CN107974515A - A kind of constant temperature quick detection kit of Tilapia mossambica Luohu virus - Google Patents
A kind of constant temperature quick detection kit of Tilapia mossambica Luohu virus Download PDFInfo
- Publication number
- CN107974515A CN107974515A CN201711204371.1A CN201711204371A CN107974515A CN 107974515 A CN107974515 A CN 107974515A CN 201711204371 A CN201711204371 A CN 201711204371A CN 107974515 A CN107974515 A CN 107974515A
- Authority
- CN
- China
- Prior art keywords
- primer
- constant temperature
- kit
- pair
- detection kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of constant temperature quick detection kit of Tilapia mossambica Luohu virus, includes the constant temperature fluorescent detector primers group of detection Luohu virus causing disease, is made of a pair of of outer primer, a pair of of inner primer and a pair of of ring primer, the sequence such as SEQ ID NO of outer primer:1~SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of inner primer:3~SEQ ID NO:Shown in 4, the sequence such as SEQ ID NO of ring primer:5~SEQ ID NO:Shown in 6.The detection kit specificity of the present invention is good, high sensitivity, for the positive plasmid containing Tilapia mossambica Luohu virus causing disease detection target gene, minimum detectability can reach 1fg/ μ L, detection time is short, testing result can be obtained at 45 minutes or so, can obtain positive findings within most fast 10 minutes, when smaller than Standard PCR saving 3 ~ 4.Kit is reacted using one-step method, and anti-pollution ability is strong, prevents Aerosol Pollution.Simple operation, it is easy to spread.Kit is safer to human and environment, and noxious material is free of in material composition and product.
Description
Technical field
The invention belongs to fishes virus detection field, more particularly to a kind of monitoring and diagnosis for Tilapia mossambica lake virus
Technology.
Background technology
On May 26th, 2017, food and agricultural organization's global information and early warning system issue special alarm：A kind of infectiousness is very strong
Disease is being cultivated to be propagated with wild Tilapia mossambica.It has been established that causes pathogen entitled " Luohu " virus of the disease
（Tilapia Lake Virus, TiLV）.Luohu virus（TiLV）It is a kind of very strong virus of infectiousness, infected fish can be caused
Group's mortality, the death rate are up to 80% ~ 90%.Luohu virus is reported first in Israel and Ecuador within 2009, later
5 countries in three continents have been found that epidemic situation, including Colombia, Ecuador, Egypt, Israel and Thailand.2015 with
Come, which breaks out on a large scale in Thailand, belongs to Asia the first.Tilapia mossambica is second-biggest-in-the-world aquaculture kind, and China is
The big cultivation state of the first of Tilapia mossambica, yield account for the 40% of Gross World Product, and wherein Hainan Province is that the maximum cultivation of Tilapia mossambica saves
Part, account for the 42% of national Tilapia mossambica total output.On June 13rd, 2017, Taiwan confirm the first " Luohu " viral epidemic situation, Rofe
There is mortality situation in fish.Judging from the current situation, " Luohu " viral epidemic situation oncoming force is violent, it is fast to propagate, loses big, prevention and control situation
More severe, the risk in incoming China significantly increases.Once break out the viral epidemic situation of Introduced cases " Luohu ", it will heavy losses China's Rofe
Fish culture industry.
The diseased Tilapia mossambica main clinic symptoms of infection Luohu virus show as losing the appetite, and move about slow, skin injury
And ulcer；Histologic lesion occurs mainly in brain, eye and liver, shows as encephaledema, meningorrhagia；Eye disease is obvious, just
Phase lenticular opacities, later stage lens rupture；Liver, kidney hemorrhagic disease, spleen enlargement etc., and can be by infected Rofe
Fish is propagated to not infected Tilapia mossambica.Research shows that the virus is a kind of new virus similar to orthomyxovirus.TiLV bases
Because group is made of the strand RNA of 10 segments.Segment 1 is up to 1.641kb, segment 2-10 be respectively 1.471kb, 1.371kb,
1.250kb、1.099kb、1.044kb、0.777kb、0.657kb、0.548kb、0.465kb.Wherein, segment 1 is opened comprising one
Reading frame is put, there is low similitude with the PB1 subunits of influenzavirus C, other 9 segments are with other viruses without similitude.But 9
There is conservative complementary series, this is similar to the virus of orthomyxovirus section between the 5 ' of segment and 3 ' terminal sequences.In morbidity fish
Liver and brain in can detect the nucleic acid of virus, the virus bred in addition in cell culture fluid can cause disease-free Tilapia mossambica
It is diseased.Grass carp can also be infected by having the reported literature virus at present, yellow head fish, channel catfish and the secondary beautiful fish of flower body etc. other
Fish species.
Existing detection of the report to Tilapia mossambica Luohu viruses molecule both at home and abroad generally use nest-type PRC, heminested PCR with
The method of quantitative PCR.Research at present at home on Luohu method for detecting virus is few, on the market rarer detection reagent
Box.If the common detection methods in foreign literature are applied in the farming disease harms monitoring and Exit-Entry Quaratine, its detection time
Long and heavy workload, subjectivity are strong, are unfavorable for the detection and prevention of lake virus.Meanwhile band can not be avoided in terms of the quarantine of border
Viral sample enters China, potential morbidity information can not be passed to related staff, notify raiser to take early early
Defensive measure limits a wide range of outburst of the virosis.Therefore, it is badly in need of establishing the TiLV detection techniques of rapid sensitive.
In molecular Biological Detection technology, ring mediated isothermal amplification（loop-mediated isothermal
Amplification, LAMP）Technology is a kind of Novel isothermal nucleic acid amplification method, mainly utilizes 4 kinds of different specific primers
Identify 6 specific regions of target gene, and utilize a kind of archaeal dna polymerase with strand-displacement activity（Bst DNA
ploymerase）, in constant temperature（65 DEG C or so）Lower fast-amplifying nucleic acid, ensure that the high specific and high efficiency of amplification,
10 can be reached in 1h9~1010Target sequence copies.LAMP method has that easy to operate, detection is quick, sensitivity and specificity are high
And the advantages that of low cost, it is not necessary to which expensive instrument can be completed to detect, in nucleic acids research, medical diagnosis on disease, Pathogen test etc.
It is used widely in field.Have not yet to see and LAMP technology is applied in the detection of Tilapia mossambica Luohu virus in the prior art
The content of the invention
It is an object of the invention to overcome the deficiencies of the prior art and provide one kind to have high sensitivity, high specificity, operation
Tilapia mossambica Luohu virus constant temperature fluorescence detection reagent kit easy, detection time is short.It is normal different from what is reported in domestic and foreign literature
The detection method of rule, is conducive to the monitoring prevention of Luohu virus and the quarantine of entry and exit system.
To achieve these goals, the present invention is achieved by the following technical programs：
A kind of constant temperature quick detection kit of Tilapia mossambica Luohu virus, includes the constant temperature fluoroscopic examination of detection Luohu virus causing disease
Primer sets, are made of a pair of of outer primer, a pair of of inner primer and a pair of of ring primer,
The sequence of a pair of of outer primer is：
F3：GTACCAGCAGATTTGTAAGGT,
B3：CTATCACGTGCGTACTCG；
The sequence of a pair of of inner primer is：
FIP：CCACTCAATACGAGGCTTCGGCATCCTACGATGCTGAGC,
BIP：CCAGACTTGCGGACATATCCAACAGGCGAGGAACTTTGAG；
The sequence of a pair of of ring primer is：
LF：TGGTAGTTCCAATAGCCGTTC,
LB：AGGCAATATGGATTCTTCGAGT.
The sequence of outer primer such as SEQ ID NO:1~SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of inner primer:3
~SEQ ID NO:Shown in 4, the sequence such as SEQ ID NO of ring primer:5~SEQ ID NO:Shown in 6.
In mentioned reagent box, the kit further includes archaeal dna polymerase, reverse transcriptase, 2 × reaction buffer, fluorescence
Dyestuff, sealing fluid, standard positive template and negative control.
Preferably, in mentioned reagent box, mole of the outer primer of primer sets, inner primer and ring primer in the kit
Than for 1~2：4~8：2~4.
It is highly preferred that in mentioned reagent box, the outer primer of primer sets in the kit, inner primer and ring primer rub
You are than being 1：4：2.
Preferably, in mentioned reagent box, the 2 × reaction buffer is by buffer buffer solutions, glycine betaine and dNTPs
Composition, the volume ratio of buffer buffer solutions, glycine betaine and dNTPs is 10：8：7.
Preferably, in mentioned reagent box, the archaeal dna polymerase is Bst archaeal dna polymerases, and reverse transcriptase inverts for AMV
Enzyme is recorded, fluorescent dye is 0.02mM SYTO-9, and sealing fluid is mineral oil.
Preferably, in mentioned reagent box, the standard positive template is to detect target containing Tilapia mossambica Luohu virus causing disease
The Plasmid DNA of gene is marked, the negative control is sterilizing ultra-pure water.
It is highly preferred that in mentioned reagent box, the reaction system of the kit into being grouped into：Primers F 3, B3,
The final concentration of FIP, BIP, LF, LB in the reaction system is respectively 0.2 μM, 0.2 μM, 0.8 μM, 0.8 μM, 0.4 μM, 0.4 μM, and 2
0.5 μ L of × reaction solution 12.5 μ L, archaeal dna polymerase 8U, reverse transcriptase 2U, 0.02mM SYTO-9,2 μ L of measuring samples, add sterilizing
Ultra-pure water is to 25 μ L；The reaction condition of reaction system is 63 DEG C of 45~60min of reaction, and in 80 DEG C of lasting 2min.
The present invention judges testing result according to amplification curve.Amplification curve is in serpentine, and testing result is the positive, that is, is examined
Contain Tilapia mossambica Luohu virus causing disease in sample；No serpentine amplification curve occurs, and testing result is feminine gender, that is, detects sample
Tilapia mossambica Luohu virus causing disease is not contained.
Compared with existing detection technique, virus constant temperature fluorescence detection method in Tilapia mossambica lake provided by the invention has with following
Beneficial effect：
1st, specificity is good：LAMP primer of the present invention is designed according to 5 different zones of 3 gene of TilV fragments,
The pair of primers that wherein specificity is most strong is have selected, only has expanding effect to Tilapia mossambica lake virus.
2nd, kit high sensitivity of the invention, for the positive containing Tilapia mossambica Luohu virus causing disease detection target gene
Plasmid, minimum detectability can reach 1fg/ μ L.
3rd, kit detection time of the invention is short, and testing result can be obtained at 45 minutes or so, 10 minutes most fast
Obtain positive findings；When smaller than Standard PCR saving 3 ~ 4.
4th, kit of the invention is using one-step method reaction, transcriptive process,reversed and amplification procedure in a reaction tube into
OK, need not uncap after detection process and detection, anti-pollution ability is strong, prevents Aerosol Pollution.
5th, simple operation：The detection kit of the present invention is easy to operate, and visual result easily judges, for no operating experience
People uses, easy to spread.
6th, kit of the invention is safer to human and environment, and noxious material is free of in material composition and product.
Brief description of the drawings：
Fig. 1 is the negative control repeatability result schematic diagram of constant temperature Fluorometric assay Luohu virus causing disease in application examples 1.
Fig. 2 is the positive control sensitivity results schematic diagram of constant temperature Fluorometric assay Luohu virus causing disease in application examples 2.
Fig. 3 is the positive control stability result schematic diagram of constant temperature Fluorometric assay Luohu virus causing disease in application examples 3.
Fig. 4 is the actual sample result schematic diagram of constant temperature Fluorometric assay Luohu virus causing disease in application examples 4.
Fig. 5 is the actual sample specific outcome schematic diagram of constant temperature Fluorometric assay Luohu virus causing disease in application examples 5.
Embodiment
The present invention is made with reference to Figure of description and specific embodiment and further being elaborated, the embodiment
It is served only for explaining the present invention, is not intended to limit the scope of the present invention.Test method used in following embodiments is such as without spy
Different explanation, is conventional method；Used material, reagent etc., unless otherwise specified, for the reagent commercially obtained
And material.
Embodiment 1
A kind of constant temperature fluorescence detection reagent kit for detecting Tilapia mossambica Luohu virus causing disease, constituent are：One group of detection Luohu disease
The LAMP primer group of viral disease original, archaeal dna polymerase, reverse transcriptase, 2 × reaction buffer, fluorescent dye, sealing fluid, standard positive
Template and negative control.
The LAMP primer group of the detection Luohu virus causing disease, is made of outer primer, inner primer and ring primer, is with Luohu
3 gene of virus causing disease fragment aids in software using design of primers, designs 6 LAMP including ring primer as target gene
Primer, the sequence such as SEQ ID NO of outer primer:1~SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of inner primer:3~
SEQ ID NO:Shown in 4, the sequence such as SEQ ID NO of ring primer:5~SEQ ID NO:Shown in 6.
F3：GTACCAGCAGATTTGTAAGGT,
B3：CTATCACGTGCGTACTCG.
FIP：CCACTCAATACGAGGCTTCGGCATCCTACGATGCTGAGC.
BIP：CCAGACTTGCGGACATATCCAACAGGCGAGGAACTTTGAG,
LF：TGGTAGTTCCAATAGCCGTTC,
LB：AGGCAATATGGATTCTTCGAGT.
The molar ratio of the outer primer, inner primer and ring primer is 1：4：2.
2 × the reaction buffer is made of buffer buffer solutions, glycine betaine and dNTPs, and each component volume ratio is 10：
8：7.
The archaeal dna polymerase is Bst archaeal dna polymerases, and reverse transcriptase is AMV enzymes, and fluorescent dye is 0.02mM SYTO-9,
Sealing fluid is mineral oil.
The standard positive template be containing Luohu virus causing disease detect target gene Plasmid DNA, the negative control
For the ultra-pure water that sterilizes.
The reaction system of the kit into being grouped into：Primers F 3, B3, FIP, BIP, LF, LB are in the reaction system
Final concentration be respectively 0.2 μM, 0.2 μM, 0.8 μM, 0.8 μM, 0.4 μM, 0.4 μM, 2 × reaction solution, 12.5 μ L, archaeal dna polymerase
8U, reverse transcriptase 2U, 0.02mM SYTO-9 0.5 μ L, 2 μ L of measuring samples, add sterilizing ultra-pure water to 25 μ L；
The reaction condition of reaction system is 63 DEG C of 45~60min of reaction, and in 80 DEG C of lasting 2min.
Application examples 1
The negative control repeatability of kit detection Luohu cause of disease described in embodiment 1：
1st, template to be checked prepares：Positive control and negative control.
2nd, ring mediated isothermal amplification detection reaction system and condition：
25 μ L reaction systems contain：The final concentration of primers F 3, B3, FIP, BIP, LF, LB in the reaction system is respectively 0.2 μM,
0.2 μM, 0.8 μM, 0.8 μM, 0.4 μM, 0.4 μM, 2 × reaction solution 12.5 μ L, archaeal dna polymerase 8U, reverse transcriptase 2 U, 0.02mM
0.5 μ L of SYTO-9,2 μ L of measuring samples, add sterilizing ultra-pure water to 25 μ L.It is 20 μ L that sealing fluid, which adds volume,.Wherein, it is negative right
According to set 20 times it is parallel, positive control set 2 times it is parallel.
Centrifuged after the PCR pipe configured is mixed, 63 DEG C of 45~60min of reaction, and in 80 DEG C of lasting 2min.
3rd, testing result judges：Above-mentioned reaction tube is placed in fluorescent PCR instrument（ABI step-one）In, according to amplification curve
To judge testing result.Amplification curve is in serpentine, and testing result is the positive, that is, detects in sample and contain acute Hepatopancreatic necrosis
Cause of disease；No serpentine amplification curve occurs, and testing result is feminine gender, that is, detects sample and do not contain Luohu virus causing disease.
As shown in Figure 1, the results showed that：In the Luohu virus causing disease constant temperature Fluorometric assay kit of foundation, negative control
Detection is repeated 20 times without expanding.
Application examples 2
The positive control sensitivity of kit detection Luohu virus causing disease described in embodiment 1：
By positive control plasmid DNA carry out 10 times of gradient dilutions, respectively with 1ng/ μ L, 100pg/ μ L, 10pg/ μ L, 1pg/ μ L,
100fg/ μ L, 10fg/ μ L, 1fg/ μ L, 0.1 eight gradient concentration DNA of fg/ μ L are as template and negative control（Sterilize ultrapure
Water）Detection method is established according to above-mentioned reaction system and condition, to determine the sensitivity of kit.
As shown in Figure 2, the results showed that：After positive plasmid DNA is carried out 10 times of gradient dilutions, the Luohu virus causing disease of foundation
Constant temperature Fluorometric assay kit can detect concentration be 1fg/ μ L positive plasmid DNA.
Application examples 3
The positive control stability of kit detection Luohu virus causing disease described in embodiment 1：
Using the positive plasmid that concentration is 10pg/ μ L and 1pg/ μ L as template DNA, each set 30 times it is parallel, while feminine gender is set
Control（Sterilize ultra-pure water）Detection method is established according to above-mentioned reaction system and condition, to determine the stability of kit.
As shown in Figure 3, the results showed that, in the constant temperature Fluorometric assay kit of the Luohu virus causing disease of foundation, positive matter
Two concentration of grain repeat 30 times and are detected experiment, and repeatability is good, the Ct value coefficient of variation≤5%, it was demonstrated that the stabilization of kit
Well.
Application examples 4
It is as follows using the actual sample of the kit detection Luohu virus causing disease described in embodiment 1, step：
1st, the extraction of Luohu viral RNA：Sample is ground to uniform state, takes 500 μ L in 1.5mL centrifuge tubes, adds 500 μ
L physiological saline is uniformly mixed, and 10000rmp centrifugation 2min, take 100 μ L of supernatant in new 1.5mL centrifuge tubes, add 300 μ L and split
Solution liquid overturns mixing, stands cracking 8min, adds 200 μ L absolute ethyl alcohols, is vortexed and mixes, the nucleic acid collection being transferred in kit
It is combined in tubulature, 10000rmp centrifugation 1min, abandon filtrate, add 400 μ L cleaning solutions (confirming to add ethanol), 10000rmp centrifugations
1min, abandons filtrate, then adds 400 μ L cleaning solutions, and 10000rmp centrifugation 1min, abandon filtrate, 10000rmp skies are from 3min, by nucleic acid
Concetrated pipe is gone in new 1.5mL centrifuge tubes, adds 55 μ L DEPC water, stands 2min, 10000rmp centrifugation 1min, remove pillar
And cover, completion is extracted from -20 DEG C and saves backup.
2nd, the RNA of extraction is detected according to above-mentioned reaction system and reaction condition, while negative control is set.
As shown in Figure 4, the results showed that：Examined with the constant temperature Fluorometric assay kit of the Luohu virus causing disease of foundation
Survey, typical " S " type curve amplification is presented in sample, is positive findings, it was demonstrated that Luohu virus causing disease is detected in sample.
Application examples 5
The actual sample specificity of kit detection Luohu virus causing disease described in embodiment 1：
With the method for application examples 4 respectively to containing infectious hematopoietic necrosis's poison（IHNV）, it is red-spotted grouper nervous necrosis disease
Poison（RGNNV）, hemorrhagic disease of grass carp II types virus（GCRVII）, Koi herpesvirus（KHV）, grouper irido virus（GIV）, carp
Spring viremia virusemia virus（SVCV）The sample RNA of etiology nucleic acid and Luohu virus TiLV cause of diseases is detected.
As shown in Figure 5, the results showed that, there is amplification curve in the sample for containing only Luohu virus causing disease, remaining sample does not expand
Increase, show that the constant temperature Fluorometric assay kit specificity of the Luohu virus causing disease of foundation is good.
Claims (8)
1. a kind of constant temperature quick detection kit of Tilapia mossambica Luohu virus, it is characterised in that including detection Luohu virus causing disease
Constant temperature fluorescent detector primers group, is made of a pair of of outer primer, a pair of of inner primer and a pair of of ring primer,
The sequence of a pair of of outer primer is：
F3：GTACCAGCAGATTTGTAAGGT,
B3：CTATCACGTGCGTACTCG；
The sequence of a pair of of inner primer is：
FIP：CCACTCAATACGAGGCTTCGGCATCCTACGATGCTGAGC,
BIP：CCAGACTTGCGGACATATCCAACAGGCGAGGAACTTTGAG；
The sequence of a pair of of ring primer is：
LF：TGGTAGTTCCAATAGCCGTTC,
LB：AGGCAATATGGATTCTTCGAGT.
2. constant temperature quick detection kit as claimed in claim 1, it is characterised in that the outer of primer sets draws in the kit
The molar ratio of thing, inner primer and ring primer is 1~2：4~8：2~4.
3. constant temperature quick detection kit as claimed in claim 2, it is characterised in that the outer of primer sets draws in the kit
The molar ratio of thing, inner primer and ring primer is 1：4：2.
4. constant temperature quick detection kit as claimed in claim 1, it is characterised in that further include archaeal dna polymerase, reverse transcription
Enzyme, 2 × reaction buffer, fluorescent dye, sealing fluid, standard positive template and negative control.
5. constant temperature quick detection kit as claimed in claim 4, it is characterised in that the 2 × reaction buffer by
Buffer buffer solutions, glycine betaine and dNTPs compositions, the volume ratio of buffer buffer solutions, glycine betaine and dNTPs is 10：8：7.
6. constant temperature quick detection kit as claimed in claim 4, it is characterised in that the archaeal dna polymerase gathers for Bst DNA
Synthase, the reverse transcriptase are AMV reverse transcriptase, and the fluorescent dye is 0.02mM SYTO-9, and the sealing fluid is mineral
Oil.
7. constant temperature quick detection kit as claimed in claim 4, it is characterised in that the standard positive template is to contain sieve
The Plasmid DNA of non-fish Luohu virus causing disease detection target gene, the negative control are sterilizing ultra-pure water.
8. constant temperature quick detection kit as claimed in claim 1, it is characterised in that the reaction system of the kit into
It is grouped into：The final concentration of primers F 3, B3, FIP, BIP, LF, LB in the reaction system is respectively 0.2 μM, 0.2 μM, 0.8 μM,
0.8 μM, 0.4 μM, 0.4 μM, 0.5 μ L of 2 × reaction solution 12.5 μ L, archaeal dna polymerase 8U, reverse transcriptase 2U, 0.02mM SYTO-9,
2 μ L of measuring samples, add sterilizing ultra-pure water to 25 μ L；The reaction condition of reaction system is 63 DEG C of 45~60min of reaction, and at 80 DEG C
Continue 2min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711204371.1A CN107974515B (en) | 2017-11-27 | 2017-11-27 | Constant-temperature rapid detection kit for tilapia lake Luo virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711204371.1A CN107974515B (en) | 2017-11-27 | 2017-11-27 | Constant-temperature rapid detection kit for tilapia lake Luo virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107974515A true CN107974515A (en) | 2018-05-01 |
| CN107974515B CN107974515B (en) | 2021-05-14 |
Family
ID=62011785
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711204371.1A Active CN107974515B (en) | 2017-11-27 | 2017-11-27 | Constant-temperature rapid detection kit for tilapia lake Luo virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107974515B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109234451A (en) * | 2018-09-26 | 2019-01-18 | 中国水产科学研究院长江水产研究所 | A kind of Tilapia mossambica parvovirus TiPV CPA detection primer and application |
| CN110592268A (en) * | 2018-06-13 | 2019-12-20 | 杭州众测生物科技有限公司 | RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV) |
| CN113755645A (en) * | 2021-09-30 | 2021-12-07 | 厦门海关技术中心 | Fluorescent quantitative RT-PCR primer pair and probe for detecting Luo lake virus, kit and detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106456737A (en) * | 2014-02-13 | 2017-02-22 | 以色列州农业和农村发展部基姆伦兽医研究所 | Tilapia lake virus vaccines |
-
2017
- 2017-11-27 CN CN201711204371.1A patent/CN107974515B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106456737A (en) * | 2014-02-13 | 2017-02-22 | 以色列州农业和农村发展部基姆伦兽医研究所 | Tilapia lake virus vaccines |
Non-Patent Citations (1)
| Title |
|---|
| JAPHETTE ESTHER KEMBOU TSOFACK ET AL.: "Detection of Tilapia Lake Virus in Clinical samples by culturing and nested reverse transcription-PCR", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592268A (en) * | 2018-06-13 | 2019-12-20 | 杭州众测生物科技有限公司 | RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV) |
| CN109234451A (en) * | 2018-09-26 | 2019-01-18 | 中国水产科学研究院长江水产研究所 | A kind of Tilapia mossambica parvovirus TiPV CPA detection primer and application |
| CN113755645A (en) * | 2021-09-30 | 2021-12-07 | 厦门海关技术中心 | Fluorescent quantitative RT-PCR primer pair and probe for detecting Luo lake virus, kit and detection method |
| CN113755645B (en) * | 2021-09-30 | 2023-06-09 | 厦门海关技术中心 | Fluorescent quantitative RT-PCR primer pair and probe for detecting rochu virus, kit and detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107974515B (en) | 2021-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN107974515A (en) | A kind of constant temperature quick detection kit of Tilapia mossambica Luohu virus | |
| CN105525040A (en) | Real-time fluorescent RPA kit and test strip RPA kit for rapid detection of porcine type 2 circovirus and application of real-time fluorescent RPA kit and test strip RPA kit | |
| CN108220474A (en) | A kind of LAMP detection primer of Fusarium graminearum and its application | |
| CN107034309A (en) | The real-time fluorescence RPA kits of quick detection PRV, test strips RPA kits and application thereof | |
| AU2020104007A4 (en) | Rt-lamp detection primer group, kit and method for tilapia lake virus | |
| CN103320435B (en) | Listeria monocytogenes LAMP (loop-mediated isothermal amplification) detection kit containing internal standard | |
| CN105671210A (en) | LAMP technology-based primer, kit and detection method for detecting Plum pox virus | |
| CN107699635B (en) | Fluorescent RPA (reverse transcriptase amplification) detection method for porcine epidemic diarrhea virus | |
| CN104450961A (en) | Kit for detecting grass carp reovirus types I, II and III based on RT-LAMP visualization technology and method for detecting grass carp reovirus types I, II and III | |
| CN109439801B (en) | Real-time fluorescence RT-PCR detection kit and detection method for israel acute paralysis virus of bees | |
| CN107760802A (en) | Luohu virus-specific RT PCR detection kits and detection method | |
| CN103484568B (en) | Method and kit for dual fluorescence quantitative PCR detection of grass carp reovirus types I and II | |
| CN104031997B (en) | A kind of LAMP primer group for rapid detection ustilago scitaminea bacteria, test kit and detection method thereof | |
| CN106086211A (en) | LAMP primer group, test kit and the detection method of detection Flos Nelumbinis corruption pathogenic bacteria | |
| CN101178350B (en) | Detect the kit of rabies viruses | |
| CN112853004A (en) | LAMP detection degenerate primer group, kit and method for white spot syndrome virus | |
| CN106884056A (en) | Detect primer, kit and the method for zika virus | |
| CN104195270B (en) | The visual quick detection kit of white spot syndrome virus (WSSV) and detection method | |
| CN110964848A (en) | RAA amplification primer and probe for rapidly detecting carp herpesvirus II, detection kit and use method | |
| CN103937912B (en) | For detecting LAMP primer composition thing and the application thereof of infectious pancreas necrosis virus | |
| CN105779443B (en) | The Primer composition of identification or auxiliary identification oyster herpetovirus | |
| CN113718061B (en) | Primer set, kit and method for simultaneously detecting double RT-PCR of rochu virus and viral nervous necrosis virus | |
| RU2607025C1 (en) | Synthetic oligonucleotide primers and method for detecting rna atypical pestivirus of cattle |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |