8 in a sequence table;
the primer II-FIP is a single-stranded DNA molecule shown in a sequence 9 of a sequence table;
the primer II-BIP is a single-stranded DNA molecule shown in a sequence 10 in a sequence table;
the primer II-LF is a single-stranded DNA molecule shown in a sequence 11 of a sequence table;
the primer II-LB is a single-stranded DNA molecule shown in a sequence 12 in a sequence table;
the primer group III consists of a primer III-F3, a primer III-B3, a primer III-FIP, a primer III-BIP, a primer III-LF and a primer III-LB;
the primer III-F3 is a single-stranded DNA molecule shown in a sequence 13 in a sequence table;
the primer III-B3 is a single-stranded DNA molecule shown in a sequence 14 in a sequence table;
the primer III-FIP is a single-stranded DNA molecule shown in a sequence 15 in a sequence table;
the primer III-BIP is a single-stranded DNA molecule shown in a sequence 16 in a sequence table;
the primer III-LF is a single-stranded DNA molecule shown in a sequence 17 of a sequence table;
the primer III-LB is a single-stranded DNA molecule shown in a sequence 18 in a sequence table;
the primer group IV consists of a primer IV-F3, a primer IV-B3, a primer IV-FIP, a primer IV-BIP, a primer IV-LF and a primer IV-LB;
the primer IV-F3 is a single-stranded DNA molecule shown in a sequence 19 in a sequence table;
the primer IV-B3 is a single-stranded DNA molecule shown in a sequence 20 in a sequence table;
the primer IV-FIP is a single-stranded DNA molecule shown in a sequence 21 of a sequence table;
the primer IV-BIP is a single-stranded DNA molecule shown in a sequence 22 of a sequence table;
the primer IV-LF is a single-stranded DNA molecule shown in a sequence 23 of a sequence table;
the primer IV-LB is a single-stranded DNA molecule shown in a sequence 24 in a sequence table;
the primer group V consists of a primer V-F3, a primer V-B3, a primer V-FIP, a primer V-BIP, a primer V-LF and a primer V-LB;
the primer V-F3 is a single-stranded DNA molecule shown in a sequence 25 in a sequence table;
the primer V-B3 is a single-stranded DNA molecule shown in a sequence 26 in a sequence table;
the primer V-FIP is a single-stranded DNA molecule shown in a sequence 27 in a sequence table;
the primer V-BIP is a single-stranded DNA molecule shown in a sequence 28 of a sequence table;
the primer V-LF is a single-stranded DNA molecule shown in a sequence 29 in a sequence table;
the primer V-LB is a single-stranded DNA molecule shown in a sequence 30 of a sequence table;
the primer group VI consists of a primer VI-F3, a primer VI-B3, a primer VI-FIP, a primer VI-BIP, a primer VI-LF and a primer VI-LB;
the primer VI-F3 is a single-stranded DNA molecule shown in a sequence 31 in a sequence table;
the primer VI-B3 is a single-stranded DNA molecule shown in a sequence 32 in a sequence table;
the primer VI-FIP is a single-stranded DNA molecule shown in a sequence 33 of a sequence table;
the primer VI-BIP is a single-stranded DNA molecule shown in a sequence 34 of a sequence table;
the primer VI-LF is a single-stranded DNA molecule shown in a sequence 35 of a sequence table;
the primer VI-LB is a single-stranded DNA molecule shown in a sequence 36 of the sequence table.
2. The primer combination of claim 1, wherein the primer combination is any one of the following (g1) - (g 6):
(g1) identification of Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger andAspergillus calidoustus；
(g2) preparation method for identifying Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger and Aspergillus nigerAspergillus calidoustusThe kit of (1);
(g3) identifying whether the microorganism to be detected is aspergillus fumigatus or aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger orAspergillus calidoustus；
(g4) Preparing a microorganism for identifying whether the microorganism to be detected is aspergillus fumigatus or aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger orAspergillus calidoustusThe kit of (1);
(g5) detecting whether the sample to be detected contains aspergillus fumigatus and/or aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus and/or aspergillus niger and/orAspergillus calidoustus；
(g6) Preparing a sample for detecting whether the sample to be detected contains aspergillus fumigatus and/or aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus and/or aspergillus niger and/orAspergillus calidoustusThe kit of (1);
the use is for non-disease diagnostic and therapeutic purposes.
3. A kit comprising the primer combination of claim 1; the application of the kit is as follows (h1), (h2) or (h 3):
(h1) identification of Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger andAspergillus calidoustus；
(h2) identifying whether the microorganism to be detected is aspergillus fumigatus or aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger orAspergillus calidoustus；
(h3) Detecting whether the sample to be detected contains aspergillus fumigatus and/or aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus and/or aspergillus niger and/orAspergillus calidoustus。
4. Identification of Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger andAspergillus calidoustusmethod (1) is method A or method B;
the method A comprises the following steps: performing loop-mediated isothermal amplification by using the genomic DNA of aspergillus to be detected as a template and respectively using the primer group I to the primer group VI in the primer combination of claim 1, wherein if the primer group I is used, the specific amplification by using the genomic DNA as the template can be realized, and the aspergillus to be detected is or is selected as aspergillus fumigatus; if the primer group II is adopted, the specific amplification with the genome DNA as a template can be realized, and the aspergillus to be detected is or is selected as aspergillus terreus; if the primer group III is adopted, the specific amplification with the genome DNA as a template can be realized, and the aspergillus to be detected is or is selected as aspergillus nidulans; if the primer group IV is adopted, the specific amplification with the genome DNA as a template can be realized, and the aspergillus to be detected is or is selected as aspergillus flavus; if the primer group V is adopted, the specific amplification with the genome DNA as a template can be realized, and the aspergillus to be detected is the aspergillus niger or the candidate aspergillus niger; if the primer group VI is adopted, the specific amplification with the genome DNA as a template can be realized, and the aspergillus to be detected is or is selected as a candidateAspergillus calidoustus；
The method B comprises the following steps: detecting whether the target of the primer group I to the primer group VI in the primer combination of claim 1 is contained in the genomic DNA of Aspergillus to be testedA sequence, if the genome DNA contains the target sequence of the primer group I, the aspergillus to be detected is or is selected as aspergillus fumigatus; if the genome DNA contains the target sequence of the primer group II, the aspergillus to be detected is or is selected as aspergillus terreus; if the genome DNA contains the target sequence of the primer group III, the aspergillus to be detected is or is selected as aspergillus nidulans; if the genome DNA contains the target sequence of the primer group IV, the aspergillus to be detected is or is selected as aspergillus flavus; if the genome DNA contains the target sequence of the primer group V, the aspergillus to be detected is the aspergillus niger or the candidate aspergillus niger; if the genome DNA contains the target sequence of the primer group VI, the aspergillus to be detected is or is selected as a candidateAspergillus calidoustus；
The methods are methods for non-disease diagnostic and therapeutic purposes.
5. Identifying whether the microorganism to be detected is aspergillus fumigatus or aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger orAspergillus calidoustusMethod (1) is method C or method D;
the method C comprises the following steps: performing loop-mediated isothermal amplification by using genome DNA of a microorganism to be detected as a template and respectively using the primer group I to the primer group VI in the primer combination of claim 1, wherein if the primer group I is adopted, the specific amplification by using the genome DNA as the template can be realized, and the microorganism to be detected is or is selected as aspergillus fumigatus; if the primer group II is adopted, the specific amplification with the genome DNA as a template can be realized, and the microorganism to be detected is aspergillus terreus or is a candidate of aspergillus terreus; if the primer group III is adopted, the specific amplification with the genome DNA as a template can be realized, and the microorganism to be detected is or is selected as aspergillus nidulans; if the primer group IV is adopted, the specific amplification with the genome DNA as a template can be realized, and the microorganism to be detected is or is selected as aspergillus flavus; if the primer group V is adopted, the specific amplification with the genome DNA as a template can be realized, and the microorganism to be detected is Aspergillus niger or is candidate; if the primer group VI is adopted, the specific amplification with the genome DNA as a template can be realized, and the microorganism to be detected is or is selected as a candidateAspergillus calidoustusIf the specific amplification using the genomic DNA as a template cannot be realized by using the primer pair I to the primer group VI, the microorganism to be detected is Aspergillus fumigatus, Aspergillus terreus, Aspergillus nidulans, Aspergillus flavus, Aspergillus niger or Aspergillus nigerAspergillus calidoustus；
The method D comprises the following steps: detecting whether the genome DNA of a microorganism to be detected contains the target sequences of the primer group I to the primer group VI in the primer combination of claim 1, wherein if the genome DNA contains the target sequence of the primer group I, the microorganism to be detected is or is selected as aspergillus fumigatus; if the genome DNA contains the target sequence of the primer group II, the microorganism to be detected is aspergillus terreus or is a candidate for aspergillus terreus; if the genome DNA contains the target sequence of the primer group III, the microorganism to be detected is or is selected as aspergillus nidulans; if the genome DNA contains the target sequence of the primer group IV, the microorganism to be detected is or is selected as aspergillus flavus; if the genome DNA contains the target sequence of the primer group V, the microorganism to be detected is Aspergillus niger or is selected as Aspergillus niger candidate; if the genome DNA contains the target sequence of the primer group VI, the microorganism to be detected is or is selected asAspergillus calidoustus(ii) a If the genome DNA does not contain the target sequence of any one of the primer group I to the primer group VI, the microorganism to be detected is aspergillus fumigatus and aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and non-aspergillus nigerAspergillus calidoustus；
The methods are methods for non-disease diagnostic and therapeutic purposes.
6. Detecting whether the sample to be detected contains aspergillus fumigatus and/or aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus and/or aspergillus niger and/orAspergillus calidoustusMethod (4) is method E or method F;
the method E comprises the following steps: performing loop-mediated isothermal amplification by using total DNA of a sample to be detected as a template and respectively using the primer group I to the primer group VI in the primer combination of claim 1, wherein if the primer group I is used, the specific amplification by using the total DNA as the template can be realized, and the sample to be detected contains aspergillus fumigatus; if it is adoptedThe primer group II can realize specific amplification by taking the total DNA as a template, and a sample to be detected contains aspergillus terreus; if the primer group III is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains aspergillus nidulans; if the primer group IV is adopted, the specific amplification with the total DNA as a template can be realized, and the sample to be detected contains aspergillus flavus; if the primer group V is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains Aspergillus niger; if the primer group VI is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected containsAspergillus calidoustus(ii) a If the specific amplification by taking the total DNA as the template can not be realized by adopting the primer pair I to the primer group VI, the sample to be detected does not contain aspergillus fumigatus, aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and aspergillus nigerAspergillus calidoustus；
The method F comprises the following steps: detecting whether the total DNA of a sample to be detected contains target sequences of the primer group I to the primer group VI in the primer combination of claim 1, if the total DNA contains the target sequence of the primer group I, the sample to be detected contains aspergillus fumigatus; if the total DNA contains the target sequence of the primer group II, the sample to be detected contains aspergillus terreus; if the total DNA contains the target sequence of the primer group III, the sample to be detected contains aspergillus nidulans; if the total DNA contains the target sequence of the primer group IV, the sample to be detected contains aspergillus flavus; if the total DNA contains the target sequence of the primer group V, the sample to be detected contains Aspergillus niger; if the total DNA contains the target sequence of the primer group VI, the sample to be detected containsAspergillus calidoustus(ii) a If the total DNA does not contain the target sequence of any one of the primer group I to the primer group VI, the sample to be detected does not contain aspergillus fumigatus, aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and aspergillus nigerAspergillus calidoustus；
The methods are for non-disease diagnostic and therapeutic purposes.
CN201711471982.2A 2017-12-29 2017-12-29 LAMP primer combination for detecting six kinds of aspergillus and application thereof Active CN109988855B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711471982.2A CN109988855B (en) 2017-12-29 2017-12-29 LAMP primer combination for detecting six kinds of aspergillus and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711471982.2A CN109988855B (en) 2017-12-29 2017-12-29 LAMP primer combination for detecting six kinds of aspergillus and application thereof

Publications (2)

Publication Number Publication Date
CN109988855A CN109988855A (en) 2019-07-09
CN109988855B true CN109988855B (en) 2022-07-12

Family

ID=67109504

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711471982.2A Active CN109988855B (en) 2017-12-29 2017-12-29 LAMP primer combination for detecting six kinds of aspergillus and application thereof

Country Status (1)

Country Link
CN (1) CN109988855B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111304349A (en) * 2019-12-17 2020-06-19 北京百康芯生物科技有限公司 Method for combined detection of multiple pathogen nucleic acids difficult to culture and identify
CN117144053B (en) * 2023-10-27 2024-01-19 江苏美克医学技术有限公司 Aspergillus fumigatus detection primer set, kit and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001066790A2 (en) * 2000-03-10 2001-09-13 Universiteit Gent Detection of aspergillus fumigatus
CN102586455A (en) * 2012-03-14 2012-07-18 万俊松 Aflatoxin detection reagent kit based on loop-mediated isothermal gene amplification method
CN103451294A (en) * 2013-09-04 2013-12-18 福建省农业科学院植物保护研究所 Aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and visualized detection method thereof
CN105624290A (en) * 2016-01-12 2016-06-01 中国人民解放军疾病预防控制所 Application of Aspergillus fumigatus annexin anxC4 gene (anxC4 gene)

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001066790A2 (en) * 2000-03-10 2001-09-13 Universiteit Gent Detection of aspergillus fumigatus
CN102586455A (en) * 2012-03-14 2012-07-18 万俊松 Aflatoxin detection reagent kit based on loop-mediated isothermal gene amplification method
CN103451294A (en) * 2013-09-04 2013-12-18 福建省农业科学院植物保护研究所 Aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and visualized detection method thereof
CN105624290A (en) * 2016-01-12 2016-06-01 中国人民解放军疾病预防控制所 Application of Aspergillus fumigatus annexin anxC4 gene (anxC4 gene)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Development of rapid and specific molecular discrimination methods for pathogenic emericella species;Tetsuhiro Matsuzawa等;《Nihon Ishinkin Gakkai Zasshi》;20101231;第51卷(第2期);摘要，表2 *
环介导等温扩增快速检测临床常见曲霉菌方法的建立和应用;鲁勇等;《中华检验医学杂志》;20140228;第37卷(第2期);摘要、第140页正文第1段 *
评价ITS、BenA和CaM序列分析在曲霉菌种鉴定方面的应用;李颖等;《中国真菌学杂志》;20170430;第12卷(第2期);摘要 *

Also Published As

Publication number Publication date
CN109988855A (en) 2019-07-09

Similar Documents

Publication Publication Date Title
DK2430188T3 (en) METHOD AND KIT FOR DETECTING ANTIBIOTIC RESISTANT BACTERIA
CN109055502B (en) Detection method, detection kit and application of invasive fungal infection
CN112501268A (en) Nanopore sequencing-based primer group and kit for rapidly identifying respiratory microorganisms and application of primer group and kit
JP2015536676A (en) Method for detecting Helicobacter pylori DNA in stool samples
Mandviwala et al. High-throughput identification and quantification of Candida species using high resolution derivative melt analysis of panfungal amplicons
CN107365843B (en) LAMP primer combination for detecting two main parasites causing calf diarrhea and application thereof
CN109706145B (en) Primer set and application thereof
CN109487000B (en) Primer combination and application thereof
CN113481311A (en) SNP molecular marker for identifying Brucella vaccine strain M5 and application thereof
CN109988855B (en) LAMP primer combination for detecting six kinds of aspergillus and application thereof
CN110093432B (en) sRNA marker for distinguishing mycobacterium tuberculosis from BCG vaccine and application thereof
CN111793704A (en) SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof
US20110287965A1 (en) Methods and compositions to detect clostridium difficile
CN109988857B (en) LAMP primer combination for detecting two cryptococcus and application thereof
CN112522434A (en) Primer group and kit for simultaneously detecting multiple pathogenic fungi
CN109735645B (en) Real-time fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting Sporothrix globosum
CN111607658A (en) Primer probe system, kit and detection method for human fungal infection detection
RU2550257C2 (en) METHOD OF DIFFERENTIATING TYPICAL AND ATYPICAL STRAINS Yersinia pestis OF MEDIEVAL BIOVAR BY PCR METHOD WITH HYBRIDISATION-FLUORESCENT RECORDING RESULTS
CN109988856B (en) LAMP primer combination for detecting yersinia pneumocystis and application thereof
CN110055345A (en) Primer sets and its application
McILHATTON et al. Identification of medically important pathogenic fungi by reference strand-mediated conformational analysis (RSCA)
KR101955072B1 (en) Snp markers for discrimination of raphanus sativus
CN111690736A (en) Warfarin medication gene detection kit and use method thereof
CN109706259A (en) Primer sets and its application
CN109182599A (en) For detect the specific primer of grass carp hemorrhage virus to, probe, detection kit

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant