CN110592268A

CN110592268A - RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV)

Info

Publication number: CN110592268A
Application number: CN201810607232.1A
Authority: CN
Inventors: 刘荭; 钱冬; 程奇; 王津津; 黄震巨; 张建勋; 肖文; 余国君; 史秀杰; 郑晓聪; 贾鹏; 于力; 何俊强; 刘莹; 温智清
Original assignee: Hangzhou Public Survey Biological Technology Co Ltd
Current assignee: Hangzhou Public Survey Biological Technology Co Ltd
Priority date: 2018-06-13
Filing date: 2018-06-13
Publication date: 2019-12-20

Abstract

The invention discloses a constant-temperature fluorescence detection method and a detection kit for lake Luo virus (TiLV) RAA. The detection kit comprises a forward primer SEQ ID NO.1, a reverse primer SEQ ID NO.2, a specific fluorescent probe SEQ ID NO.3, reaction liquid, reverse transcriptase, recombinant polymerase and a reference substance. The kit has strong specificity; the detection sensitivity is high and can reach 10 fg/mu L; the accuracy is high and reliable; the method is simple, convenient and quick to operate, is suitable for field detection, and has wide application scenes.

Description

RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV)

Technical Field

The invention belongs to the technical field of molecular biology, relates to a detection method for marine aquaculture industry, and particularly relates to an RAA constant-temperature fluorescence detection method and a kit for lake ro virus.

Background

Lake Luo Virus (Tilapia Lake Virus, TiLV), an emerging Virus discovered and reported in recent years, was first discovered in Israel in 2009 and has been currently identified in Columbia, Ecuador, Egypt, Israel and Thailand. Although this pathogen does not cause public health problems, it can lead to massive death of the infected population. The virus is reported to have strong infectivity, and large-area death is caused to tilapia bred in Israel, Ecuador, Egyptian and other countries, and the death rate is up to 70%.

According to the information released by the food and agriculture organization of the united nations, the Luo lake virus is possibly wider than the currently known distribution range, and poses a serious threat to the global tilapia culture, so that a plurality of countries pay attention and carry out active monitoring at present. The Luo lake virus is a negative strand RNA virus, the genome consists of 10 independent gene segments, the classification status is not determined at present, the Luo lake virus is a novel virus of the orthomyxoviridae, the Luo lake virus can grow at 24-33 ℃, and the optimal growth temperature is 25 ℃. In 2017, in 5 months, the virus is detected from the domestic cultivated tilapia for the first time. In view of the high mortality rate and the great economic loss caused by the Luo lake virus, in order to find whether the cultivated tilapia is infected by the Luo lake virus as soon as possible, a rapid, accurate and sensitive detection method is needed to be established.

Currently, there is no drug or method available for effective control of luo lake virus. At present, the TILV detection method is mainly an RT-PCR method. Although the PCR method is sensitive, accurate and rapid, and can replace the etiology detection, the PCR method is not suitable for the field rapid detection and the basic popularization and application due to the requirement of expensive instruments and equipment, higher detection cost and higher technical requirements on detection personnel. Compared with the common PCR technology, the fluorescent PCR detection technology simplifies the operation steps, can eliminate the cross contamination caused by the amplification product and reduce the occurrence of false positive. However, the real-time fluorescent PCR is long in time consumption and high in cost, and is not applied to conventional pathogen detection of aquaculture animals at present. The method for detecting the Luo lake virus by RAA constant temperature fluorescence is established, is rapid, convenient, accurate and reliable, is suitable for the time requirements of rapid port detection and Datong customs, and has an important effect on promoting the marine culture of China and the trade of products thereof.

The Recombinase-aid Amplification (RAA) technique is also a method by which nucleic acids can be rapidly amplified at a constant temperature. Unlike RPA, RAA amplification uses a recombinase obtained from bacteria or fungi, which binds tightly to the primer DNA at a constant temperature of 37 ℃ to form an aggregate of the enzyme and the primer, when the primer searches for a sequence on the template DNA that is completely complementary to the primer, the template DNA is melted with the help of single-strand DNA binding protein (SSB), and a new complementary strand of DNA is formed under the action of DNA polymerase, and the reaction product is exponentially increased, and usually an amplified fragment that can be detected by agarose gel electrophoresis can be obtained within 1 hour. The fluorescent group is added into the RAA reaction system, the whole RAA amplification process is monitored in real time by utilizing the accumulation of fluorescent signals, and the quantitative and qualitative analysis of the initial template can be realized within 20 minutes. The whole reaction is simple and quick, and high-temperature circulation is not needed, so the method is particularly suitable for being used in non-laboratory detection places with a large number of samples, and is suitable for the field of quick detection of foods.

Disclosure of Invention

In view of this, the present invention aims to provide a RAA constant temperature fluorescent nucleic acid detection kit and a detection method for lake luo virus (TILV).

In order to achieve the purpose, the invention adopts the following technical scheme:

a kit for detecting luo lake virus (TILV) nucleic acid comprising: the kit comprises a Rou lake virus forward primer, a reverse primer and a specific fluorescent probe, wherein the nucleotide sequence of the Rou lake virus forward primer is shown as SEQ ID No.1, the nucleotide sequence of the Rou lake virus reverse primer is shown as SEQ ID No.2, the nucleotide sequence of the specific fluorescent probe is shown as SEQ ID No.3, a fluorescent reporter group is marked at the 5 'end of the specific fluorescent probe, and a fluorescent quenching group is marked at the 3' end of the specific fluorescent probe.

In some embodiments, the fluorescent reporter group of the specific fluorescent probe is selected from one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC Red460, and the fluorescence quenching gene is selected from one of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

In some embodiments, the nucleic acid detection kit further comprises at least one of a primer mixture, a specific fluorescent probe, a Buffer, a RAA dry powder reagent, a luo lake virus standard, and DEPC-treated water.

In some embodiments, the kit, the reverse transcription system consists of a RTE reverse transcriptase, an rnase inhibitor.

In some embodiments, the kit of (a), wherein the a Buffer is 20% PEG; b Buffer is 280mM MgAc.

In some embodiments, the kit, wherein the composition of the RAA dry powder reagent is as follows: 1mmol/L dNTP, 90ng/μ L SSB protein, 120ng/μ L recA recombinase protein (SC-recA/BS-recA) or 30ng/μ LRad51, 30ng/μ L Bsu DNA polymerase, 30ng/mL RTE reverse transcriptase, 100mmol/L Tricine, 20% PEG, 5mmol/L dithiothreitol, 100ng/μ L creatine kinase, Exo exonuclease.

In some embodiments, the nucleic acid detection kit and the luo lake virus standard are positive plasmids containing partial sequences of the luo lake virus conserved genes.

In some embodiments, the kit, the sequence of the positive plasmid containing the partial sequence of the gene of the conserved region of the roche virus is shown as SEQ ID No. 4.

The invention also provides an RAA constant-temperature fluorescence detection method of the Luo lake virus, which comprises the steps of extracting RNA of a sample to be detected, carrying out real-time fluorescence RAA reaction in the presence of a forward primer, a reverse primer, a specific fluorescence probe, an RAA dry powder reagent, an A Buffer, a B Buffer and DEPC (diethylpyrocarbonate) treated water of the Luo lake virus by taking the RNA of the sample to be detected as a template, and analyzing the sample to be detected according to a real-time fluorescence RAA amplification curve; wherein the nucleotide sequence of the forward primer of the Luo lake virus is shown as SEQ ID NO.1, the nucleotide sequence of the reverse primer of the Luo lake virus is shown as SEQ ID NO.2, the nucleotide sequence of the specific fluorescent probe is shown as SEQ ID NO.3, the 5 'end of the specific fluorescent probe is marked with a fluorescent reporter group, and the 3' end of the specific fluorescent probe is marked with a fluorescent quenching group.

In some embodiments, the Roche Virus nucleic acid RNA extraction is performed using conventional Trizol-RNA reagents or using an equivalent RNA extraction kit.

In some embodiments, the performing a fluorescent RAA reaction procedure is: at 39 ℃ for 40 s; at 39 ℃ for 20min, and 40 cycles in total;

according to the detection method, after the real-time fluorescence RAA reaction is required to be finished, the to-be-detected sample is analyzed according to the amplification curve of the real-time fluorescence RAA by using the analysis software of the real-time fluorescence RAA instrument. Preferably, the FAM channel fluorescence curve of the sample to be tested is S-shaped and the CT value is less than or equal to 35, and the sample to be tested is judged to be a positive result of the Luo lake virus; and when the curve of the sample to be detected is not S-shaped or the CT value is more than 35, judging as the negative result of the Luo lake virus.

Advantageous effects

1. Fast and efficient: the whole amplification can be completed within 20-30min, and the amplification yield can reach 10⁹-10¹⁰A copy;

2. the operation is simple: no special reagent is needed, complicated steps such as deformation of double-stranded DNA and the like are not needed in advance, only a constant-temperature fluorometer is needed, and the conditions are mild;

3. high specificity: the present invention is useful for other conditions of fish such as Viral Nervous Necrosis Virus (VNNV), Viral Hemorrhagic Septicemia Virus (VHSV), Infectious Hematopoietic Necrosis Virus (IHNV), carp spring viraemia (SVCV), Paralichthys rhabdovirus (HRV), Infectious Salmon Anaemia Virus (ISAV), lake of Roots virus (TiLV).

4. High sensitivity: the detection limit of the invention can reach 10 fg/reaction

5. The identification is simple: and the amplification result is directly judged according to the real-time fluorescence data, electrophoresis detection is not needed, and the method is suitable for field detection.

Drawings

FIG. 1 is a graph showing the amplification of 4 pairs of primers RAA involved in the present invention.

FIG. 2 is a graph showing the sensitivity test of the RAA detection method to TILV, and the amplification results of the positive standards of 10 ng/. mu.L, 1 ng/. mu.L, 100 fg/. mu.L, 10 fg/. mu.L, and 1 fg/. mu.L are shown from left to right.

FIG. 3 is a graph showing the specificity of the RAA detection method for TILV.

Detailed description of the invention

The present invention is further illustrated by the following specific examples, but is not limited thereto.

Example 1:

the invention searches the gene sequence of the Rou lake virus strain in a Genebank database for the Rou lake virus, and uses DNAMAN 6.0 software to compare a plurality of sequences to find out a conservative section. 4 sets of primers and probes were designed in the conserved regions and BLAST alignments were performed in the NCBI database, with the sequences of the primers and probes as shown in Table 1. The positive sample amplification curve is shown in FIG. 1.

Table 1 primer and probe sequences:

as can be seen from the results in FIG. 1, the amplification curves for the fourth set of primers and probes are most typical, with distinct exponential and plateau phases, with higher fluorescence intensity (ordinate values), and smaller CT values (abscissa corresponding to the intersection of the curve with the threshold line) and the results are analyzed in Table 2. The rise height of other primer probe curves is lower, the CT value is larger, and the plateau period is not obvious; or no amplification occurs and missed detection occurs. The fourth group of primers and the target products of the probes have higher replication speed, more quantity and higher amplification reaction efficiency.

TABLE 2 analysis of primer Probe screening results

Group \ result	CT value	Intensity of fluorescence
			First group	9.93	220000
Second group	9.13	210000
			Third group	6.94	350000
Fourth group	5.59	525000

Real-time example 2: the kit Rou lake virus

The nucleic acid detection kit also comprises a primer mixed solution, a specific fluorescent probe, an A Buffer, a B Buffer, an RAA dry powder reagent, a Luo lake virus standard substance and DEPC treated water.

The kit of the invention, wherein the A Buffer is 20% PEG; b Buffer is 280mM MgAc.

The kit of the invention, wherein the RAA dry powder reagent comprises the following components: 1mmol/L dNTP, 90ng/μ L SSB protein, 120ng/μ L recA recombinase protein (SC-recA/BS-recA) or 30ng/μ L Rad51, 30ng/μ L Bsu DNA polymerase, 100mmol/L Tricine, 20% PEG, 5mmol/L dithiothreitol, 100ng/μ L creatine kinase, Exo exonuclease, 30ng/mL RTE reverse transcriptase.

In the primer mixture, the base sequence of the forward primer is shown as SEQ ID NO.1, the base sequence of the reverse primer is shown as SEQ ID NO.2, and the molar ratio of the forward primer to the reverse primer is SEQ ID NO. 1: SEQ ID NO.2 is 1: 1.

The base sequence of the specific probe of the Luo lake virus provided by the invention is shown in SEQ ID NO.3, the 5 'end of the probe is marked with FAM fluorescent reporter group, and the 3' end is marked with BHQ1 fluorescent quenching group.

The Rou lake virus standard substance provided by the invention comprises a positive plasmid of a Rou lake virus conserved region gene sequence, and the base sequence of the plasmid is shown as SEQ ID NO. 4.

Base sequence of plasmid (SEQ ID NO.4):

GAAATGGACTCGCGGTTCGCACAGCTAACTGGGGTTTTCTGCGACGATTTCACTTACAGCGAAGGGAGTCGGAGGTTCCTAAGCTCTTACAGTACAGTAGAGAGACGTCCAGGAGTCCCTGTAGAGGGCGACTGTTATGACTGTTTAAAGAATAAGTGGATTGCCTTTGAGCTGGAAGGCCAGCCGCGGAAATTTCCAAAGGCAACAGTTCGTTGCATTTTGAACAATGATGCCACATACGTTTGCTCTGAGCAAGAGTACCAGCAGATTTGTAAAGTACAATTCAAGGATTATTTAGAGATCGACGGGGTTGTTAAAGTTGGGCACAAGGCATCCTACGATGCTGAGCTGAGGGAACGGCTATTGGAACTACCACATCCAAAGAGCGGCCCGAAGCCTTGTATCGAGTGGGTGGCACCACCCAGACTTGCAGACATATCCAAGGAGACAGCTGAGCTAAAGAGGCAATATGGGTTCTTCGAGTGCTCTAAGTTCCTCGCCTGCGGTGAGGAGTGTGGTCTTGACCAAGAGGCAAGAGAACTTATACTGAACGAATACGCACGTGATAGGGAATTTGAGTTCCGCAATGGAGGGTGGATACAAAGGTACACAGTTGCTTCTCATAAGCCTGCCACACAGAAGATATTGCCTCTACCAGCTA.GTGCCCCACTTGCTCGTGAGCTTTTGATGTTGATCGCTAGAAGCACAACTCAAGCAGGGAAAGTACTGCATAGCGATAATACCAGCATACTAGCTGTACCGGTCATGCGTGACTCTGGAAAGCACAGCAAAAGGAGACCAACCGCCTCCACTCACCACTTAGTTATGGGTCTAAGTAAACCTGGTTGTGAACACGATTTTGAGTTTGACGGGTACAGGGCAGCTGTGCATGTAATGCACTTAGATCCTAAGCAATCGGCCAATATAGGGGAGCAAGACTTTGTGAGTACCCGAGAAATTTACAAGCTAGATATGTTGGAACTGCCTCCCATAAGTAGAAAGGGTGATCTGGACAGAGCTAGTGGTCTTGAGACAAGATGGGATGTCATCTTACTTCTAGAATGCCTCGACTCCACAAGGGTTAGCCAAGCAGTGGCTCAACATTTCAATAGGCATCGGCTAGCACTCAGTGTCTGTAAGGACGAGTTCAGGAAAGGCTACCAGCTGGCTTCGGAGATAAGGGGTACAATACCCTTAAGCTCACTTTATTATTCACTTTGTGCAGTAAGATTGCGGATGACAGTACACCCATTTGCGAGATAATCGCTTTCGACG

the DEPC treated water provided by the invention is purchased from Solambio company.

Example 3: the kit of the invention relates to Luo lake virus

1. Extraction of nucleic acids from Positive samples

1.1, nucleic acid extraction: conventional Trizol-RNA reagents or an equivalent RNA extraction kit were used.

2. Configuration of RAA reaction system: one RAA reaction dry powder tube was used for each test sample, and the reaction components and the added volume in each RAA reaction dry powder tube are shown in Table 3.

Table 3:

RAA reaction system component	Volume (μ L)
		A Buffer	12.5μL
B Buffer	2.5μL
		Primer mixture	4μL
Specific fluorescent probe	0.6μL
		DNA template	2μL
DEPC treated Water	28.4μL
		Total volume	50μL

A Buffer is 20% PEG; b Buffer is 280mM MgAc

3. Placing the RAA reaction tube with the prepared reaction system in an ABI7500 amplification instrument, and carrying out RAA amplification according to the following procedures: at 37 ℃ for 40 s; at 37 ℃ for 20min, for a total of 40 cycles. Fluorescence of FAM channels was collected for each cycle.

4. And after the amplification is finished, judging the positive or negative result of the Luo lake virus according to the fluorescent curve judgment and the CT value.

And (4) judging the result: the fluorescence curve of the FAM channel is S-shaped, the CT value is less than or equal to 35, and the FAM channel is judged as a positive result of the Luo lake virus; and when the curve of the sample to be detected is not S-shaped or the CT value is more than 35, judging as the negative result of the Luo lake virus.

Example 4: evaluation of RAA detection kit of the invention in clinical practical application

The kit is adopted to carry out clinical blind sample experiments, and 60 parts of prawns are detected; experimental results show that the fourth primer pair can distinguish the Luo lake virus and has high positive coincidence rate with reverse transcription PCR. Of 50, 33 of the reverse transcription PCR products were positive results, 27 were negative results, 33 of the results detected by the RAA method were positive, and 27 were also negative results, and the results were completely consistent with those of the actual samples, indicating that the RAA detection reagent of the present invention had higher accuracy.

Test example 5: sensitivity test of the kit of the invention

The kit provided by the embodiment 2 of the invention extracts positive plasmids from the standard plasmid of the Rou lake virus, measures the concentration of the positive plasmids by using NanoDrop, and dilutes the positive plasmids to 5 concentration gradients of 100 fg/muL, 10 fg/muL, 1 fg/muL, 0.1 fg/muL and 0.01 fg/muL respectively to perform sensitivity tests.

The detection results are shown in figure 2, and are the amplification results of the positive standard substances of 100 fg/muL, 10 fg/muL, 1 fg/muL, 0.1 fg/muL and 0.01 fg/muL from left to right in sequence, so that the RAA fluorescence amplification reagent and the detection sensitivity can reach 1 fg/muL, the accuracy is better than that of the common PCR detection method, and the RAA constant temperature fluorescence detection kit and the detection method have high sensitivity on the diagnosis of TILV.

Test example 6: specificity test of the kit of the present invention

In order to detect the specificity of the kit, the detection method in example 3 is adopted to respectively detect the viruses VNNV, IHNV, VHSV, TILV, HRV, ISAV, TILV and TiLV samples, and the detection conditions of the kit on TILV and other common viruses of prawns are analyzed.

The detection result shows that: normal amplification occurred in the TILV-only samples, and no amplification occurred in the negative controls (DEPC-treated water) and in the VNNV, TILV, VHSV, TILV, HRV, ISAV, TiLV samples (as shown in FIG. 3). The results show that the RAA constant temperature fluorescence detection kit can specifically amplify the target sequence in TILV without cross reaction with other virus nucleic acids. The method and the kit have good specificity and do not generate false negative.

Meanwhile, the same specificity experiment is carried out on the primers 1-3 designed by the invention, and the primers can not distinguish different samples well and have poor specificity (the specific experimental data is slight).

The invention shown and described herein may be practiced in the absence of any element or elements, limitation or limitations, which is specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, and it is recognized that various modifications are possible within the scope of the invention. It should therefore be understood that although the present invention has been specifically disclosed by various embodiments and optional features, modification and variation of the concepts herein described may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.

The contents of the articles, patents, patent applications, and all other documents and electronically available information described or cited herein are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other documents.

Sequence listing

<110> Hangzhou Zhongzhuang Biotech Co., Ltd

RAA constant temperature fluorescence detection method and reagent for <120> Luo lake virus (TiLV)

<130> 18-100070-00005410

<141> 2018-06-13

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggcaccaccc agacttgcag acatat 26

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgtgcgtatt cgttcagtat aagtt 25

<210> 3

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aacttagagc actcgaagaa cccatatgcc tttagctcag ct 42

<210> 4

<211> 1275

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaaatggact cgcggttcgc acagctaact ggggttttct gcgacgattt cacttacagc 60

gaagggagtc ggaggttcct aagctcttac agtacagtag agagacgtcc aggagtccct 120

gtagagggcg actgttatga ctgtttaaag aataagtgga ttgcctttga gctggaaggc 180

cagccgcgga aatttccaaa ggcaacagtt cgttgcattt tgaacaatga tgccacatac 240

gtttgctctg agcaagagta ccagcagatt tgtaaagtac aattcaagga ttatttagag 300

atcgacgggg ttgttaaagt tgggcacaag gcatcctacg atgctgagct gagggaacgg 360

ctattggaac taccacatcc aaagagcggc ccgaagcctt gtatcgagtg ggtggcacca 420

cccagacttg cagacatatc caaggagaca gctgagctaa agaggcaata tgggttcttc 480

gagtgctcta agttcctcgc ctgcggtgag gagtgtggtc ttgaccaaga ggcaagagaa 540

cttatactga acgaatacgc acgtgatagg gaatttgagt tccgcaatgg agggtggata 600

caaaggtaca cagttgcttc tcataagcct gccacacaga agatattgcc tctaccagct 660

agtgccccac ttgctcgtga gcttttgatg ttgatcgcta gaagcacaac tcaagcaggg 720

aaagtactgc atagcgataa taccagcata ctagctgtac cggtcatgcg tgactctgga 780

aagcacagca aaaggagacc aaccgcctcc actcaccact tagttatggg tctaagtaaa 840

cctggttgtg aacacgattt tgagtttgac gggtacaggg cagctgtgca tgtaatgcac 900

ttagatccta agcaatcggc caatataggg gagcaagact ttgtgagtac ccgagaaatt 960

tacaagctag atatgttgga actgcctccc ataagtagaa agggtgatct ggacagagct 1020

agtggtcttg agacaagatg ggatgtcatc ttacttctag aatgcctcga ctccacaagg 1080

gttagccaag cagtggctca acatttcaat aggcatcggc tagcactcag tgtctgtaag 1140

gacgagttca ggaaaggcta ccagctggct tcggagataa ggggtacaat acccttaagc 1200

tcactttatt attcactttg tgcagtaaga ttgcggatga cagtacaccc atttgcgaga 1260

taatcgcttt cgacg 1275

Claims

1. A kit for detecting lake luo virus (TiLV) nucleic acid comprising: the kit comprises a Rou lake virus forward primer, a reverse primer and a specific fluorescent probe, wherein the nucleotide sequence of the Rou lake virus forward primer is shown as SEQ ID No.1, the nucleotide sequence of the Rou lake virus reverse primer is shown as SEQ ID No.2, the nucleotide sequence of the specific fluorescent probe is shown as SEQ ID No.3, a fluorescent reporter group is marked at the 5 'end of the specific fluorescent probe, and a fluorescent quenching group is marked at the 3' end of the specific fluorescent probe.

2. The nucleic acid detection kit according to claim 1, wherein the fluorescence reporter group of the specific fluorescent probe is selected from one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460, and the fluorescence quenching gene is selected from one of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

3. The nucleic acid detection kit according to claims 1 and 2, further comprising at least one of a primer mixture, a specific fluorescent probe, a Buffer, a RAA dry powder reagent, a luo lake virus standard, and DEPC-treated water.

4. The kit of claim 3, wherein the reverse transcription system comprises RTE reverse transcriptase and RNase inhibitor.

5. The kit according to claim 3, wherein the A Buffer is 20% PEG; b Buffer is 280mM MgAc.

6. The kit of claim 5, wherein the RAA dry powder reagent is comprised of: 1mmol/L dNTP, 90ng/μ L SSB protein, 120ng/μ L recA recombinase protein (SC-recA/BS-recA) or 30ng/μ L Rad51, 30ng/μ L Bsu DNA polymerase, 30ng/mL RTE reverse transcriptase, 100mmol/L Tricine, 20% PEG, 5mmol/L dithiothreitol, 100ng/μ L creatine kinase, Exo exonuclease.

7. The nucleic acid detection kit according to any one of claims 1 to 5, wherein the Rou lake virus standard is a positive plasmid containing a partial sequence of a gene of a conserved region of Rou lake virus.

8. The kit according to claim 6, wherein the sequence of the positive plasmid containing the partial sequence of the Rou lake virus conserved region gene is shown as SEQ ID No. 4.

9. The RAA constant-temperature fluorescence detection method of the Luo lake virus comprises the steps of extracting RNA of a sample to be detected, carrying out real-time fluorescence RAA reaction in the presence of a forward primer, a reverse primer, a specific fluorescence probe, an RAA dry powder reagent, an A Buffer, a B Buffer and DEPC (diethyl phthalate) treated water of the Luo lake virus by taking the RNA of the sample to be detected as a template, and analyzing the sample to be detected according to a real-time fluorescence RAA amplification curve; wherein the nucleotide sequence of the forward primer of the Luo lake virus is shown as SEQ ID NO.1, the nucleotide sequence of the reverse primer of the Luo lake virus is shown as SEQ ID NO.2, the nucleotide sequence of the specific fluorescent probe is shown as SEQ ID NO.3, the 5 'end of the specific fluorescent probe is marked with a fluorescent reporter group, and the 3' end of the specific fluorescent probe is marked with a fluorescent quenching group.

10. According to claim 9, the RNA extraction of the Roche virus nucleic acid adopts a traditional Trizol-RNA reagent or an equivalent RNA extraction kit.