CN107974515B - Constant-temperature rapid detection kit for tilapia lake Luo virus - Google Patents
Constant-temperature rapid detection kit for tilapia lake Luo virus Download PDFInfo
- Publication number
- CN107974515B CN107974515B CN201711204371.1A CN201711204371A CN107974515B CN 107974515 B CN107974515 B CN 107974515B CN 201711204371 A CN201711204371 A CN 201711204371A CN 107974515 B CN107974515 B CN 107974515B
- Authority
- CN
- China
- Prior art keywords
- primers
- kit
- detection
- constant
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a constant-temperature rapid detection kit for tilapia lake Roche virus, which comprises a constant-temperature fluorescence detection primer group for detecting Roche virus pathogen, wherein the constant-temperature fluorescence detection primer group comprises a pair of outer primers, a pair of inner primers and a pair of loop primers, the sequence of the outer primers is shown as SEQ ID NO. 1-SEQ ID NO. 2, the sequence of the inner primers is shown as SEQ ID NO. 3-SEQ ID NO. 4, and the sequence of the loop primers is shown as SEQ ID NO. 5-SEQ ID NO. 6. The detection kit disclosed by the invention is good in specificity and high in sensitivity, the lowest detection limit of a positive plasmid containing a tilapia lake Roche virus pathogen detection target gene can reach 1 fg/mu L, the detection time is short, a detection result can be obtained in about 45 minutes, the positive result can be obtained in about 10 minutes, and the detection time is saved by 3-4 hours compared with that of conventional PCR. The kit adopts a one-step reaction method, has strong anti-pollution capability and avoids aerosol pollution. The operation is convenient and fast, and the popularization is easy. The kit is safe to human and environment, and the raw material components and the product do not contain toxic substances.
Description
Technical Field
The invention belongs to the field of fish virus detection, and particularly relates to a monitoring and diagnosis technology for tilapia lake viruses.
Background
26 months and 5 months in 2017, the grain grower organizes global information and early warning system to issue special alarms: a very contagious disease is spreading in both farmed and wild tilapia. The causative agent responsible for the disease has now been identified as the "Luo Lake" Virus (Tilapia Lake Virus, TiLV). The Luo lake virus (TiLV) is a virus with strong infectivity, can cause the death of infected fish stocks in large quantity, and has the death rate of 80-90%. The roche virus was first reported in israel and ecuador in 2009 and later discovered an epidemic in 5 countries in three continents, including columbia, ecuador, egypt, israel and thailand. Since 2015, the virus had a large outbreak in thailand, belonging to the first case in asia. Tilapia is the second largest aquatic breed in the world, China is the first largest breeding country of Tilapia, and the yield accounts for about 40% of the total world yield, wherein Hainan province is the largest breeding province of Tilapia and accounts for 42% of the total national tilapia yield. 6, 13 months in 2017, the first virus epidemic situation of 'Luo lake' is confirmed in Taiwan area, and tilapia died greatly. From the current situation, the virus epidemic situation of the Luo lake is violent in coming, rapid in transmission, large in loss, severe in prevention and control situation, and obviously increased in risk of being introduced into China. Once the epidemic situation of the imported Luo lake virus is outbreaked, the tilapia breeding industry in China can be seriously created.
The main clinical symptoms of diseased tilapia infected with Luo lake virus are inappetence, slow swimming, skin injury and ulcer; histological lesions mainly occur in the brain, eyes and liver, and are manifested as cerebral edema and meningeal hemorrhage; the eye is obviously diseased, the crystalline lens is turbid in the early stage, and the crystalline lens is broken in the later stage; liver and kidney bleeding, enlarged spleen, etc., and can be transmitted from infected tilapia to non-infected tilapia. Research has shown that the virus is a novel virus similar to orthomyxovirus. The TiLV genome consists of 10 segments of negative strand RNA. Segment 1 is 1.641kb in maximum, and segments 2-10 are 1.471kb, 1.371kb, 1.250kb, 1.099kb, 1.044kb, 0.777kb, 0.657kb, 0.548kb and 0.465kb, respectively. Segment 1, which contains an open reading frame, has low similarity to the PB1 subunit of influenza C virus, and the other 9 segments have no similarity to other viruses. But 9 segments have conserved complementary sequences between the 5 'and 3' end sequences, which are similar to viruses of the orthomyxoviridae family. Nucleic acid of the virus can be detected in the liver and brain of the diseased fish, and moreover, the virus propagated in the cell culture solution can cause disease of disease-free tilapia. At present, the virus can also infect other fish species such as grass carp, yellow-head fish, channel catfish, flower body paramyxa and the like.
The detection of tilapia lake Luo virus molecules by using nested PCR, semi-nested PCR and quantitative PCR methods is generally reported at home and abroad. At present, few researches on the Luo lake virus detection method are carried out in China, and detection kits are less on the market. If the conventional detection method in foreign documents is applied to cultivation disease monitoring and entry-exit quarantine, the detection time is long, the workload is large, the subjectivity is strong, and the detection and the prevention of lake viruses are not facilitated. Meanwhile, the virus-carrying samples cannot be prevented from entering China in the aspect of border quarantine, potential disease information cannot be transmitted to related workers, and farmers are informed to take defense measures as soon as possible to limit the wide-range outbreak of the virus. Therefore, there is an urgent need to establish a rapid and sensitive TiLV detection technique.
In molecular biological detection techniques, the cyclic mediumA loop-mediated isothermal amplification (LAMP) technology is a novel isothermal nucleic acid amplification method, which mainly utilizes 4 different specific primers to identify 6 specific regions of a target gene, utilizes a DNA polymerase (Bst DNA polymerase) with strand displacement activity to rapidly amplify nucleic acid under a constant temperature condition (about 65 ℃), ensures high specificity and high efficiency of amplification, and can reach 10 within 1 hour9～1010Copies of the target sequence. The LAMP method has the advantages of simple operation, rapid detection, high sensitivity and specificity, low cost and the like, can complete detection without expensive instruments, and is widely applied to the fields of nucleic acid research, disease diagnosis, pathogen detection and the like. At present, the application of LAMP technology in the detection of tilapia lake Roche virus in the prior art is not seen
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide the constant-temperature fluorescence detection kit for tilapia lake viruses, which has the advantages of high sensitivity, strong specificity, simple and convenient operation and short detection time. Different from the conventional detection method reported in domestic and foreign documents, is beneficial to the monitoring and prevention of the Luo lake virus and the quarantine work of the entry and exit system.
In order to achieve the purpose, the invention is realized by the following technical scheme:
a constant-temperature rapid detection kit for tilapia lake Roche virus comprises a constant-temperature fluorescence detection primer group for detecting Roche virus pathogen, which consists of a pair of outer primers, a pair of inner primers and a pair of loop primers,
the sequences of one pair of outer primers are:
F3：GTACCAGCAGATTTGTAAGGT，
B3：CTATCACGTGCGTACTCG；
the sequences of a pair of inner primers are as follows:
FIP：CCACTCAATACGAGGCTTCGGCATCCTACGATGCTGAGC，
BIP：CCAGACTTGCGGACATATCCAACAGGCGAGGAACTTTGAG；
the sequences of the pair of loop primers are:
LF：TGGTAGTTCCAATAGCCGTTC，
LB：AGGCAATATGGATTCTTCGAGT。
the sequences of the outer primers are shown as SEQ ID NO. 1-SEQ ID NO. 2, the sequences of the inner primers are shown as SEQ ID NO. 3-SEQ ID NO. 4, and the sequences of the loop primers are shown as SEQ ID NO. 5-SEQ ID NO. 6.
In the kit, the kit further comprises DNA polymerase, reverse transcriptase, 2 × reaction buffer solution, fluorescent dye, sealing solution, standard positive template and negative control.
Preferably, in the kit, the molar ratio of the outer primer, the inner primer and the loop primer of the primer group in the kit is 1-2: 4-8: 2 to 4.
More preferably, in the above kit, the molar ratio of the outer primer, the inner primer and the loop primer of the primer set in the kit is 1: 4: 2.
preferably, in the above kit, the 2 × reaction buffer comprises buffer, betaine and dNTPs in a volume ratio of 10: 8: 7.
preferably, in the kit, the DNA polymerase is Bst DNA polymerase, the reverse transcriptase is AMV reverse transcriptase, the fluorescent dye is 0.02mM SYTO-9, and the sealing liquid is mineral oil.
Preferably, in the kit, the standard positive template is plasmid DNA containing a pathogen detection target gene of tilapia lake Roche Virus, and the negative control is sterilized ultrapure water.
More preferably, in the above kit, the reaction system of the kit comprises: the final concentrations of the primers F3, B3, FIP, BIP, LF and LB in the reaction system are respectively 0.2 muM, 0.8 muM, 0.4 muM, 2 Xreaction solution 12.5 muL, DNA polymerase 8U, reverse transcriptase 2U, 0.02mM SYTO-90.5 muL, 2 muL of the sample to be detected, and sterilized ultrapure water is added to 25 muL; the reaction system has the reaction condition of reacting for 45-60 min at 63 ℃ and lasting for 2min at 80 ℃.
The present invention judges the detection result based on the amplification curve. The amplification curve is S-shaped, the detection result is positive, namely the detection sample contains tilapia lake Rou virus pathogen; no S-shaped amplification curve appears, the detection result is negative, namely the detection sample does not contain Tilapia Roche virus pathogen.
Compared with the prior art, the constant-temperature fluorescence detection method for tilapia lake viruses provided by the invention has the following beneficial effects:
1. the specificity is good: the LAMP primers adopted by the invention are designed according to 5 different regions of the TilV fragment 3 gene, and a pair of primers with the strongest specificity is selected, so that the LAMP primers only have amplification effect on tilapia lake viruses.
2. The kit has high sensitivity, and the lowest detection limit can reach 1 fg/mu L for positive plasmids containing tilapia lake virus pathogen detection target genes.
3. The kit has short detection time, can obtain a detection result in about 45 minutes, and can obtain a positive result in 10 minutes at the fastest speed; compared with the conventional PCR, the method saves 3-4 hours.
4. The kit adopts a one-step reaction, the reverse transcription process and the amplification process are carried out in one reaction tube, the cover opening is not needed in the detection process and after the detection is finished, the anti-pollution capacity is strong, and the aerosol pollution is avoided.
5. The operation is convenient and fast: the detection kit disclosed by the invention is simple to operate, the result is visual and easy to judge, and the detection kit can be used by people without operation experience and is easy to popularize.
6. The kit is safe to human and environment, and the raw material components and the product do not contain toxic substances.
Description of the drawings:
FIG. 1 is a schematic diagram of a negative control repetitive result of the constant temperature fluorescence method in application example 1 for detecting Rou lake virus pathogen.
FIG. 2 is a diagram showing the result of positive control sensitivity for detecting Rou lake virus pathogen by the isothermal fluorescence method in application example 2.
FIG. 3 is a diagram showing the stability of positive control in the constant temperature fluorescence method of application example 3 for detecting Rou lake virus pathogen.
FIG. 4 is a diagram showing the results of the real samples for detecting Rou lake Virus pathogen by the isothermal fluorescence method in application example 4.
FIG. 5 is a diagram showing the results of the specificity of the real sample for detecting Rou lake virus pathogen by the isothermal fluorescence method in application example 5.
Detailed Description
The present invention will be described in further detail with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
Example 1
A constant temperature fluorescence detection kit for detecting Tilapia Roche virus pathogen comprises the following components: a group of LAMP primer groups for detecting the pathogen of the Luo lake virus, DNA polymerase, reverse transcriptase, 2 multiplied reaction buffer solution, fluorescent dye, sealing liquid, a standard positive template and negative control.
The LAMP primer group for detecting the Rou lake virus pathogen consists of an outer primer, an inner primer and a loop primer, 6 LAMP primers including the loop primer are designed by using Rou lake virus pathogen fragment 3 gene as a target gene and adopting primer design auxiliary software, the sequence of the outer primer is shown as SEQ ID NO. 1-SEQ ID NO. 2, the sequence of the inner primer is shown as SEQ ID NO. 3-SEQ ID NO. 4, and the sequence of the loop primer is shown as SEQ ID NO. 5-SEQ ID NO. 6.
F3：GTACCAGCAGATTTGTAAGGT，
B3：CTATCACGTGCGTACTCG。
FIP：CCACTCAATACGAGGCTTCGGCATCCTACGATGCTGAGC。
BIP：CCAGACTTGCGGACATATCCAACAGGCGAGGAACTTTGAG，
LF：TGGTAGTTCCAATAGCCGTTC，
LB：AGGCAATATGGATTCTTCGAGT。
The molar ratio of the outer primer to the inner primer to the loop primer is 1: 4: 2.
the 2 multiplied reaction buffer solution consists of buffer solution, betaine and dNTPs, and the volume ratio of each component is 10: 8: 7.
the DNA polymerase is Bst DNA polymerase, the reverse transcriptase is AMV enzyme, the fluorescent dye is 0.02mM SYTO-9, and the sealing liquid is mineral oil.
The standard positive template is plasmid DNA containing a Rou lake virus pathogen detection target gene, and the negative control is sterilized ultrapure water.
The reaction system of the kit comprises the following components: the final concentrations of the primers F3, B3, FIP, BIP, LF and LB in the reaction system are respectively 0.2 muM, 0.8 muM, 0.4 muM, 2 Xreaction solution 12.5 muL, DNA polymerase 8U, reverse transcriptase 2U, 0.02mM SYTO-90.5 muL, 2 muL of the sample to be detected, and sterilized ultrapure water is added to 25 muL;
the reaction system has the reaction condition of reacting for 45-60 min at 63 ℃ and lasting for 2min at 80 ℃.
Application example 1
The kit described in example 1 detects the repeatability of the negative control of lao lake pathogens:
1. preparing a template to be detected: a positive control and a negative control.
2. Loop-mediated isothermal amplification detection reaction system and conditions:
a25. mu.L reaction system contained: the final concentrations of the primers F3, B3, FIP, BIP, LF and LB in the reaction system are 0.2. mu.M, 0.8. mu.M, 0.4. mu.M, 2 Xreaction solution 12.5. mu.L, DNA polymerase 8U, reverse transcriptase 2U, 0.02mM SYTO-90.5. mu.L, 2. mu.L of the sample to be detected, and sterilized ultrapure water is added to 25. mu.L. The volume of the sealing liquid added was 20. mu.L. Wherein, the negative control is set for 20 times of paralleling, and the positive control is set for 2 times of paralleling.
And (3) uniformly mixing the prepared PCR tubes, centrifuging, reacting at 63 ℃ for 45-60 min, and continuing at 80 ℃ for 2 min.
3. And (3) judging a detection result: the reaction tube was placed in a fluorescent PCR apparatus (ABI step-one), and the detection result was judged from the amplification curve. The amplification curve is S-shaped, the detection result is positive, namely the detection sample contains the acute hepatopancreatic necrosis pathogen; no S-shaped amplification curve appears, the detection result is negative, namely the detection sample does not contain Rou lake virus pathogen.
As shown in fig. 1, the results show that: in the established kit for detecting the Rou lake virus pathogen by the constant temperature fluorescence method, negative control is repeatedly detected for 20 times without amplification.
Application example 2
The positive control sensitivity of the kit described in example 1 for detecting the pathogen of roche virus:
positive control plasmid DNA is subjected to 10-fold gradient dilution, eight gradient concentration DNAs of 1 ng/mu L, 100 pg/mu L, 10 pg/mu L, 1 pg/mu L, 100 fg/mu L, 10 fg/mu L, 1 fg/mu L and 0.1 fg/mu L are respectively used as a template and a negative control (sterilized ultrapure water), and a detection method is established according to the reaction system and conditions to determine the sensitivity of the kit.
As shown in fig. 2, the results show that: after the positive plasmid DNA is diluted by 10 times of gradient, the positive plasmid DNA with the concentration of 1 fg/mu L can be detected by the established constant-temperature fluorescence method detection kit for the Rou lake virus pathogen.
Application example 3
The kit described in example 1 detects the stability of the positive control of the pathogen of roche virus:
positive plasmids with the concentrations of 10 pg/mu L and 1 pg/mu L are taken as template DNAs, the positive plasmids are respectively arranged for 30 times in parallel, and a negative control (sterilized ultrapure water) is arranged to establish a detection method according to the reaction system and conditions so as to determine the stability of the kit.
As shown in FIG. 3, the results show that in the established constant temperature fluorescence detection kit for Rou lake Virus pathogens, two concentrations of positive plasmids are repeated for 30 times to perform detection experiments, the repeatability is good, and the Ct value variation coefficient is less than or equal to 5 percent, which proves that the kit has good stability.
Application example 4
The actual sample of the Rou lake Virus pathogen was tested using the kit described in example 1, with the following steps:
1. extraction of Luo lake virus RNA: grinding a sample to a uniform state, putting 500 mu L into a 1.5mL centrifuge tube, adding 500 mu L of normal saline, uniformly mixing, centrifuging for 2min at 10000rmp, putting 100 mu L of supernatant into a new 1.5mL centrifuge tube, adding 300 mu L of lysis solution, uniformly reversing, standing, lysing for 8min, adding 200 mu L of absolute ethyl alcohol, uniformly mixing by vortex, transferring into a nucleic acid collection assembly tube in a reagent box, centrifuging for 1min at 10000rmp, discarding filtrate, adding 400 mu L of washing solution (ethanol is confirmed to be added), centrifuging for 1min at 10000rmp, discarding filtrate, adding 400 mu L of washing solution, centrifuging for 1min at 10000rmp, discarding filtrate, leaving the 10000rmp empty for 3min, transferring the nucleic acid collection tube into a new 1.5mL centrifuge tube, adding 55 mu L of DEPC water, standing for 2min, centrifuging for 1min at 10000rmp, removing a column, covering, and finishing extraction and storing at-20 ℃ for later use.
2. The extracted RNA was detected according to the above reaction system and reaction conditions, and a negative control was set.
As shown in fig. 4, the results show that: the established constant-temperature fluorescence detection kit for the Rou lake virus pathogen is used for detection, a sample presents a typical S-shaped curve amplification, and the sample is proved to be detected with the Rou lake virus pathogen as a positive result.
Application example 5
The kit described in example 1 detects the actual sample specificity of the luo lake virus pathogen:
the method of application example 4 was used to detect RNA from samples containing Infectious Hematopoietic Necrosis Virus (IHNV), red spotted grouper nervous necrosis virus (RGNNV), grass carp hemorrhagic disease type II virus (GCRVII), Koi Herpesvirus (KHV), Grouper Iridovirus (GIV), cyprinivirus viremia of carp (SVCV) pathogenic nucleic acid, and Luo lake virus TiLV pathogen, respectively.
As shown in FIG. 5, the results show that only the sample containing Rou lake Virus pathogen shows an amplification curve, and the other samples are not amplified, which shows that the established isothermal fluorescence method detection kit for Rou lake Virus pathogen has good specificity.
Sequence listing
<110> Guangzhou double helix Gene technology, Inc
China's republic of people Guangzhou airport entry and exit inspection and quarantine bureau
Guangdong province aquatic animal epidemic disease prevention control center
<120> constant-temperature rapid detection kit for tilapia lake Luo virus
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 1
gtaccagcag atttgtaagg t 21
<210> 2
<211> 18
<212> DNA
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 2
ctatcacgtg cgtactcg 18
<210> 3
<211> 39
<212> DNA
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 3
ccactcaata cgaggcttcg gcatcctacg atgctgagc 39
<210> 4
<211> 40
<212> DNA
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 4
ccagacttgc ggacatatcc aacaggcgag gaactttgag 40
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 5
tggtagttcc aatagccgtt c 21
<210> 6
<211> 22
<212> DNA
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 6
aggcaatatg gattcttcga gt 22
Claims (8)
1. A constant-temperature rapid detection kit for tilapia lake Roche virus is characterized by comprising a constant-temperature fluorescence detection primer group for detecting Roche virus pathogen, which consists of a pair of outer primers, a pair of inner primers and a pair of loop primers,
the sequences of one pair of outer primers are:
F3：GTACCAGCAGATTTGTAAGGT，
B3：CTATCACGTGCGTACTCG；
the sequences of a pair of inner primers are as follows:
FIP：CCACTCAATACGAGGCTTCGGCATCCTACGATGCTGAGC，
BIP：CCAGACTTGCGGACATATCCAACAGGCGAGGAACTTTGAG；
the sequences of the pair of loop primers are:
LF：TGGTAGTTCCAATAGCCGTTC，
LB：AGGCAATATGGATTCTTCGAGT。
2. the constant-temperature rapid detection kit according to claim 1, wherein the molar ratio of the outer primer, the inner primer and the loop primer of the primer group in the kit is 1-2: 4-8: 2 to 4.
3. The kit for rapid detection at constant temperature according to claim 2, wherein the molar ratio of the outer primer, the inner primer and the loop primer of the primer group in the kit is 1: 4: 2.
4. the isothermal rapid assay kit of claim 1, further comprising DNA polymerase, reverse transcriptase, 2 x reaction buffer, fluorescent dye, sealing solution, standard positive template and negative control.
5. The isothermal rapid detection kit according to claim 4, wherein the 2 x reaction buffer comprises buffer, betaine and dNTPs, and the volume ratio of the buffer, the betaine and the dNTPs is 10: 8: 7.
6. the isothermal rapid assay kit according to claim 4, wherein the DNA polymerase is Bst DNA polymerase, the reverse transcriptase is AMV reverse transcriptase, the fluorescent dye is 0.02mM SYTO-9, and the sealing liquid is mineral oil.
7. The constant-temperature rapid detection kit according to claim 4, wherein the standard positive template is plasmid DNA containing a pathogen detection target gene of tilapia lake Roche virus, and the negative control is sterilized ultrapure water.
8. The constant-temperature rapid detection kit according to claim 1, wherein the reaction system of the kit comprises the following components: the final concentrations of the primers F3, B3, FIP, BIP, LF and LB in the reaction system are respectively 0.2 muM, 0.8 muM, 0.4 muM, 2 Xreaction solution 12.5 muL, DNA polymerase 8U, reverse transcriptase 2U, 0.02mM SYTO-90.5 muL, 2 muL of the sample to be detected, and sterilized ultrapure water is added to 25 muL; the reaction system has the reaction condition of reacting for 45-60 min at 63 ℃ and lasting for 2min at 80 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711204371.1A CN107974515B (en) | 2017-11-27 | 2017-11-27 | Constant-temperature rapid detection kit for tilapia lake Luo virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711204371.1A CN107974515B (en) | 2017-11-27 | 2017-11-27 | Constant-temperature rapid detection kit for tilapia lake Luo virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107974515A CN107974515A (en) | 2018-05-01 |
| CN107974515B true CN107974515B (en) | 2021-05-14 |
Family
ID=62011785
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711204371.1A Active CN107974515B (en) | 2017-11-27 | 2017-11-27 | Constant-temperature rapid detection kit for tilapia lake Luo virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107974515B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592268A (en) * | 2018-06-13 | 2019-12-20 | 杭州众测生物科技有限公司 | RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV) |
| CN109234451B (en) * | 2018-09-26 | 2021-04-16 | 中国水产科学研究院长江水产研究所 | Tilapia parvovirus TiPV CPA detection primer and application thereof |
| CN113755645B (en) * | 2021-09-30 | 2023-06-09 | 厦门海关技术中心 | Fluorescent quantitative RT-PCR primer pair and probe for detecting rochu virus, kit and detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106456737A (en) * | 2014-02-13 | 2017-02-22 | 以色列州农业和农村发展部基姆伦兽医研究所 | Tilapia lake virus vaccines |
-
2017
- 2017-11-27 CN CN201711204371.1A patent/CN107974515B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106456737A (en) * | 2014-02-13 | 2017-02-22 | 以色列州农业和农村发展部基姆伦兽医研究所 | Tilapia lake virus vaccines |
Non-Patent Citations (1)
| Title |
|---|
| Detection of Tilapia Lake Virus in Clinical samples by culturing and nested reverse transcription-PCR;Japhette Esther Kembou Tsofack et al.;《Journal of Clinical Microbiology》;20161214;第55卷(第3期);摘要部分、第764页倒数第1段以及第766页第2段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107974515A (en) | 2018-05-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111733283B (en) | Triple fluorescence PCR detection kit for infectious spleen and kidney necrosis virus, largemouth black bass virus and mandarin fish rhabdovirus | |
| CN107974515B (en) | Constant-temperature rapid detection kit for tilapia lake Luo virus | |
| CN109762942B (en) | Internal reference-containing double isothermal nucleic acid amplification method for rapidly detecting respiratory syncytial virus | |
| CN107955839A (en) | For detecting double PCR primer, detection method and the kit of 3 type of porcine circovirus 2 type and circovirus | |
| CN109439801B (en) | Real-time fluorescence RT-PCR detection kit and detection method for israel acute paralysis virus of bees | |
| CN112301168B (en) | TaqMan real-time fluorescent quantitative RT-PCR kit and method for detecting largemouth black bass double RNA virus | |
| CN107190103B (en) | Multiplex PCR primer group, kit and method for simultaneously detecting three fish viruses | |
| CN112853004A (en) | LAMP detection degenerate primer group, kit and method for white spot syndrome virus | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN109371110B (en) | LAMP (loop-mediated isothermal amplification) detection kit for bacterial canker pathogen of poplar | |
| CN107523627B (en) | LAMP kit for detecting acute hepatopancreas necrosis pathogen | |
| CN113234862B (en) | African swine fever virus LAMP detection primer group and kit | |
| CN106868222B (en) | LAMP primer for detecting silkworm binary densovirus and kit thereof | |
| CN113718061B (en) | Primer set, kit and method for simultaneously detecting double RT-PCR of rochu virus and viral nervous necrosis virus | |
| CN110592269A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type 2 virus (GCRV-2) | |
| CN114196786A (en) | Poultry adenovirus type 4 and 8 dual fluorescent quantitative PCR rapid detection kit and method | |
| CN115094164A (en) | Multiple qPCR (quantitative polymerase chain reaction) kit and detection method for ASFV (advanced specific immunodeficiency syndrome) with different gene deletion types | |
| CN108018377B (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer group, kit and method for Luo lake virus | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus | |
| CN108315487B (en) | Primer group and kit for detecting eel herpesvirus and application of primer group and kit | |
| CN111304364A (en) | Primer and probe combination for detecting avian influenza virus, kit and detection method | |
| CN112195257A (en) | Primer group, reagent, kit and detection method for detecting vibrio parahaemolyticus | |
| CN110578018B (en) | LAMP (loop-mediated isothermal amplification) method for rapidly detecting nuclear polyhedrosis virus | |
| CN110894551A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type I virus (GCRV-I) | |
| CN114480737B (en) | FAdV-4 NP strain specific primer and application thereof in recombinase-mediated isothermal nucleic acid amplification detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |