CN109182599A - For detect the specific primer of grass carp hemorrhage virus to, probe, detection kit - Google Patents
For detect the specific primer of grass carp hemorrhage virus to, probe, detection kit Download PDFInfo
- Publication number
- CN109182599A CN109182599A CN201811067067.1A CN201811067067A CN109182599A CN 109182599 A CN109182599 A CN 109182599A CN 201811067067 A CN201811067067 A CN 201811067067A CN 109182599 A CN109182599 A CN 109182599A
- Authority
- CN
- China
- Prior art keywords
- grass carp
- probe
- detection
- seq
- carp hemorrhage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The probe that the specific primer pair and the primer pair that the invention discloses a kind of for detecting grass carp hemorrhage virus are used cooperatively.The invention also discloses a kind of detection kits.The present invention is detection target spot with conservative gene VP7 gene in grass carp hemorrhage virus, by isothermal amplification technology, is combined using the primer and probe of specificity, improves the detection convenience and specificity of grass carp hemorrhage virus I type, while detection time also greatly shortens.Compared with PCR detection method, method of the invention eliminates product electrophoresis verification process, avoids false positive results appearance, improves the accuracy of detection.Compared with qPCR, of the invention method is simple, does not also need instrument and equipment complicated for operation, has saved cost, improves detection efficiency, while convenient in a wide range of interior popularization and use.Compared with other constant-temperature amplification methods, shorter the time required to detection method of the invention, the accuracy rate of detection is higher.
Description
Technical field
The invention belongs to field of biotechnology, be related to specific primer for detecting grass carp hemorrhage virus to, probe, inspection
Test agent box.
Background technique
Grass carp (Grass Carp) big face can all occur as one of big cultured freshwater fish in China most important four every year
Long-pending haemorrhage, the death rate are up to 80%, and research data shows that grass carp arc reovirus virus is the main of grass carp viral hemorrhagic disease
Pathogen.Up to now, still highly difficult for the prevention and treatment of such infectious disease.Nineteen eighty-three separates for the first time out of grass carp body
Virus out, in the research to the virus Jing Guo a series of form, physio-biochemical characteristics, the international virus taxis committee in 1991
The viral nomenclature is formally grass carp arc reovirus virus (Grass carp reovirus, GCRV) by the 5th meeting of member's meeting, and will
It is included in the aquatic arc reovirus virus category (Aquareovirus) of arc reovirus virus section (Reoviridae).Up to the present, have
More than 30 plants of GCRV are identified by separation, and their biological characteristics are not quite similar.And presently found grass carp arc reovirus virus master
There are 3 genotype: grass carp arc reovirus virus I type, representative strains 873；Grass carp arc reovirus virus II type, representative strains are 08 He of HZ
GD 108；Grass carp arc reovirus virus type III, representative strains 104.This research detection is grass carp arc reovirus virus I type.
The method of grass carp arc reovirus virus detection at present and identification has very much, is most commonly used to detection grass carp in the past and exhales intestines arc sick
(SPACOA) is tested in the method staphylococcal protein A coagglutination of poison, and this method is quickly, characteristic is strong, it is complicated and expensive to be not necessarily to
Equipment, but sensitivity is not too high.Hereafter, there is enzyme linked immunosorbent assay (ELISA) (ELISA) to detect grass carp and exhale intestines arc sick
The technology of poison, ELISA testing result can quantify, and easily determine and time-consuming short, Shao Jianzhong et al. establishes Dot-ELISA detection
The technology of GCRV, the sensitivity of the technology are higher than staphylococcal protein A coagglutination experiment[2]But this method pair (SPACOA),
Enzymatic activity requirement is also high, relies on the performance of enzymatic activity, and the performance of any influence enzymatic activity is likely to influence the accuracy of result,
And there is a problem of for subtype virus strain indistinguishable.In addition, kit price needed for such method costly, is unfavorable for
It is widely applied；With the development of molecular biotechnology, there is sensitivity, accuracy and the higher PCR of stability
(Polymerase Chain Reaction) technology.
PCR is using 4 kinds of dNTP as substrate, in the presence of primer, carries out prolonging for complementary strand in 3 ' ends of DNA profiling
It stretches, repetitious circulation can make micro template nucleic acid obtain exponential amplification.Since grass carp arc reovirus virus is a kind of
RNA virus, therefore the Testing and appraisal of the especially suitable grass carp arc reovirus virus of RT-PCR detection method.RT-PCR method detection grass carp exhales
The basic step of intestines arc virus includes the pre-treatment of sample, and buffer, magnesium chloride, Taq are added in RT-PCR overall reaction system
Amplification condition amplified reaction is arranged in enzyme, reverse transcriptase, dNTP, template and primer.Micro amplified production is taken to carry out Ago-Gel
Electrophoresis is observed with Ultraviolet Detector and is taken a picture with gel imaging system, has seen whether that purpose segment occurs.Point of PCR product
Analysis is generally analyzed using agarose gel electrophoresis, tentatively judge the size of PCR product segment with it is expected that whether unanimously.Wang Xiaofeng,
Hao Guijie, Zhang establish the RT-PCR technology of detection grass carp arc reovirus virus, and troubling problem is regular-PCR amplification
Detection is easy to appear Aerosol Pollution, and testing result is made false positive occur.With the development of molecular biology, gradually developed glimmering
Light quantitative RT-PCR technology carries out GCRV detection means, as Zhou Yong, Yin Liang establish the fluorescence RT-PCR inspection of quickly detection GCRV
Survey technology.
Quantitative fluorescent PCR (real-time fluorescence quantitative PCR) is 1996 by the U.S.
The new quantitative test technology of a kind of nucleic acid that Applied Biosystems company releases, quantitative fluorescent PCR are on Standard PCR basis
Upper addition fluorescence probe or corresponding fluorescent dye realize real-time quantitative.With the progress that PCR reacts, PCR reaction product
Constantly accumulative, also equal proportion increases fluorescence signal intensity.Every to collect first order fluorescence signal by a circulation, we are just in this way
The variation that product amount can be monitored by fluorescence intensity change, to obtain a fluorescent amplification curve.In real time fluorescent quantitative
Ct value refers to recurring number experienced when the fluorescence signal in each reaction tube reaches given threshold in round pcr.Each template
Ct value and the logarithm of starting copy number of the template there are linear relationships, starting copy number is more, and Ct value is smaller.Using known
The standard items of starting copy number can make standard curve, and wherein abscissa represents the logarithm of starting copy number, and ordinate represents Ct
Value.Therefore, as long as obtaining the Ct value of unknown sample, the starting copy number of the sample can be calculated from standard curve.Although
Real-time fluorescence quantitative PCR simplifies operating procedure, and going out for aerosol false positive caused by can avoid PCR race glue is detected using stopped pipe
Existing, sensibility is high, may be implemented to monitor in real time, can also realize rational judgment.Real-time fluorescence quantitative PCR needs matched price height
High quantitative fluorescent PCR instrument, and equipment maintenance cost is high, machine setting is complicated for operation, professional is needed, therefore, it is difficult to
To all-round popularization.
Loop-mediated isothermal amplification technique (Loop-mediated isothermal amplification method,
It LAMP is) a kind of emerging gene amplification technology, by Japanese scholars Notomi2000 on Nucleic Acids Res magazine
It publishes, as a kind of molecular Biological Detection technology, is now first widely used to Molecular Detection field, Zhang Jinfeng,
Zhang, Zeng establish the RT-LAMP technology that grass carp arc reovirus virus quickly detects using the different gene of GCRV.Hao Gui
It is outstanding[12]Establish the technology that reverse transcription loop-mediated isothermal amplification joint lateral flow test strips quickly detect GCRV.LAMP principle
It is 6 regions design, 4 species-specific primers for target gene, under the action of strand displacement archaeal dna polymerase (such as Bst enzyme), water-bath
63 DEG C or so in pot, it can be realized 10 within 60 minutes9~1010Nucleic acid amplification again has very high amplification efficiency, easy to operate,
Detection is not needed using special instrument.Although LAMP increases amplification efficiency, but the non-specific pairing between primer is easy to lead
False positive results are caused, the use of LAMP method is limited.
Summary of the invention
Goal of the invention: there is provided a kind of for detecting the special of grass carp hemorrhage virus for the technical problem of being solved of the invention
Property primer pair.The present invention, which passes through, lists the common conservative gene of hemorrhagic disease of grass carp poison in Vector NTI software documents, and
The strong VP7 gene of selected conservative has separately designed 4 pairs in conserved region using 6 software of Oligo and has drawn as target amplification section
Designed sequence is carried out BLAST comparison by object and 3 probes on NCBI, it is ensured that the conservative of type and inter-species it is special
Property.
Also there is provided the probes being used cooperatively with the primer pair for technical problems to be solved by the present invention.
There is provided be used cooperatively comprising above-mentioned primer pair and/or with primer pair the present invention also technical problems to be solved
The kit of probe.
Technical solution: it is of the existing technology in order to solve the problems, such as, the invention adopts the following technical scheme: a kind of for examining
The specific primer pair of grass carp hemorrhage virus is surveyed, the primer pair includes upstream primer and downstream primer, the upstream primer
Nucleotide sequence as shown in SEQ ID NO:1 or SEQ ID NO:3 or SEQ ID NO:5 or SEQ ID NO:7, draw by the downstream
Nucleotide sequence as shown in SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8.
The content of present invention further includes the probe being used cooperatively with the primer pair, and the nucleotide sequence of the probe is such as
Shown in SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11.
Wherein, the probe be fluorochrome label probe, the fluorescent dye be SYTO-13, SYTO-82, FAM,
FITC, SYBR Green I, SYTO-13, SYTO-82, VIC, HEX, JOE, TAMRA, TET, Cy3, ROX, TEXAS-Red or
One of Cy5.
Wherein, the length of the probe is 35-55 nucleotide base, and a base positioned at 28-35 is replaced
For nucleic acid analog, the nucleic acid analog is THF, is respectively two T bases and mark fluorescent group in the two sides of THF and quenches
Go out group, and probe is closed in 3 '-ends by blocking groups.
The content of present invention further include the specific primer to, the probe in the detection of preparation grass carp hemorrhage virus or
Application in diagnostic kit.
The content of present invention further includes a kind of detection kit of grass carp hemorrhage virus, the detection examination of the grass carp hemorrhage virus
Agent box includes the primer pair and/or the probe.
Wherein, the detection kit reaction system includes: recombinase, polymerase, single-stranded DNA binding protein, nucleic acid
Enzyme, at least pair of primers, a probe, dNTP, crowding agent, recombination load albumen, energy system and salt ion.
Wherein, the recombinase be selected from bacteriophage UvsX albumen, Escherichia coli recA albumen it is any one or more
Combination.
Wherein, the polymerase is selected from the prominent of klenow polymerase, bsu polymerase or phi29 polymerase and its these enzymes
Any one or more combinations of variant or large fragment.
Wherein, the single-stranded DNA binding protein is selected from Escherichia coli SSB albumen, GP32 albumen it is any or combinations thereof.
Wherein, the nuclease is selected from any one or more groups of exonuclease III or endonuclease IV
It closes.
Wherein, recombination load albumen is selected from bacteriophage UvsY albumen, Escherichia coli RecO or Escherichia coli RecR's
Any one or more combinations.
Wherein, the crowding agent is selected from polyethylene glycol, polyvinyl alcohol, one kind of dextran or ficoll or it is a kind of with
On combination.
Wherein, the polyethylene glycol is selected from PEG1450, PEG3000, PEG8000, PEG10000, PEG14000,
One or more of PEG20000, PEG25000, PEG30000, PEG35000 or PEG40000.
Wherein, the energy system is selected from one or more kinds of combinations of ATP, phosphocreatine, creatine kinase.
Wherein, the salt ion is selected from Tris, any one or more combinations of magnesium ion or potassium ion.
Specifically, the combination of primer and probe of the invention has following four combination:
Group unification:
Upstream primer: 5 '-ACCATTCAAGACTCCCACGCTTGTTCACGTCA-3 '
Downstream primer: 5 '-GGCCTGGCAGTGATTTCGGACGCAAGCGGTAG-3 '
Probe: 5 '-TCGGTAGCCGCACTGTGGACTATCACGAAT (FAM-dT) G (THF) A (BHQ1-dT)
GTGAAAGCTGGATTC(C3-SPACER)-3’
Combination two:
Upstream primer: 5 '-CGCCAACGTCAAGACCATTCAAGACTCCCAC-3 '
Downstream primer: 5 '-GAATCGTCCAAGTCACAGGTGCGAAACGGAAG-3 '
Probe: 5 '-TCGGTAGCCGCACTGTGGACTATCACGAAT (FAM-dT) G (THF) A (BHQ1-dT)
GTGAAAGCTGGATTC(C3-SPACER)-3’
Combination three:
Upstream primer: 5 '-TACACCATCTGCGCCTTCTGCCTTACGACTCT-3 '
Downstream primer: 5 '-TGATAGTCTACAGTACGGCTACCGACGAGGG-3 '
Probe: 5 '-TCATTTGGTTGACGGGAACAAGCGTGGGAG (FAM-dT) (THF) T (BHQ1-dT)
GGATGGTCTTGACG(C3-SPACER)-3’
Or combination four:
Upstream primer: 5 '-CCCACGCCAACGTCAAGACCATTCAAGACTCC-3 '
Downstream primer: 5 '-TCCAATTCGTGATAGTCTACAGTACGGCTACC-3 '
Probe: 5 '-CAAATGAAGCCATTCGCTCATTAGTCGAAG (FAM-dT) G (THF) G (BHQ1-dT)
GACAAAGCGCAGACC(C3-SPACER)-3’
Recombinase polymeric enzymatic amplification technology has in terms of required for proliferation time, specific amplification, amplification
There is apparent advantage.Principle is by being usually two specific primers and recombinase shape of 28-35 base in reaction system
At compound, homologous sequence is found on template DNA, chain exchange occurs, and extended under archaeal dna polymerase effect.By upper
At the specific section both ends of template respectively in connection with extension, the occurrence index grade that moves in circles expands downstream primer.Though amplified production
The increase of fluorescence signal can be so realized by addition SYBR Green dyestuff, but because non-specificity cannot be distinguished in fluorescent dye, and
By way of increasing in reaction system and can carry out base analogue excision by exonuclease III or endonuclease IV
Specificity fluorescent probe technique detected, to substantially increase the specificity of detection.
The present invention is searched on document by NCBI lists the viral sugar VP7 gene of common grass carp hemorrhage, utilizes Vector
NTI software, which is compared, finds out its conservative region, choose VP7 Gene Partial region as target amplification section, constructed to
In carrier puc57, it is prepared into the positive plasmid of grass carp hemorrhage virus, plasmid is by Sangon Biotech (Shanghai) Co., Ltd.
Synthesis, the glycoprotein VP7 Gene Partial sequence of selection are as follows:
CGTCACCTGCGGGCGGTACACCATCTGCGCCTTCTGCCTTACGACTCTGGCTCCCCACGCCAACGTCA
AGACCATTCAAGACTCCCACGCTTGTTCACGTCAACCAAATGAAGCCATTCGCTCATTAGTCGAAGTGAGTGACAA
AGCGCAGACCGCCCTCGTCGGTAGCCGTACTGTAGACTATCACGAATTGGATGTGAAAGCTGGGTTCGTCGCCCCA
ACTGCCGATGAAACAATAGCCCCCTCTAAGGATATCGTCGAACTTCCGTTTCGCACCTGTGACTTGGACGATTCCT
CTGCTACCGCTTGCGTCCGAAATCACTGCCAGGCCGGTCACGACGGCGTTATCCACCTCCCGATCCTTTCTGGAGA
TTTCAAATTGCCTAACGAGCATCCCACCA (SEQ ID NO:12)
The present invention has separately designed 4 pairs of primers and 3 probes in conserved region using 6 software of Oligo, by designed sequence
It is listed in progress BLAST comparison on NCBI, it is ensured that the conservative of type and the specificity of inter-species.
The invention also includes the method for detection grass carp hemorrhage virus, the amplification system that this method uses detects as described above
The system of kit, this method include at least two primers and a probe, and primer is respectively in connection in the upstream in region to be amplified
And downstream, the length of primer are 15-45 nucleotide base, preferably 28-35 nucleotide base；The probe length is 35-55
A nucleotide base, preferably 46-52 base, it is similar that a base in probe positioned at 28-35 is replaced by nucleic acid
Object, the nucleic acid analog are preferably THF, are respectively two T bases and mark fluorescent group in the two sides of THF and base is quenched
Group, probe are closed in 3 '-ends by blocking groups.The four kinds of combinations of the combination of primer and probe as described above.
In the amplification system, the trishydroxymethylaminomethane-final concentration of 20-60mM of acetate buffer solution pH8.0, more preferably
For 30mM；Potassium acetate final concentration of 60-120mM, more preferably 120mM；The final concentration of 0.1-0.5nM of primer, more preferably
0.42nM；Polyethylene glycol is selected from final concentration 5%PEG8000 or PEG20000, more preferably 5%PEG20000, dithiothreitol (DTT)
Final concentration of 1-10mM, more preferably 3mM；ATP final concentration of 1-10mM, more preferably 2mM；The final concentration of 10- of phosphocreatine
50mM, more preferably 20mM；Creatine kinase final concentration of 50-250ng/ μ l, more preferably 100ng/ul；Bacteriophage gp32 albumen
Final concentration of 100-1000ng/ μ l, more preferably 600ng/ μ l；Bacteriophage uvsX final concentration of protein is 50-500ng/ μ l, more excellent
It is selected as 150ng/ μ l；Bacteriophage uvsY final concentration of protein is 10-100ng/ μ l, more preferably 25ng/ μ l；Klenow polymerase is whole
Concentration is 5-100ng/ μ l, more preferably 80ng/ μ l；Reverse transcriptase final concentration of 0.1-50U/ μ l, more preferably 4U/ μ l；Core
The sour final concentration of 10-200ng/ μ l of exonucleaseⅢ, more preferably 50ng/ μ l.
In the amplified reaction, reaction temperature is 25-45 DEG C, preferably 37-42 DEG C, more preferably 37 DEG C；Reaction time is
15-60 minutes, preferably 15-20 minutes.
The utility model has the advantages that compared with prior art, the invention has the advantages that
(1) present invention is that detection target spot is used by isothermal amplification technology with Glycoprotein G Gene in grass carp hemorrhage virus
The primer and probe combination of specificity, improves the detection convenience and specificity of grass carp hemorrhage virus, while detection time
It greatly shortens.
(2) compared with PCR detection method, detection method of the invention eliminates product electrophoresis verification process, avoids vacation
Positive findings occur, and improve the accuracy of detection.Compared with qPCR, of the invention method is simple, and it is multiple not need operation yet
Miscellaneous instrument and equipment, has saved cost, improves detection efficiency, while convenient in a wide range of interior popularization and use.With other constant temperature
Amplification method is compared, and shorter the time required to detection method of the invention, the accuracy rate of detection is higher.
(3) detection method of the invention is reacted dependent on enzymatic amplification, can continuously be expanded at a constant temperature
Increase reaction, rate of amplification is significantly larger than conventional PCR alternating temperature reaction.At 20 minutes, i.e. detection was completed for entire amplification；And
It in operation, does not need to be configured many kinds of parameters, detection operation can also be carried out by not needing to have very professional technical ability.
(4) reaction condition of the invention is 37~42 DEG C, does not need to temperature control particularly severe, and is used special
The fluorescence probe of property, can preferably distinguish non-specific amplification.Therefore, more convenient for base's test use, and consume energy
It is lower, it is particularly suitable for execute-in-place.
Detailed description of the invention
Fig. 1 is GCRV-I recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method sensitivity test result；1. matter
Grain 7 (10-5Ng/ μ l) 2. plasmids 8 (10-6Ng/ μ l) 3. plasmids 9 (10-7Ng/ μ l) 4. plasmids 10 (10-8ng/μl)5.ddH2O；
Fig. 2 is GCRV-I recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method specific test result；
1.GCRV-I 2.GCRV-II 3.GCRV-III 4.SVCV 5.ISKNV 6.KHV 7.IHNV 8.GIV 9.Cyhv-II
10.NTC:DEPC handles water；
Fig. 3 is GCRV-I recombinase polymeric enzymatic amplification (in conjunction with endonuclease IV) method sensitivity test result.1. matter
Grain 7 (10-5Ng/ μ l) 2. plasmids 8 (10-6Ng/ μ l) 3. plasmids 9 (10-7Ng/ μ l) 4. plasmids 10 (10-8ng/μl)5.ddH2O。
Specific embodiment
The present invention is described in further details combined with specific embodiments below.
According to following embodiments, the present invention may be better understood.However, as it will be easily appreciated by one skilled in the art that real
It applies content described in example and is merely to illustrate the present invention, without sheet described in detail in claims should will not be limited
Invention.Following embodiment is in order to which invention is further described in detail, not to the limitation of invention.
The sick fish tissues sample standard deviation of the grass carp hemorrhage virus infection used in the present invention is by the popularization of Jiangsu Province's fishery technology
The heart provides.
Embodiment 1
1, it the acquisition of the positive plasmid of grass carp hemorrhage virus: is searched on document by NCBI and lists common hemorrhagic disease of grass carp
Malicious sugar VP7 gene, is compared using Vector NTI software and finds out its conservative region, constituency Glycoprotein G Gene partial region
It as target amplification section, is constructed into carrier puc57, is prepared into the positive plasmid of grass carp hemorrhage virus, plasmid is by giving birth to
The synthesis of work bioengineering (Shanghai) limited liability company, the glycoprotein VP7 Gene Partial sequence of selection are as follows:
CGTCACCTGCGGGCGGTACACCATCTGCGCCTTCTGCCTTACGACTCTGGCTCCCCACGCCAACGTCA
AGACCATTCAAGACTCCCACGCTTGTTCACGTCAACCAAATGAAGCCATTCGCTCATTAGTCGAAGTGAGTGACAA
AGCGCAGACCGCCCTCGTCGGTAGCCGTACTGTAGACTATCACGAATTGGATGTGAAAGCTGGGTTCGTCGCCCCA
ACTGCCGATGAAACAATAGCCCCCTCTAAGGATATCGTCGAACTTCCGTTTCGCACCTGTGACTTGGACGATTCCT
CTGCTACCGCTTGCGTCCGAAATCACTGCCAGGCCGGTCACGACGGCGTTATCCACCTCCCGATCCTTTCTGGAGA
TTTCAAATTGCCTAACGAGCATCCCACCA (shown in SEQ ID NO:12)
2, select the plasmid containing grass carp hemorrhage virus conserved region gene sequence synthesized by step 1 to detect target,
Upstream primer sequence is: 5 '-ACCATTCAAGACTCCCACGCTTGTTCACGTCA-3 ' (SEQ ID NO:1)；
Downstream primer sequence is: 5 '-GGCCTGGCAGTGATTTCGGACGCAAGCGGTAG-3 ' (SEQ ID NO:2)；
Probe: 5 '-TCGGTAGCCGCACTGTGGACTATCACGAAT (FAM-dT) G (THF) A (BHQ1-dT)
GTGAAAGCTGGATTC (C3-SPACER) -3 ' (SEQ ID NO:9)
It is expanded, is constructed using recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method amplification reaction system
25 μ l amplification reaction systems are as follows:
30mM trishydroxymethylaminomethane-acetate buffer solution pH8.0
100mM potassium acetate
14mM magnesium acetate
3mM dithiothreitol (DTT)
5% polyethylene glycol (molecular weight 20000)
2mM ATP
20mM phosphocreatine
100ng/ μ l creatine kinase
600ng/ μ l Escherichia coli SSB albumen
150ng/ μ l bacteriophage uvsX albumen
25ng/ μ l bacteriophage uvsY albumen
80ng/ μ l klenow polymerase Large fragment (exo-)
4U/ μ l reverse transcriptase
50ng/ μ l exonuclease III
450μM dNTP
Every upstream primer of 420nM
Every downstream primer of 420nM
Every fluorescence probe of 120nM
Template is the positive plasmid of synthesis, 1.5 μ l
Expanding temperature is 37 DEG C, reacts 20min, the changing value of detection fluorescence is carried out with GS8 fluorescence constant-temperature amplification instrument, often
30s reads first order fluorescence.Recombinase polymeric enzymatic amplification does not need complicated sample DNA pretreatment process, does not need the heat of template
Denaturation, reaction are completed under lower isothermal condition, and reaction susceptibility is high, and high specificity, upper machine testing 20min can go out
As a result.Reaction eliminates the process of PCR product electrophoresis verifying, avoids Aerosol Pollution by fluorescence values interpretation.
Template processing: with the concentration of NanoDrop calibration positive plasmid, it is first diluted to 10ng/ μ l with TE and (is named as
Plasmid 1), subsequent 10 times successively dilute, and are diluted to 1ng/ μ l (being named as plasmid 2), are diluted to 10-1Ng/ μ l (is named as plasmid
3) 10, are diluted to-2Ng/ μ l (being named as plasmid 4), 10 are diluted to-3Ng/ μ l (being named as plasmid 5), 10 are diluted to-4Ng/ μ l (life
Entitled plasmid 6), be diluted to 10-5Ng/ μ l (being named as plasmid 7), 10 are diluted to-6Ng/ μ l (being named as plasmid 8), 10 are diluted to- 7Ng/ μ l (being named as plasmid 9), 10 are diluted to-8Ng/ μ l (name plasmid 10)；Finally confirm that its sensitivity can detect after testing
To 10-6Ng/ μ l (being named as plasmid 8), (result is referring to Fig. 1), sensitivity are entirely capable of reaching application demand.
Embodiment 2
Choose following primer and probe sequence:
Upstream primer sequence is: 5 '-CGCCAACGTCAAGACCATTCAAGACTCCCAC-3 ' (SEQ ID NO:3)；
Downstream primer sequence is: 5 '-GAATCGTCCAAGTCACAGGTGCGAAACGGAAG-3 ' (SEQ ID NO:4)；
Probe sequence is: 5 '-TCGGTAGCCGCACTGTGGACTATCACGAAT (FAM-dT) G (THF) A (BHQ1-dT)
GTGAAAGCTGGATTC(C3-SPACER)-3'.(SEQ ID NO:9)
It is detection target by plasmid of the synthesis containing grass carp hemorrhage virus conserved region gene sequence, carries out recombination enzymatic polymerization
Enzymatic amplification (in conjunction with endonuclease IV) method version amplification assay, 25 μ l amplification reaction systems of building are as follows:
60mM trishydroxymethylaminomethane-acetate buffer solution pH8.0
100mM potassium acetate
14mM magnesium acetate
3mM dithiothreitol (DTT)
5% polyethylene glycol (20000)
2mM ATP
20mM phosphocreatine
100ng/ μ l creatine kinase
600ng/ μ l Escherichia coli SSB albumen
150ng/ μ l bacteriophage uvsX albumen
25ng/ μ l bacteriophage uvsY albumen
80ng/ μ l klenow polymerase Large fragment (exo-)
4U/ μ l reverse transcriptase
50ng/ μ l exonuclease III
450μM dNTP
Every upstream primer of 420nM
Every downstream primer of 420nM
Every fluorescence probe of 120nM
Template is the 1.5 μ l of positive plasmid of synthesis
Expanding temperature is 37 DEG C, reacts 20min, the changing value of detection fluorescence is carried out with GS8 fluorescence constant-temperature amplification instrument, often
30s reads first order fluorescence.It is detected using the positive plasmid of above-mentioned synthesis as template.
Template processing: with embodiment 1, finally confirm that its sensitivity can detect 10 after testing-7Ng/ μ l plasmid 9 is sensitive
Degree is shown in Fig. 1.
Nucleic acid extraction: pillar total RNA from animal tissues extracting and purifying kit (B518651) be purchased from raw work bioengineering (on
Sea) limited liability company, take sample to be examined incidence tissue about 25mg, RNA extraction process according to kit internal standard extraction steps,
The nucleic acid extracted is dispensed, is frozen spare in -80 DEG C.
Specific detection: the specificity in order to verify primer and probe, respectively with fish common virus GCRVII,
The positive sample of GCRVIII, SVCV, ISKNV, KHV, IHNV, GIV, CyHV-2 are that template is detected；After testing only
The normal amplification of GCRV-I positive sample appearance, negative control (DEPC handles water, purchased from life work) and GCRV-II/III, SVCV,
ISKNV, KHV, IHNV, GIV, CyHV-2 positive sample do not occur expanding (see Fig. 2).
Embodiment 3
The primer pair and probe sequence designed in selection example 2, using recombinase polymeric enzymatic amplification (in conjunction with endonuclease
Enzyme IV) method amplification reaction system expanded, and 25 μ l amplification reaction systems of building are as follows:
60mM trishydroxymethylaminomethane-acetate buffer solution pH8.0
100mM potassium acetate
14mM magnesium acetate
3mM dithiothreitol (DTT)
5% polyethylene glycol (molecular weight 20000)
2mM ATP
20mM phosphocreatine
100ng/ μ l creatine kinase
400ng/ μ l Escherichia coli recA albumen
200ng/ μ l Escherichia coli SSB albumen
60ng/ μ l Escherichia coli recO albumen
40ng/ μ l Escherichia coli recR albumen
60ng/ μ l Escherichia coli recF albumen
8Units bacillus subtilis DNA polymerase i
4U/ μ l reverse transcriptase
50ng/ μ l endonuclease IV
450μM dNTP
Every upstream primer of 420nM
Every downstream primer of 420nM
120nM fluorescence probe
Template is the 1.5 μ l of positive plasmid of synthesis
Expanding temperature is 42 DEG C, reacts 20min, the changing value of detection fluorescence is carried out with GS8 fluorescence constant-temperature amplification instrument, often
30s reads first order fluorescence.It is detected using the positive plasmid that embodiment 1 synthesizes as template.
Template processing: with embodiment 2, finally confirm that its sensitivity can detect 10 after testing-7Ng/ μ l plasmid 9 is sensitive
Degree and recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method are essentially identical (see Fig. 3).
Embodiment 4
It selects through plasmid of the synthesis containing grass carp hemorrhage virus conserved region gene sequence to detect target,
Upstream primer sequence is: 5 '-TACACCATCTGCGCCTTCTGCCTTACGACTCT-3 ' (SEQ ID NO:5)；
Downstream primer sequence is: 5 '-TGATAGTCTACAGTACGGCTACCGACGAGGG-3 ' (SEQ ID NO:6)；
Probe sequence is: 5 '-TCATTTGGTTGACGGGAACAAGCGTGGGAG (FAM-dT) (THF) T (BHQ1-dT)
GGATGGTCTTGACG(C3-SPACER)-3'.(SEQ ID NO:10)
It is expanded, is constructed using recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method amplification reaction system
25 μ l amplification reaction systems are as follows:
30mM trishydroxymethylaminomethane-acetate buffer solution pH8.0
50mM potassium acetate
14mM magnesium acetate
3mM dithiothreitol (DTT)
5% polyethylene glycol (molecular weight 20000)
2mM ATP
20mM phosphocreatine
100ng/ μ l creatine kinase
600ng/ μ l Escherichia coli SSB albumen
150ng/ μ l bacteriophage uvsX albumen
25ng/ μ l bacteriophage uvsY albumen
80ng/ μ l klenow polymerase Large fragment (exo-)
4U/ μ l reverse transcriptase
50ng/ μ l exonuclease III
450μM dNTP
Every upstream primer of 420nM
Every downstream primer of 420nM
Every fluorescence probe of 120nM
Template is the 1.5 μ l of positive plasmid of synthesis
Expanding temperature is 37 DEG C, reacts 20min, the changing value of detection fluorescence is carried out with GS8 fluorescence constant-temperature amplification instrument, often
30s reads first order fluorescence.It is detected using the positive plasmid that embodiment 1 synthesizes as template.
Template processing: with embodiment 1, finally confirm that its sensitivity can detect 10 after testing-5Ng/ μ l plasmid 7.
Embodiment 5
It selects through plasmid of the synthesis containing grass carp hemorrhage virus conserved region gene sequence to detect target,
Upstream primer sequence is: 5 '-CCCACGCCAACGTCAAGACCATTCAAGACTCC-3 ' (SEQ ID NO:7)；
Downstream primer sequence is: 5 '-TCCAATTCGTGATAGTCTACAGTACGGCTACC-3 ' (SEQ ID NO:8)；
Probe sequence is: 5 '-CAAATGAAGCCATTCGCTCATTAGTCGAAG (FAM-dT) G (THF) G (BHQ1-dT)
GACAAAGCGCAGACC(C3-SPACER)-3'.(SEQ ID NO:11)
It is expanded, is constructed using recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method amplification reaction system
25 μ l amplification reaction systems are as follows:
30mM trishydroxymethylaminomethane-acetate buffer solution pH8.0
100mM potassium acetate
14mM magnesium acetate
3mM dithiothreitol (DTT)
5% polyethylene glycol (molecular weight 20000)
2mM ATP
20mM phosphocreatine
100ng/ μ l creatine kinase
600ng/ μ l bacteriophage gp32 albumen
150ng/ μ l bacteriophage uvsX albumen
25ng/ μ l bacteriophage uvsY albumen
70ng/ μ l klenow polymerase Large fragment (exo-)
4U/ μ l reverse transcriptase
50ng/ μ l exonuclease III
450μM dNTP
Every upstream primer of 400nM
Every downstream primer of 400nM
Every fluorescence probe of 120nM
Template is the 1.5 μ l of positive plasmid of synthesis
Expanding temperature is 37 DEG C, reacts 20min, the changing value of detection fluorescence is carried out with GS8 fluorescence constant-temperature amplification instrument, often
30s reads first order fluorescence.It is detected using the positive plasmid that embodiment 1 synthesizes as template.
Template processing: with embodiment 1, finally confirm that its sensitivity can detect 10 after testing-5Ng/ μ l plasmid 6.
To sum up, embodiment 2 is most preferred embodiment, and best primer and probe are SEQ ID NO:3, SEQ ID NO:4 respectively
With the combination of SEQ ID NO:9.
Finally it should be noted that the above embodiments are merely illustrative of the technical solutions of the present invention rather than protects to the present invention
The limitation of range, although the invention is described in detail with reference to the preferred embodiments, those skilled in the art should be managed
Solution, can with modification or equivalent replacement of the technical solution of the present invention are made, without departing from technical solution of the present invention essence and
Range.
Sequence table
<110>Jiangsu aquatic product fishery popularization center, Suzhou first reach Gene Tech. Company Limited
<120>for detect the specific primer of grass carp hemorrhage virus to, probe, detection kit
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 32
<212> DNA
<213>upstream primer (Artificial Sequence)
<400> 1
accattcaag actcccacgc ttgttcacgt ca 32
<210> 2
<211> 32
<212> DNA
<213>downstream primer (Artificial Sequence)
<400> 2
ggcctggcag tgatttcgga cgcaagcggt ag 32
<210> 3
<211> 31
<212> DNA
<213>upstream primer (Artificial Sequence)
<400> 3
cgccaacgtc aagaccattc aagactccca c 31
<210> 4
<211> 32
<212> DNA
<213>downstream primer (Artificial Sequence)
<400> 4
gaatcgtcca agtcacaggt gcgaaacgga ag 32
<210> 5
<211> 32
<212> DNA
<213>upstream primer (Artificial Sequence)
<400> 5
tacaccatct gcgccttctg ccttacgact ct 32
<210> 6
<211> 31
<212> DNA
<213>downstream primer (Artificial Sequence)
<400> 6
tgatagtcta cagtacggct accgacgagg g 31
<210> 7
<211> 32
<212> DNA
<213>upstream primer (Artificial Sequence)
<400> 7
cccacgccaa cgtcaagacc attcaagact cc 32
<210> 8
<211> 32
<212> DNA
<213>downstream primer (Artificial Sequence)
<400> 8
tccaattcgt gatagtctac agtacggcta cc 32
<210> 9
<211> 47
<212> DNA
<213>probe sequence (Artificial Sequence)
<400> 9
tcggtagccg cactgtggac tatcacgaat gagtgaaagc tggattc 47
<210> 10
<211> 45
<212> DNA
<213>probe sequence (Artificial Sequence)
<400> 10
tcatttggtt gacgggaaca agcgtgggag tggatggtct tgacg 45
<210> 11
<211> 47
<212> DNA
<213>probe sequence (Artificial Sequence)
<400> 11
caaatgaagc cattcgctca ttagtcgaag gggacaaagc gcagacc 47
<210> 12
<211> 401
<212> DNA
<213>VP7 Gene Partial sequence (Artificial Sequence)
<400> 12
cgtcacctgc gggcggtaca ccatctgcgc cttctgcctt acgactctgg ctccccacgc 60
caacgtcaag accattcaag actcccacgc ttgttcacgt caaccaaatg aagccattcg 120
ctcattagtc gaagtgagtg acaaagcgca gaccgccctc gtcggtagcc gtactgtaga 180
ctatcacgaa ttggatgtga aagctgggtt cgtcgcccca actgccgatg aaacaatagc 240
cccctctaag gatatcgtcg aacttccgtt tcgcacctgt gacttggacg attcctctgc 300
taccgcttgc gtccgaaatc actgccaggc cggtcacgac ggcgttatcc acctcccgat 360
cctttctgga gatttcaaat tgcctaacga gcatcccacc a 401
Claims (10)
1. a kind of for detecting the specific primer pair of grass carp hemorrhage virus, which is characterized in that the primer pair includes that upstream is drawn
Object and downstream primer, the nucleotide sequence of the upstream primer such as SEQ ID NO:1 or SEQ ID NO:3 or SEQ ID NO:5
Or shown in SEQ ID NO:7, the nucleotide sequence of the downstream primer such as SEQ ID NO:2 or SEQ ID NO:4 or SEQ
Shown in ID NO:6 or SEQ ID NO:8.
2. the probe being used cooperatively with primer pair described in claim 1, which is characterized in that the nucleotide sequence of the probe is such as
Shown in SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11.
3. probe according to claim 2, which is characterized in that the probe is the probe of fluorochrome label, described glimmering
Photoinitiator dye is SYTO-13, SYTO-82, FAM, FITC, SYBR Green I, SYTO-13, SYTO-82, VIC, HEX, JOE,
One of TAMRA, TET, Cy3, ROX, TEXAS-Red or Cy5.
4. specific primer described in claim 1 to, probe as claimed in claim 2 in the detection of preparation grass carp hemorrhage virus or
Application in diagnostic kit.
5. a kind of detection kit of grass carp hemorrhage virus, which is characterized in that the detection kit packet of the grass carp hemorrhage virus
Include the described in any item probes of primer pair and/or claim 2 ~ 3 described in claim 1.
6. the detection kit of grass carp hemorrhage virus according to claim 5, which is characterized in that the detection kit
Reaction system includes: recombinase, polymerase, single-stranded DNA binding protein, nuclease, at least pair of primers, a probe, dNTP,
Crowding agent, recombination load albumen, energy system and salt ion.
7. the detection kit of grass carp hemorrhage virus according to claim 6, which is characterized in that the recombinase is selected from and bites
Thallus UvsX albumen, any one or more combinations of Escherichia coli recA albumen.
8. the detection kit of grass carp hemorrhage virus according to claim 6, which is characterized in that the nuclease is selected from core
Sour exonucleaseⅢ, any one or more combinations of endonuclease IV.
9. the detection kit of grass carp hemorrhage virus according to claim 6, which is characterized in that the crowding agent is poly-
Ethylene glycol, the polyethylene glycol are selected from PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG20000,
One or more of PEG25000, PEG30000, PEG35000 or PEG40000.
10. the detection kit of grass carp hemorrhage virus according to claim 7, which is characterized in that the energy system choosing
From one or more kinds of combinations of ATP, phosphocreatine, creatine kinase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811067067.1A CN109182599A (en) | 2018-09-13 | 2018-09-13 | For detect the specific primer of grass carp hemorrhage virus to, probe, detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811067067.1A CN109182599A (en) | 2018-09-13 | 2018-09-13 | For detect the specific primer of grass carp hemorrhage virus to, probe, detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109182599A true CN109182599A (en) | 2019-01-11 |
Family
ID=64910669
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811067067.1A Withdrawn CN109182599A (en) | 2018-09-13 | 2018-09-13 | For detect the specific primer of grass carp hemorrhage virus to, probe, detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109182599A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110016523A (en) * | 2019-04-25 | 2019-07-16 | 江苏省渔业技术推广中心 | For detect the specific primer of prawn baculovirus to, probe, detection kit |
-
2018
- 2018-09-13 CN CN201811067067.1A patent/CN109182599A/en not_active Withdrawn
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110016523A (en) * | 2019-04-25 | 2019-07-16 | 江苏省渔业技术推广中心 | For detect the specific primer of prawn baculovirus to, probe, detection kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| EP4198142A1 (en) | Kit and method for detecting nucleic acid and uses thereof | |
| CN112501268A (en) | Nanopore sequencing-based primer group and kit for rapidly identifying respiratory microorganisms and application of primer group and kit | |
| WO2020151532A1 (en) | Model for predicting treatment responsiveness based on intestinal microorganism information | |
| CN113652505B (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| CN103725796A (en) | BVDV (bovine viral diarrhea virus) internal control typing fluorescent PCR (polymerase chain reaction) detection kit and preparation thereof | |
| CN110734994A (en) | Specific primer pair, probe and detection kit for detecting aeromonas hydrophila | |
| CN109055618A (en) | For detect the specific primer of infectious spleen and kidney necrosis virus to, probe, detection kit | |
| CN108998576B (en) | Specific primer pair, probe and detection kit for detecting spring carp virus | |
| CN105567802A (en) | Fluorescence PCR (polymerase chain reaction) detection kit for Chlamydia pneumoniae | |
| CN110592268A (en) | RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV) | |
| CN112011632A (en) | RPA detection primer group, kit and method for polymyxin drug-resistant gene mcr-4 | |
| CN111793717A (en) | Specific primer pair, probe and kit for detecting novel coronavirus | |
| CN112011650A (en) | Chinese bee sacbrood virus RT-RPA detection primer, probe and kit | |
| CN108998575B (en) | Establishment of double PCR detection method for chicken parvovirus and chicken newcastle disease virus | |
| CN109666746B (en) | Primer, probe and kit for detecting human ROS1 gene fusion mutation and detection method thereof | |
| CN109182599A (en) | For detect the specific primer of grass carp hemorrhage virus to, probe, detection kit | |
| CN110699470A (en) | Dual PCR primer, kit, application and method for detecting salmonella and identifying pullorum disease/gallinarum serotype | |
| CN108070638B (en) | Recombinase polymerase isothermal amplification method for detecting orientia tsutsutsugamushi, special primer and probe thereof and application | |
| CN115747361A (en) | Real-time fluorescent MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method | |
| CN110894532A (en) | RAA constant temperature fluorescence detection method and reagent for bacterial septicemia (FBS) | |
| CN110592269A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type 2 virus (GCRV-2) | |
| CN115725756A (en) | RPA primer group, reagent and kit for detecting treponema pallidum and application of RPA primer group, reagent and kit | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| KR101493910B1 (en) | Primer set for detecting strawberry latent ringspot virus and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20190111 |