CN112011632A - RPA detection primer group, kit and method for polymyxin drug-resistant gene mcr-4 - Google Patents
RPA detection primer group, kit and method for polymyxin drug-resistant gene mcr-4 Download PDFInfo
- Publication number
- CN112011632A CN112011632A CN202010981014.1A CN202010981014A CN112011632A CN 112011632 A CN112011632 A CN 112011632A CN 202010981014 A CN202010981014 A CN 202010981014A CN 112011632 A CN112011632 A CN 112011632A
- Authority
- CN
- China
- Prior art keywords
- mcr
- detection
- rpa
- drug
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses an RPA detection primer group, a kit and a method of a polymyxin drug-resistant gene mcr-4. Relates to the technical field of molecular biology. Comprises 1 pair of primers and 1 probe, and provides a detection kit, a detection method of non-diagnostic treatment and application of a primer group. The invention only needs a fluorescence detection instrument with a temperature control function, and can carry out quick, real-time, sensitive, accurate and convenient detection on mcr-4 at the temperature of 39 ℃.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to an RPA detection primer group, a kit and a method of a polymyxin drug resistance gene mcr-4.
Background
Polymyxin is a polycation polypeptide drug, has good curative effect on infection caused by gram-negative drug-resistant bacteria, and is particularly used as the last line of defense drugs in the treatment of Carbapenem-resistant enterobacteriaceae (bacteria of Carbapenem-resistant enterobacteriaceae, CRE) and other super drug-resistant bacteria. In 2016, the plasmid-mediated polymyxin drug resistance gene mcr-1 was discovered and demonstrated to be horizontally transferred between different strains, which has attracted extensive attention all over the world. The annual increase of the use amount of polymyxin in medical clinic, animal husbandry and agriculture and unreasonable medication situation pose serious threats to public health safety and animal husbandry development. At present, other genes of the mcr gene family (mcr-2-8) are also reported successively. The existing research shows that the detection rate of mcr-1, mcr-2 and mcr-3 genes is higher in China, and the detection rate of mcr-4 genes is lower. The detection method mostly adopts the methods of conventional PCR, Sanger sequencing, fluorescent quantitative PCR, LAMP and the like. Some of these techniques are time consuming and labor intensive, some have low sensitivity, and some require the use of large precision instruments. Further confirms the existence condition of the mcr-4 gene in livestock and poultry breeding in China, and is worthy of further research.
Therefore, how to provide a method for detecting the drug resistance gene mcr-4 of polymyxa is a problem which needs to be solved urgently by the technical personnel in the field.
Disclosure of Invention
In view of the above, the invention provides an RPA detection primer group, a kit and a method of a polymyxin drug resistance gene mcr-4.
Recombinase Polymerase Amplification (RPA) techniques rely primarily on three enzymes: a recombinase capable of binding single-stranded nucleic acids, a single-stranded DNA binding protein (SSB), and a strand-displacing DNA polymerase. The mixture of these three enzymes is also active at ambient temperature, with an optimal reaction temperature of about 37 ℃. The principle is as follows: the recombinase, in combination with the primer, forms a protein-DNA complex that is able to search for homologous sequences in double-stranded DNA. Once the primers locate the homologous sequences, strand exchange reaction formation occurs and DNA synthesis is initiated, and the target region on the template is exponentially amplified. The replaced DNA strand binds to SSB, preventing further replacement. In this system, a single synthesis event is initiated by two opposing primers. The entire process is carried out very quickly and detectable levels of amplification product are typically obtained within ten minutes.
The key to the analysis of RPA is the design of amplification primers and probes. It should be noted that unlike PCR primers, RPA primers are longer than typical PCR primers, typically requiring up to 30-38 bases; when the RPA primer is designed, the denaturation temperature is no longer a key factor influencing the amplification primer; the primer and probe design of the RPA is not mature like the traditional PCR, and the optimization needs to be carried out by probing conditions by self.
The invention verifies the sensitivity and specificity of detection and successfully detects the mcr-4 nucleic acid in the strain to be detected.
In order to achieve the purpose, the invention adopts the following technical scheme:
an RPA detection primer group of polymyxin drug-resistant gene mcr-4 comprises 1 pair of primers and 1 probe, wherein the primers and the probes are as follows:
mcr-4-F1：5’-CCTCGCCGTGCTAATGCTCAAGACACAGTGATT-3’，SEQ ID NO 1；
mcr-4-R3：5’-AGCAATACTTGGTCAAAACAATATTGGCCAGAA-3’，SEQ ID NO 2；
probe mcr-4-probe: 5'-TCATAGTGGTATAAAAGTACAGTGGTTTATAATGATTCTGGCTC-3', SEQ ID NO 3;
wherein, thymine T with 27bp of base number away from the 5' end is marked by FAM fluorescent group; inserting tetrahydrofuran molecules between T with the base number of 28bp separated from the 5' end and A with the base number of 29 bp; the T with the base number of 15bp away from the 3' end is marked by a fluorescence quenching group BHQ.
The probe mcr-4-probe can be expressed as: 5 '-TCATAGTGGTATAAAAGTACAGTGGT [ FAM-dT ] T [ THF ] A [ BHQ-dT ] AATGATTCTGGCTC-3';
by referring to the sequence of the colistin-resistant gene mcr-4 in GenBank, a specific conserved region is selected, a large number of RPA primers are designed, and finally a set of primer and probe combination capable of quickly and effectively detecting the component of the colistin-resistant gene mcr-4 is screened out. The pair of primers is used for rapid amplification and real-time fluorescence detection.
The invention also provides a detection kit based on the primer group, which comprises: freeze-dried powder, deionized water, polyethylene glycol, 10 mu mol/L mcr-4-F1, 10 mu mol/L mcr-4-R3, 10 mu mol/L probe and 280mmol/L magnesium acetate solution.
Preferably: the freeze-dried powder comprises the following components: 11. mu.g of 220 ng/. mu.L recombinase RecA, 0. mu.g of 200 ng/. mu.L single-stranded DNA binding protein gp 3210. mu.g, 5. mu.g of 100 ng/. mu.L DNA polymerase IKlenow, 3.5. mu.g of 70 ng/. mu.L helper protein uvsY, 4. mu.g of 80 ng/. mu.L exonuclease exoIII, 1mg of 3% polyethylene glycol, 0.12mg of 30mM Tris, 0.49mg of 120mM potassium acetate, 0.05mg of 3mM ATP, 0.51mg of 50mM creatine phosphate disodium, 250. mu.M 275. mu.M dNTP, 2.5mg of 6% sucrose and 1mg of 30% glycerol were prepared by freeze-drying.
The freeze-drying conditions are as follows: pre-freezing for 3-4 hours at-80 ℃, putting the pre-frozen product into a vacuum freeze dryer to dry for 2-10 hours at-20 to-45 ℃ and finally drying for 1-2 hours at 10-18 ℃. Obtaining the freeze-dried powder.
Preferably: the reaction system is 50 mu L, and the freeze-dried powder is mixed with 28.4 mu L of deionized water, 12.5 mu L of polyethylene glycol, 10 mu mol/L of mcr-4-F12 mu L, 10 mu mol/L of mcr-4-R32 mu L, 10 mu mol/L of probe 0.6 mu L, 2 mu L of template DNA and 2.5 mu L of 280mmol/L magnesium acetate solution.
The invention also provides a RPA detection method of the non-diagnosis-purpose polymyxa drug-resistant gene mcr-4, which comprises the following steps:
(1) extracting DNA of a sample to be detected as a template;
(2) the primer group or the kit is used for rapid amplification and real-time fluorescence detection.
Preferably: the amplification procedure was: reacting at constant temperature of 39 ℃ for 20 min.
Preferably: the detection equipment is an RPA amplification detector or a fluorescent quantitative PCR instrument.
The invention also provides application of the primer group in preparation of a kit for detecting the polymyxa drug-resistant gene mcr-4.
According to the technical scheme, compared with the prior art, the invention discloses the RPA detection primer group, the kit and the method for the polymyxin drug resistance gene mcr-4, and the technical effects are that the detection primer group provided by the invention enables mcr-4 to generate specific fluorescent signals, and the mcr-1, mcr-2 and mcr-3 genes to generate no specific fluorescent signals, so that the good specificity is realized. Diluting the positive template to 106～100And copy/. mu.L, a good specific fluorescent signal appears, which indicates that the kit has higher sensitivity.
The RPA (isothermal amplification) detection method of the colistin drug-resistant gene mcr-4, which is established by the invention, combines the advantages of good repeatability, high sensitivity, short detection time of the isothermal amplification method and the like of the fluorescence PCR, and has high sensitivity with the detection limit value of 1 copy/mu L; the detection time is 20min, which is only half of the LAMP detection method and one third of the fluorescence PCR method. Only a fluorescence detection instrument with a temperature control function is needed, and mcr-4 can be quickly, sensitively, accurately and conveniently detected in real time at the temperature of 39 ℃.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.
FIG. 1 is a schematic diagram of primer screening provided by the present invention, wherein a is an amplification curve of F1 and R3 primer pairs; b: f2, R2 primer pair amplification curve; c, F1 and R2 primer pair amplification curves; d, F2 and R1 primer pair amplification curves; f2 and R3 primer pair amplification curves; f, F3, R1 primer pair amplification curve; g, F1 and R1 primer pair amplification curves; h, F3 and R2 primer pair amplification curves; i, F3 and R3 primer pair amplification curves.
FIG. 2 is a schematic diagram of the specific detection provided by the present invention, wherein a is an amplification curve using pUC-mcr-4 as a template; b. and c and d are amplification curves using pUC-mcr-1, pUC-mcr-2 and pUC-mcr-3 as templates, and 3 lines are fitted to form one line.
FIG. 3 is a schematic diagram of the sensitivity detection provided by the present invention, wherein a is a template 106Copy/. mu.L amplification curve; b the template is 105Copy/. mu.L amplification curve c template 104Copy/. mu.L amplification curve; d, the template is 103The amplification curve of (1); e the template is 102Copy/. mu.L amplification curve; f. the form is 101Copy/. mu.L amplification Curve g template 100Copy/. mu.L amplification curve; h is a template of 10-1Copy/. mu.L amplification curve.
FIG. 4 is a schematic diagram of the detection of Escherichia coli provided by the present invention, wherein a is an amplification curve of sample MF 1; b, an amplification curve of the sample MF 2; c, an amplification curve of the sample MF 3; d, an amplification curve of the sample MF 4; e, negative control.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The embodiment of the invention discloses an RPA detection primer group, a kit and a method of a polymyxin drug-resistant gene mcr-4.
The raw materials or reagents involved in the examples are all common commercial products, and the operations involved are all conventional operations in the field unless otherwise specified, such as:
primary reagent
Nucleic acid extraction kit and plasmid DNA small-scale extraction kit, which are purchased from QIAGEN (QIAGEN) bioengineering Co., Ltd
Main instrument
CFX96 fluorescent quantitative PCR instrument, product of Berle.
The biological material samples MF1, MF2, MF3 and MF4 are all strains carrying the target gene mcr-4 screened by a conventional screening method, are only used for control, and can be strains with the known same similar target gene mcr-4.
Example 1
Synthesis and copy number determination of mcr-4 and other colistin drug-resistant gene recombinant plasmids
The mcr-4 gene sequence information was determined from the mcr-4 reference sequence (NG _057471.1) in the GenBank database, synthesized from the Huada gene and cloned into the pUC vector, designated pUC-mcr-4, the pUC-mcr-4 plasmid was transformed into competent cell DH 5. alpha. and after overnight culture the plasmid was extracted and the concentration was determined.
Three drug-resistant gene sequences of mcr-1(MF084991.1), mcr-2(NG _051171.1) and mcr-3(NG _055505.1) with similar sequences are selected as a control according to the classification status, the transverse transmission mode and the genetic relationship of adjacent drug-resistant genes of colistin drug-resistant gene plasmids, and the control plasmids of pUC-mcr-1, pUC-mcr-2 and pUC-mcr-3 are synthesized and cloned by Huada genes.
The copy number of recombinant plasmids such as pUC-mcr-4 was calculated according to the following formula: copy number (copy/. mu.L) ═ 6.02X 1023X plasmid concentration (ng/. mu.L). times.10-9/(number of plasmid bases × 660).
Example 2
RPA primer (Probe) set design
Comparing the mcr-4 gene sequence in GenBank with mcr-1, mcr-2 and mcr-3 nucleic acid sequences by reference, selecting specific conserved region, multiple groups of probes and primer pairs, and screening 1 probe, 3 upstream primers in the upstream region of the probe and 3 downstream primers in the downstream region of the probe by preliminary screening. Both probes and primers were synthesized by Shanghai (tables 1 and 2).
Determination of optimal primer pairs
All the primers are arranged and combined to obtain 9 groups of amplification primer pairs, multiple comparison experiments are carried out according to the template concentration of 10 copies/. mu.L, and the optimal primer is judged according to indexes such as peak starting time, repeatability and the like. As can be seen from FIG. 1, mcr-4-F1 and mcr-4-R3 have early peak times and good amplification effect. And repeated alignment experiments show that the primer pair has stable amplification effect (the amplification sequence is CCTCGCCGTGCTAATGCTCAAGACACAGTGATTGATGTGTTAAGTCATAGTGGTATAAAAGTACAGTGGTTTGATAATGATTCTGGCTGTAAAGGTGTGTGTGATCGGGTTGAAAATCTCACGATAGATTTGAAGAGTGATCCGAAGCTGTGTTCTGGCCAATATTGTTTTGACCAAGTATTGCT, SEQ ID NO 4; the optimal primer groups are mcr-4-F1, mcr-4-R3 and mcr-4-probe) according to which the mcr-4-F1 and the mcr-4-R3 are judged to be the optimal amplification primers.
TABLE 1
| Primer name | Primer sequence (5'-3') |
| mcr-4-F1 | CCTCGCCGTGCTAATGCTCAAGACACAGTGATT，SEQ ID NO1； |
| mcr-4-F2 | CTAATGCTCAAGACACAGTGATTGATGTGTTAA，SEQ ID NO5； |
| mcr-4-F3 | CTATGATCCTCGCCGTGCTAATGCTCAAGACA，SEQ ID NO6； |
| mcr-4-R1 | AACACAGCTTCGGATCACTCTTCAAATCTAT，SEQ ID NO7； |
| mcr-4-R2 | TATTGGCCAGAACACAGCTTCGGATCACTCTT，SEQ ID NO8； |
| mcr-4-R3 | AGCAATACTTGGTCAAAACAATATTGGCCAGAA，SEQ ID NO2； |
TABLE 2
Note: wherein, thymine T with 27bp of base number away from the 5' end is marked by FAM fluorescent group; inserting tetrahydrofuran molecules between T with the base number of 28bp separated from the 5' end and A with the base number of 29 bp; the T with the base number of 15bp away from the 3' end is marked by a fluorescence quenching group BHQ.
Example 3
A method for detecting RPA of a drug-resistant gene mcr-4 of non-diagnostic objective polymyxa bacteria comprises the following steps:
(1) extracting DNA (or total DNA) of a sample to be detected as a template;
(2) the optimal primer set selected in the example 2 is subjected to rapid amplification and real-time fluorescence detection.
The reaction system is 50 mu L, and freeze-dried powder and deionized water are mixed by 28.4 mu L, polyethylene glycol is 12.5uL, 10 mu mol/L mcr-4-F12 mu L, 10 mu mol/L mcr-4-R32 mu L, 10 mu mol/L probe is 0.6 mu L, template DNA is 2 mu L, and 280mmol/L magnesium acetate solution is 2.5 mu L.
See table 3 for the composition of the lyophilized powder, the lyophilization method is: pre-freezing for 3-4 hours at-80 ℃, drying in a vacuum freeze dryer after pre-freezing, drying for 2-10 hours at-20 to-45 ℃, and finally drying for 1-2 hours at 10-18 ℃ to prepare freeze-dried powder for later use.
TABLE 3 Freeze-dried powder reaction Unit composition
| Components | Dosage of |
| Recombinase RecA (220 ng/. mu.L) | 11μg |
| Single-stranded DNA binding protein gp32(200 ng/. mu.L) | 10μg |
| DNA polymerase IKLenow (100 ng/. mu.L) | 5μg |
| Helper protein uvsY (70 ng/. mu.L) | 3.5μg |
| Exonuclease exoIII (80 ng/. mu.L) | 4μg |
| Polyethylene glycol (3%) | 1mg |
| Tris(30mM) | 0.12mg |
| Potassium acetate (120mM) | 0.49mg |
| ATP(3mM) | 0.05mg |
| Creatine phosphate disodium salt (50mM) | 0.51mg |
| dNTP(275μM) | 250μM |
| Sucrose (6%) | 2.5mg |
| Glycerol (30%) | 1mg |
The amplification procedure was: reacting at constant temperature of 39 ℃ for 20 min.
And (3) after fully and uniformly mixing, placing the reaction test tube in a CFX96 fluorescent quantitative PCR instrument for real-time fluorescent amplification, and reacting at the constant temperature of 39 ℃ for 20min (for template DNA with low copy number, taking out the reaction tube after 4min, uniformly mixing again, and centrifuging for 3-5 s).
Positive samples will show a significant amplification curve, while negative control samples will show no amplification curve.
Control experiment 1
The specificity of the primers and the probe was determined by the fluorescent signal of the RPA detection using pUC-mcr-4, pUC-mcr-1, pUC-mcr-2 and pUC-mcr-3 as the template, respectively (the detection method was the same as in example 3). As a result, only pUC-mcr-4 showed a specific fluorescent signal, indicating that the method had good specificity (see FIG. 2).
Control experiment 2
pUC-mcr-4 was diluted 10-fold to a final concentration of 106～10-1Copy/. mu.L, and take it as the template to do RPA reaction (same as example 3), and determine the lowest detection concentration of the method, namely the sensitivity of mcr-4 fluorescence RPA method. (see FIG. 3) the results of the assay showed good sensitivity for the RPA detection method with a limit of 1 copy/. mu.L.
Example 4
The primers, probes and reagents of the invention are used for detecting actual samples. See table 4 for actual sample conditions.
TABLE 4 actual sample information
The genomic DNA of the actual samples in Table 4 was extracted using QIAGEN blood/cell/tissue genomic DNA extraction kit according to the protocol. The extracted DNA is detected by adopting the primer, the probe and the reagent. (see FIG. 4) the results show that the samples MF1, MF2, MF3 and MF4 all have fluorescence signals generated, which proves that the detection results of the primers, the probes and the reagents of the invention on the actual samples are consistent with the known results.
According to the invention, a pair of RPA primers and a fluorescence detection probe capable of effectively detecting a target fragment are designed according to an mcr-4 conserved gene sequence. Through verification, the mcr-4 fluorescent RPA detection method can specifically detect an mcr-4 nucleic acid sequence, the detection limit value is 1 copy/mu L, the result can be obtained within 20min, and effective technical support can be provided for the detection and judgment of the mcr-4 drug-resistant gene.
Example 5
A detection kit based on the optimal primer set screened in example 2 comprises: lyophilized powder (see Table 3 in example 3), polyethylene glycol, 10. mu. mol/L mcr-4-F1, 10. mu. mol/L mcr-4-R3, 10. mu. mol/L probe and 280mmol/L magnesium acetate solution.
The operation steps are as follows:
mixing the freeze-dried powder with 28.4 mu L of deionized water, 12.5 mu L of polyethylene glycol, 10 mu mol/L of mcr-4-F12 mu L, 10 mu mol/L of mcr-4-R32 mu L, 0.6 mu L of 10 mu mol/L probe, 2 mu L of template DNA and 2.5 mu L of 280mmol/L magnesium acetate solution.
Mixing, centrifuging, placing the mixture into a fluorescent instrument with a temperature control function, and setting the temperature to be 39 ℃; the fluorescence signal intensity was measured every 20 seconds for a total of 60 times and 20 min.
And after the reaction is finished, judging whether the sample is positive according to the fluorescence intensity curve.
The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> Shandong province veterinary drug quality control institute (Shandong province animal product quality testing center)
<120> RPA detection primer group, kit and method of polymyxin drug-resistant gene mcr-4
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cctcgccgtg ctaatgctca agacacagtg att 33
<210> 2
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
agcaatactt ggtcaaaaca atattggcca gaa 33
<210> 3
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tcatagtggt ataaaagtac agtggtttat aatgattctg gctc 44
<210> 4
<211> 185
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cctcgccgtg ctaatgctca agacacagtg attgatgtgt taagtcatag tggtataaaa 60
gtacagtggt ttgataatga ttctggctgt aaaggtgtgt gtgatcgggt tgaaaatctc 120
acgatagatt tgaagagtga tccgaagctg tgttctggcc aatattgttt tgaccaagta 180
ttgct 185
<210> 5
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctaatgctca agacacagtg attgatgtgt taa 33
<210> 6
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ctatgatcct cgccgtgcta atgctcaaga ca 32
<210> 7
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
aacacagctt cggatcactc ttcaaatcta t 31
<210> 8
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tattggccag aacacagctt cggatcactc tt 32
Claims (8)
1. An RPA detection primer group of polymyxin drug-resistant gene mcr-4 is characterized by comprising 1 pair of primers and 1 probe, wherein the primers and the probes are as follows:
mcr-4-F1：5’-CCTCGCCGTGCTAATGCTCAAGACACAGTGATT-3’，SEQ ID NO 1；
mcr-4-R3：5’-AGCAATACTTGGTCAAAACAATATTGGCCAGAA-3’，SEQ ID NO 2；
probe mcr-4-probe: 5'-TCATAGTGGTATAAAAGTACAGTGGTTTATAATGATTCTGGCTC-3', SEQ ID NO 3;
wherein, thymine T with 27bp of base number away from the 5' end is marked by FAM fluorescent group; inserting tetrahydrofuran molecules between T with the base number of 28bp separated from the 5' end and A with the base number of 29 bp; the T with the base number of 15bp away from the 3' end is marked by a fluorescence quenching group BHQ.
2. A detection kit based on the primer set of claim 1, comprising: freeze-dried powder, deionized water, polyethylene glycol, 10 mu mol/L mcr-4-F1, 10 mu mol/L mcr-4-R3, 10 mu mol/L probe and 280mmol/L magnesium acetate solution.
3. The test kit of claim 2, wherein the lyophilized powder is composed of: 11. mu.g of 220 ng/. mu.L recombinase RecA, 0. mu.g of 200 ng/. mu.L single-stranded DNA binding protein gp 3210. mu.g, 5. mu.g of 100 ng/. mu.L DNA polymerase IKlenow, 3.5. mu.g of 70 ng/. mu.L helper protein uvsY, 4. mu.g of 80 ng/. mu.L exonuclease exoIII, 1mg of 3% polyethylene glycol, 0.12mg of 30mM Tris, 0.49mg of 120mM potassium acetate, 0.05mg of 3mM ATP, 0.51mg of 50mM creatine phosphate disodium, 250. mu.M 275. mu.M dNTP, 2.5mg of 6% sucrose and 1mg of 30% glycerol were prepared by freeze-drying.
4. The detection kit of claim 3, wherein the reaction system is 50 μ L, and the lyophilized powder is mixed with 28.4 μ L of deionized water, 12.5 μ L of polyethylene glycol, 10 μmol/L of mcr-4-F12 μ L, 10 μmol/L of mcr-4-R32 μ L, 10 μmol/L of probe 0.6 μ L, 2 μ L of template DNA and 2.5 μ L of 280mmol/L magnesium acetate solution.
5. A method for detecting RPA of a drug-resistant gene mcr-4 of non-diagnostic objective polymyxa, which is characterized by comprising the following steps:
(1) extracting DNA of a sample to be detected as a template;
(2) the primer group of claim 1 or the kit of claim 2 or 3 is used for rapid amplification and real-time fluorescence detection.
6. The method for detecting the RPA of the polymyxa drug-resistance gene mcr-4 of non-diagnostic interest according to claim 5, wherein the amplification procedure is: reacting at constant temperature of 39 ℃ for 20 min.
7. The method for detecting the RPA of the polymyxa drug-resistant gene mcr-4 of non-diagnostic interest according to claim 6, wherein the detection device is an RPA amplification detector or a fluorescent quantitative PCR instrument.
8. The use of the primer set of claim 1 in the preparation of a kit for detecting the polymyxa drug-resistance gene mcr-4.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010981014.1A CN112011632A (en) | 2020-09-17 | 2020-09-17 | RPA detection primer group, kit and method for polymyxin drug-resistant gene mcr-4 |
| ZA2021/04727A ZA202104727B (en) | 2020-09-17 | 2021-07-07 | Rpa detection primer set, kit and method for polymyxin drug-resistant gene mcr-4 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010981014.1A CN112011632A (en) | 2020-09-17 | 2020-09-17 | RPA detection primer group, kit and method for polymyxin drug-resistant gene mcr-4 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112011632A true CN112011632A (en) | 2020-12-01 |
Family
ID=73522949
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010981014.1A Pending CN112011632A (en) | 2020-09-17 | 2020-09-17 | RPA detection primer group, kit and method for polymyxin drug-resistant gene mcr-4 |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN112011632A (en) |
| ZA (1) | ZA202104727B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112877409A (en) * | 2021-02-01 | 2021-06-01 | 常州市疾病预防控制中心 | RPA reagent and device for detecting antibiotic resistance gene and detection method thereof |
| CN115786549A (en) * | 2022-10-31 | 2023-03-14 | 宁波大学 | Primer and probe sequence for detecting tigecycline drug-resistant gene tet (X) RPA and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107937612A (en) * | 2017-12-21 | 2018-04-20 | 北京卓诚惠生生物科技股份有限公司 | A kind of primer, probe and kit for detecting Marburg virus |
| CN108754000A (en) * | 2018-06-11 | 2018-11-06 | 中国农业大学 | Drug resistant gene mcr-4/5/8 fluorescent quantitative PCR detection methods |
| WO2019178188A1 (en) * | 2018-03-13 | 2019-09-19 | Microinvestigate, Llc | Direct-to-consumer genomic diagnostic device |
| CN110643687A (en) * | 2019-11-19 | 2020-01-03 | 深圳市艾伟迪生物科技有限公司 | SRDA (sequence-related amplified deoxyribonucleic acid) isothermal nucleic acid amplification kit and application thereof |
-
2020
- 2020-09-17 CN CN202010981014.1A patent/CN112011632A/en active Pending
-
2021
- 2021-07-07 ZA ZA2021/04727A patent/ZA202104727B/en unknown
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107937612A (en) * | 2017-12-21 | 2018-04-20 | 北京卓诚惠生生物科技股份有限公司 | A kind of primer, probe and kit for detecting Marburg virus |
| WO2019178188A1 (en) * | 2018-03-13 | 2019-09-19 | Microinvestigate, Llc | Direct-to-consumer genomic diagnostic device |
| CN108754000A (en) * | 2018-06-11 | 2018-11-06 | 中国农业大学 | Drug resistant gene mcr-4/5/8 fluorescent quantitative PCR detection methods |
| CN110643687A (en) * | 2019-11-19 | 2020-01-03 | 深圳市艾伟迪生物科技有限公司 | SRDA (sequence-related amplified deoxyribonucleic acid) isothermal nucleic acid amplification kit and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| 孙祖越: "《药物生殖与发育毒理学》", 31 January 2015 * |
| 孙赫等: "多黏菌素耐药基因的变异特征及传播规律的研究现状 ", 《畜牧兽医学报》 * |
| 杜亚楠等: "重组酶聚合酶扩增技术的研究进展及其应用", 《上海农业学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112877409A (en) * | 2021-02-01 | 2021-06-01 | 常州市疾病预防控制中心 | RPA reagent and device for detecting antibiotic resistance gene and detection method thereof |
| CN115786549A (en) * | 2022-10-31 | 2023-03-14 | 宁波大学 | Primer and probe sequence for detecting tigecycline drug-resistant gene tet (X) RPA and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| ZA202104727B (en) | 2021-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| WO2022033331A1 (en) | Kit and method for detecting nucleic acid and uses thereof | |
| WO2020243978A1 (en) | Primer for specific detection of human source genomic dna and application thereof | |
| CN110106285B (en) | Internal reference-containing dual isothermal nucleic acid amplification method for rapidly detecting 3-type human adenovirus | |
| CN114085903B (en) | Primer pair probe combination product for detecting mitochondria 3243A & gtG mutation, kit and detection method thereof | |
| CN105039586A (en) | Primer and kit for detecting duck type-II adenovirus | |
| CN112011632A (en) | RPA detection primer group, kit and method for polymyxin drug-resistant gene mcr-4 | |
| CN111534514A (en) | Novel coronavirus detection kit based on Crisper | |
| CN111286559A (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN110408727B (en) | CPA primer group for detecting J subgroup avian leukosis virus, CPA nucleic acid test strip kit and application thereof | |
| CN110157837B (en) | Primer and method for detecting peste des petits ruminants virus and bluetongue virus | |
| CN101768636A (en) | Composition and kit for detecting vibrio cholerae and detection method | |
| WO2023216707A1 (en) | Universal preclinical bio-distribution detection kit for nk cell therapy products | |
| CN111996272A (en) | RPA detection primer group, kit and method for drug-resistant gene mcr-8 | |
| CN116042926B (en) | Visual rapid detection method for peste des petits ruminants virus nucleic acid and kit thereof | |
| CN112575119A (en) | RPA primer, probe, kit and detection method for rapidly detecting avian leukosis virus J subgroup | |
| CN111793717A (en) | Specific primer pair, probe and kit for detecting novel coronavirus | |
| CN108998576B (en) | Specific primer pair, probe and detection kit for detecting spring carp virus | |
| CN111996271A (en) | RPA detection primer group, kit and method for drug-resistant gene NDM-1 of superbacteria | |
| CN110878337A (en) | Detection method of erysipelothrix rhusiopathiae, primers and probe thereof | |
| CN113136438B (en) | Nucleic acid molecule, PCR primer pair and kit for detecting trichomonas fowl beta-tubulin gene | |
| CN106148483B (en) | Primer and method for detecting escherichia coli cell DNA | |
| CN109182599A (en) | For detect the specific primer of grass carp hemorrhage virus to, probe, detection kit | |
| CN112941211A (en) | Multiplex fluorescence quantitative PCR detection kit for streptococcus suis type 2 virulence genes and detection method thereof | |
| CN112011631A (en) | RPA detection primer group, kit and method for drug-resistant gene sul2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210729 Address after: 250109 4566 Tangye West Road, Licheng District, Jinan City, Shandong Province Applicant after: Shandong livestock product quality and Safety Center (Shandong livestock and poultry slaughtering Technology Center) Address before: 250022 No. 4566, Tangye West Road, Tangye street, Licheng District, Jinan City, Shandong Province Applicant before: SHANDONG VETERINARY DRUG QUALITY EXAMINATION INSTITUTE (SHANDONG ANIMAL PRODUCT QUALITY TESTING CENTER) |
|
| TA01 | Transfer of patent application right |