CN117144053B - Aspergillus fumigatus detection primer set, kit and application thereof - Google Patents

Aspergillus fumigatus detection primer set, kit and application thereof Download PDF

Info

Publication number
CN117144053B
CN117144053B CN202311401969.5A CN202311401969A CN117144053B CN 117144053 B CN117144053 B CN 117144053B CN 202311401969 A CN202311401969 A CN 202311401969A CN 117144053 B CN117144053 B CN 117144053B
Authority
CN
China
Prior art keywords
primer
aspergillus fumigatus
kit
detection
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202311401969.5A
Other languages
Chinese (zh)
Other versions
CN117144053A (en
Inventor
李翔
陈海琴
李婷婷
陈冬冬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu Mics Medical Technology Co ltd
Original Assignee
Jiangsu Mics Medical Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Mics Medical Technology Co ltd filed Critical Jiangsu Mics Medical Technology Co ltd
Priority to CN202311401969.5A priority Critical patent/CN117144053B/en
Publication of CN117144053A publication Critical patent/CN117144053A/en
Application granted granted Critical
Publication of CN117144053B publication Critical patent/CN117144053B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/66—Aspergillus
    • C12R2001/68—Aspergillus fumigatus
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides an aspergillus fumigatus detection primer set, a kit and application thereof, belongs to the technical field of fungus detection, and solves the problem of inaccurate aspergillus fumigatus detection in the prior art. The aspergillus fumigatus detection primer group provided by the invention has high sensitivity and strong specificity, and the detection limit is as low as 500copies/mL, thereby being beneficial to early screening and early diagnosis of aspergillus fumigatus infection and being convenient for timely intervention treatment and disease control. The kit for detecting aspergillus fumigatus provided by the invention adopts a isothermal amplification-nucleic acid colloidal gold chromatography method, can complete detection reaction within 35min, and has simple and convenient result judgment; the kit provided by the invention has low single detection cost and low requirements on instruments and equipment, is suitable for basic medical units, can perform home self-test, and is beneficial to early diagnosis of fungal infection.

Description

Aspergillus fumigatus detection primer set, kit and application thereof
Technical Field
The invention relates to the technical field of fungus detection, in particular to an aspergillus fumigatus detection primer group, a kit and application thereof.
Background
Aspergillus fumigatusAspergillus fumigatus) The aspergillus is a saprophytic fungus widely existing in the nature, can generate a large amount of conidia to diffuse into the air for wide spread, and enters the body through respiratory tract or wound to cause infection, thus causing great harm to human health. Aspergillus fumigatus-induced diseases mainly include invasive Aspergillus diseases, chronic pulmonary aspergillosis, aspergillus swelling, and allergic diseases such as asthma and allergic bronchopulmonary aspergillosis, of which invasive aspergillosis (Invasive aspergillosis, IA) is the most serious. Whereas, of the systemic infections caused by aspergillus, about 90% are caused by aspergillus fumigatus. Researches show that the early diagnosis rate of patients with invasive fungal infection death is only 12% -60%, and the failure to accurately diagnose and actively treat the patients is caused by invasive fungal infectionThe main factor of high mortality. Therefore, the development of an early diagnosis method for aspergillus fumigatus infection is a precondition for targeted treatment of fungal infection, and has important significance for reducing the mortality rate of fungal infection.
According to the "laboratory diagnostic methods for invasive mycoses clinical application expert consensus" (2022 edition), the current clinical tests for invasive mycoses can be divided into two categories, histological and microbiological tests. Although the histological examination can directly obtain pathogenic bacteria at an infection site, the culture step is still needed when the pathogenic bacteria load is low, the time consumption is long, and the method is not suitable for early diagnosis. In microbiological examination, direct microscopic examination has the problems of false negative, low sensitivity and the like. Fungus culture identification also has the problem of low positive rate and takes longer time. The G test and GM test in serological tests are widely used for early screening and continuous detection of aspergillus infections, but in the presence of false positives.
The existing aspergillus fumigatus detection method based on the molecular biology method is poor in specificity, and the flow is mostly dependent on a specific detection instrument, so that convenience is lacking, for example, the method for detecting aspergillus fumigatus by using the fluorescent quantitative PCR technology disclosed in Chinese patent CN108707691A and CN109811079A is poor, but the technology depends on the operation of the fluorescent detection instrument and professionals. Chinese patent CN113335731a discloses that, although a detection technology based on RPA and CRISPR is used, a higher detection sensitivity is obtained, the result still needs the assistance of a fluorescence detection instrument during interpretation, which is not beneficial to the convenience of detection, and the above technical schemes have risks of false positive and inaccurate detection.
Disclosure of Invention
The invention aims to provide an aspergillus fumigatus detection primer group, a kit and application thereof, so as to solve the problem of inaccurate aspergillus fumigatus detection in the prior art.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides an aspergillus fumigatus detection primer group, which comprises the following primers:
a primer AF F3 with a nucleotide sequence shown as SEQ ID NO. 1;
a primer AF FIP with a nucleotide sequence shown as SEQ ID NO. 2;
the nucleotide sequence is shown as a primer AF LF shown as SEQ ID NO. 3;
the nucleotide sequence is shown as a primer AF BIP shown in SEQ ID NO. 4;
the nucleotide sequence is shown as a primer AF LB shown in SEQ ID NO. 5;
the nucleotide sequence is shown as a primer AF B3 shown in SEQ ID NO. 6.
Preferably, the 5' end of the primer AF FIP is marked with a fluorescent group;
the 5' end of the primer AF LB is marked with biotin.
Preferably, the fluorophore is FAM or FITC.
The invention also provides application of the aspergillus fumigatus detection primer group in preparation of a kit for detecting aspergillus fumigatus.
The invention also provides a kit for detecting aspergillus fumigatus, which comprises a detection reagent and the aspergillus fumigatus detection primer group.
Preferably, the final concentration of the primer AF FIP in the kit is 1.6-2.4 mu mol/L;
the final concentration of the primer AF BIP in the kit is 1.6-2.4 mu mol/L.
Preferably, the detection reagent comprises isothermal amplification buffer, dNTPs and Bst DNA polymerase.
Preferably, the isothermal amplification buffer comprises Tris-HCl, (NH) 4 ) 2 SO 4 、KCl、MgSO 4 And Tween-20.
Preferably, the kit further comprises a colloidal gold immunochromatographic test strip.
Preferably, the colloidal gold immunochromatographic test strip comprises a bottom plate, a sample pad, an interpretation area and a water absorption pad; the sample pad, the interpretation area and the water absorption pad are sequentially arranged on the bottom plate; the interpretation area is sequentially provided with a detection line and a quality control line;
FAM antibodies are coated in the detection line, and the concentration of the FAM antibodies is 0.05-0.15 mg/mL;
the quality control line is coated with a biotin-BSA solution, and the concentration of the biotin-BSA solution is 1.5-3 mg/mL.
The invention has the beneficial effects that:
the aspergillus fumigatus detection primer group provided by the invention has high sensitivity and strong specificity, and the detection limit is as low as 500copies/mL, thereby being beneficial to early screening and early diagnosis of aspergillus fumigatus infection and being convenient for timely intervention treatment and disease control.
The kit for detecting aspergillus fumigatus provided by the invention adopts a isothermal amplification-nucleic acid colloidal gold chromatography method, can complete detection reaction within 35min, and has simple and convenient result judgment; the kit provided by the invention has low single detection cost and low requirements on instruments and equipment, is suitable for basic medical units, can perform home self-test, and is beneficial to early diagnosis of deep fungal infection.
Drawings
FIG. 1 is a graph of the repeated detection results of the present invention;
FIG. 2 is a graph showing the results of the specific assay of the present invention.
Detailed Description
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. In case of conflict, the present specification, definitions, will control.
As used herein, the term "prepared from …" is synonymous with "comprising. The terms "comprising," "including," "having," "containing," or any other variation thereof, as used herein, are intended to cover a non-exclusive inclusion.
The conjunction "consisting of …" excludes any unspecified element, step or component. If used in a claim, such phrase will cause the claim to be closed, such that it does not include materials other than those described, except for conventional impurities associated therewith. When the phrase "consisting of …" appears in a clause of the claim body, rather than immediately following the subject, it is limited to only the elements described in that clause; other elements are not excluded from the stated claims as a whole.
When an equivalent, concentration, or other value or parameter is expressed as a range, preferred range, or a range bounded by a list of upper preferable values and lower preferable values, this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value, regardless of whether ranges are separately disclosed. For example, when ranges "1 to 5" are disclosed, the described ranges should be construed to include ranges "1 to 4", "1 to 3", "1-2 and 4-5", "1-3 and 5", and the like. When a numerical range is described herein, unless otherwise indicated, the range is intended to include its endpoints and all integers and fractions within the range.
The invention provides an aspergillus fumigatus detection primer group, which comprises the following primers:
a primer AF F3 with a nucleotide sequence shown as SEQ ID NO. 1;
a primer AF FIP with a nucleotide sequence shown as SEQ ID NO. 2;
the nucleotide sequence is shown as a primer AF LF shown as SEQ ID NO. 3;
the nucleotide sequence is shown as a primer AF BIP shown in SEQ ID NO. 4;
the nucleotide sequence is shown as a primer AF LB shown in SEQ ID NO. 5;
a primer AF B3 with a nucleotide sequence shown as SEQ ID NO. 6;
the target of the primer group is in the aspergillus fumigatus genomeANXC4The 543 to 762 nucleic acid sequences of the coding region (CDS).
In the present invention, the 5' end of the primer AF FIP is preferably labeled with a fluorescent group, and the fluorescent group is preferably FAM or FITC; the 5' end of the primer AF LB is marked with biotin.
The invention also provides application of the aspergillus fumigatus detection primer group in preparation of a kit for detecting aspergillus fumigatus, and the kit for detecting aspergillus fumigatus is preferably a kit adopting a isothermal amplification principle.
The invention also provides a kit for detecting aspergillus fumigatus, which comprises a detection reagent and the aspergillus fumigatus detection primer group, wherein the final concentration of the primer AF FIP in the kit is preferably 1.6-2.4 mu mol/L, more preferably 1.8-2.2 mu mol/L, the final concentration of the primer AF BIP in the kit is preferably 1.6-2.4 mu mol/L, more preferably 1.8-2.2 mu mol/L, the final concentration of the primer AF F3 in the kit is preferably 0.1-0.3 mu mol/L, more preferably 0.15-0.25 mu mol/L, the final concentration of the primer AF LB in the kit is preferably 0.5-0.8 mu mol/L, more preferably 0.6-0.7 mu mol/L, the final concentration of the primer AF B3 in the kit is preferably 0.1-0.3 mu mol/L, more preferably 0.15-0.2 mu mol/L, more preferably 0.25 mu mol/L, and the final concentration of the primer AF LB in the kit is preferably 0.5-0.8 mu mol/L.
In the present invention, the detection reagent preferably comprises an isothermal amplification buffer, preferably comprising Tris-HCl, (NH), dNTP and Bst DNA polymerase 4 ) 2 SO 4 、KCl、MgSO 4 And Tween-20, wherein the concentration of Tris-HCl in the kit is preferably 15-18 mmol/L, and more preferably 16-17 mmol/L; in the kit (NH) 4 ) 2 SO 4 The final concentration of KCl in the kit is preferably 7 to 9mmol/L, more preferably 7.5 to 8.5mmol/L, the final concentration of KCl in the kit is preferably 11 to 13mmol/L, more preferably 11.5 to 12.5mmol/L, and the MgSO in the kit 4 The final concentration of Tween-20 in the kit is preferably 1-3 mmol/L, more preferably 1.5-2.5 mmol/L, the final concentration of dNTP in the kit is preferably 0.06-0.1%, more preferably 0.07-0.09%, the final concentration of dNTP in the kit is preferably 0.55-0.65 mmol/L, more preferably 0.58-0.62 mmol/L, and the final enzyme activity of Bst DNA polymerase in the kit is preferably 0.2-0.3U/mL, more preferably 0.24-0.28U/mL.
In the present invention, the method of using the kit preferably comprises the steps of: (1) extracting DNA of a sample to be detected by adopting a genome DNA extraction kit; (2) reagent configuration: preparing a reaction system by taking 1.5mL centrifuge tubes (DNase/RNase-Free, sterilization), adding isothermal amplification PCR reaction liquid and primer mixed liquid, carrying out vortex oscillation for 10 seconds, centrifuging for standby, and sub-packaging 20 mu L/tube into the PCR reaction tubes (sterile and DNase/RNase-Free); (3) sample adding: transferring 10 mu L of the extracted nucleic acid into each PCR reaction tube, covering a tube cover, centrifuging, and transferring to a PCR detection area; (4) and (3) PCR amplification: and placing the PCR reaction tube into a sample tank for isothermal amplification, reacting for 30min at 60 ℃ to obtain a sample amplification product, and determining whether the sample amplification product contains 543-762 nucleic acid sequences of an ANXC4 coding region (CDS) in an aspergillus fumigatus genome, so as to obtain whether the sample contains aspergillus fumigatus.
In the invention, the kit also preferably comprises a colloidal gold immunochromatographic test strip, wherein the colloidal gold immunochromatographic test strip preferably comprises a bottom plate, a sample pad, an interpretation area and a water absorption pad; the sample pad, the interpretation area and the water absorption pad are sequentially arranged on the bottom plate; the interpretation area is sequentially provided with a detection line and a quality control line; the read zone preferably comprises a conjugate pad and a nitrocellulose membrane; the sample pad, the bonding pad, the nitrocellulose membrane and the water absorbing pad are sequentially overlapped with each other in a staggered manner to form a strip shape and then are adhered to a bottom plate, and the bottom plate is a PVC plate; the binding pad is sprayed with a streptavidin marked tracer marker, the tracer marker is nano particles comprising colloidal gold, latex microspheres and fluorescent microspheres, a C line (quality control line) and a T line (detection line) are sequentially arranged on a nitrocellulose membrane from absorbent paper to the binding pad, a biotin-BSA solution is coated in the C line region, and FAM antibodies are coated in the T line region. The concentration of the biotin-BSA solution is preferably 1.5-3 mg/mL, the concentration of the FAM antibody is preferably 0.05-0.15 mg/mL, and the FAM antibody is preferably a rabbit anti-FAM antibody; in the invention, the test strip is assembled into the shell to prepare the detection card.
The detection principle of the test strip provided by the invention is as follows: the label marker marked by streptavidin is sprayed on the binding pad in the interpretation area, the label marker is nano particles including colloidal gold, latex microspheres and fluorescent microspheres, a biotin-BSA is coated on a C line of a nitrocellulose membrane, and a rabbit anti-FAM antibody is coated on a T line; meanwhile, when the double-chain amplification product with FITC/FAM and biotin marks flows through the test strip, the double-chain amplification product can be recognized and captured by specific antibodies on the colloidal gold labeled antibody and nitrocellulose membrane, a red strip is formed in a corresponding T line area (detection line), unbound colloidal gold labeled antibody is chromatographed to a C line area (quality control line) along with buffer solution, and specific antigens fixed on the membrane are recognized and captured to form the red strip, so that quality control of the test strip is completed.
Result determination criteria:
the C line shows red line, and the T line shows red line, which indicates that the detected sample is positive;
the C line shows red line, and the T line does not show red line, which indicates that the detected sample is negative;
the C line has no red line indicating a test card failure.
In the invention, the kit is also provided with a conventional DNA extraction kit, a chromatographic buffer solution, and more than five standby disposable pipettes and reaction tubes; the loop-mediated isothermal amplification reaction solution, the primer mixture and the chromatographic buffer solution are placed in independent reaction tubes for aseptic sealing.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
Taking the 543 rd to 762 th positions of an ANXC4 coding region (CDS) in an aspergillus fumigatus genome as a specific detection target for detecting aspergillus fumigatus, designing a primer group according to a target region sequence, wherein the nucleotide sequence of the primer group is as follows (the sequences are 5'to 3'):
primer AF F3: TCCAGTTATGTCCGGGGC, shown in SEQ NO.1, is located at positions 543-560 on the ANXC4 CDS region;
primer AF FIP: TGGGATGATGACCGGGAATGTCCTCCAGCCAAGCACGATT, shown as SEQ NO.2, is composed of two CDS separated fragments, and is respectively positioned at 575 th to 592 th and 622 th to 643 th positions on the CDS;
primer AF LF: ATGACGGGAACGCGACG, shown in SEQ NO.3, at positions 593-609 of the CDS region;
primer AF BIP: CAGTTCCAGTATGCCATGCCGTCGGTGCAGATGATGTCGG, shown in SEQ NO.4, consists of two fragments spaced apart on the CDS at positions 661-682 and 715-732, respectively, on the CDS;
primer AF LB: ACAGTATGGCCAATTCCAGCCT, shown in SEQ NO.5, at positions 684-705 of the CDS region;
primer AF B3: ACACTCTGGAATGGGGGC, SEQ NO.6, at positions 745-762 of the CDS region;
wherein, the 5 'end of the primer AF FIP is marked with FAM group, and the 5' end of the primer AF LB is marked with biotin.
Example 2
The difference from example 1 is only that the 5 '-end of the primer AF FIP is labeled with FITC group and the 5' -end of the primer AF LB is labeled with biotin.
Example 3
Preparing the components of the kit: the method comprises the steps of mixing the primer combination in the embodiment 1, loop-mediated isothermal amplification reaction liquid and a nucleic acid colloidal gold detection card;
the loop-mediated isothermal amplification reaction solution comprises: 2.5. Mu.L of 10 Xisothermal amplification buffer, 1.4. Mu.L of dNTPs (25 mmol/L), 1. Mu.L of Bst DNA polymerase (8000U/mL).
10 Xisothermal amplification buffer is prepared from Tris-HCl, (NH) 4 ) 2 SO 4 、KCl、MgSO 4 The mixture ratio of the components in the reaction system is as follows:
primer AF F3: 0.2. Mu. Mol/L;
primer AF FIP: 1.6. Mu. Mol/L;
primer AF LF: 0.67. Mu. Mol/L;
primer AF BIP: 1.6. Mu. Mol/L;
primer AF LB: 0.67. Mu. Mol/L;
primer AF B3: 0.2. Mu. Mol/L;
dNTP：0.58mmol/L；
Tris-HCl：16.67mmol/L；
(NH 4 ) 2 SO 4 ：8.33mmol/L；
KCl：12.5mmol/L；
MgSO 4 ：1.67mmol/L；
Tween-20：0.08%；
bst polymer: 0.27U/mL.
Nucleic acid colloidal gold detection cards are commercially available, for example, from Jiangsu Hunting Biotechnology Inc., under the accession number HDu.
Example 4
Extracting DNA of a sample to be detected by adopting a genome DNA extraction kit;
reagent configuration: the experiment was performed by selecting the kit of example 3, preparing a reaction system by using a 1.5mL centrifuge tube (DNase/RNase-Free, sterilization), adding a mixed solution of a loop-mediated isothermal amplification PCR reaction solution and a primer, performing vortex oscillation for 10 seconds, centrifuging for standby, and sub-packaging 20 mu L/tube into the PCR reaction tube (sterile and DNase/RNase-Free).
Sample adding: the extracted nucleic acid was transferred to each PCR reaction tube by 10. Mu.L, the tube cap of the reaction tube was closed, and transferred to the PCR detection zone after centrifugation.
And (3) PCR amplification: the PCR reaction tube was placed in an isothermal amplification sample tank and reacted at 60℃for 30min.
Preparing a detection card: the test card was removed from the aluminum foil bag and placed on a dry horizontal table top.
Sample adding detection: 20 mu L of sample amplification product is taken into a sample adding hole of a detection card by using a liquid transfer device, 100 mu L of chromatographic buffer solution is added, and the result is read within 2 minutes.
Result determination criteria:
the C line shows red line, and the T line shows red line, which indicates that the detected sample is positive;
the C line shows red line, and the T line does not show red line, which indicates that the detected sample is negative;
the C line has no red line indicating a test card failure.
Example 5
The difference from example 3 was only that the final concentration of the primer AF FIP in the reaction system was replaced with 2.4. Mu. Mol/L.
Example 6
The difference from example 3 was only that the final concentration of the primer AF BIP in the reaction system was replaced with 2.4. Mu. Mol/L.
Example 7
The difference from example 3 was only that the final concentration of primer AF FIP in the reaction system was replaced with 2.4. Mu. Mol/L and the final concentration of primer AF BIP was replaced with 2.4. Mu. Mol/L.
Experimental example 1
The primers shown in example 1 were used for Aspergillus fumigatus standard bacteria in the same manner as in example 4Plant @Aspergillus fumigatusPurchased from the american type ATCC collection, no. ATCC 1022 DQ), the concentration of the Aspergillus fumigatus sample was about 5000 copies/mL, and the test was repeated 10 times, and the test results are shown in FIG. 1.
As can be seen from FIG. 1, the results of 10 tests are positive to Aspergillus fumigatus and the color development is uniform, which indicates that the combination of the invention has good detection consistency.
Experimental example 2 detection sensitivity of Aspergillus fumigatus detection kit
Aspergillus fumigatus is preparedAspergillus fumigatusSamples to be tested, prepared at concentrations of 2500copies/mL, 1000 copies/mL, 500copies/mL, 250 copies/mL and 100 copies/mL, purchased from the American type ATCC accession number ATCC 1022 DQ), were tested according to the method of example 4, each gradient was tested 5 times repeatedly, the results were recorded, and the results were shown in Table 1 below (positive for "+", negative for "-") with the sample concentration at all tested times as the limit of detection:
TABLE 1 sensitivity test results
As a result, 2500copies/mL, 1000 copies/mL and 500copies/mL were all detected, and 250 copies/mL and 100 copies/mL were detected with a probability. Therefore, the detection limit of the combined reagent for aspergillus fumigatus is 500copies/mL, and the sensitivity is high, so that the combined reagent can be used for aspergillus fumigatus nucleic acid detection.
Experimental example 3 specificity of Aspergillus fumigatus detection kit
Aspergillus fumigatus purchased from American ATCCAspergillus fumigatusAF, no. ATCC 1022DQ, aspergillus flavus @ and method for preparing the sameAspergillus flavusAFla, no. ATCC 9643DQ, aspergillus nigerAspergillus nigerAN, no. ATCC 1015 DQ), aspergillus oryzaeAspergillus oryzaeAO, no. ATCC 1011), aspergillus nidulansAspergillus nidulansANi, no. ATCC 10074), cryptococcus neoformansCryptococcus neoformans，CN，No.ATCC32045 Cryptococcus garvieae @, gCryptococcus gattiCG, no. atcc MYA-4562), yersinia pneumosporePneumocystis jiroveciiPJ, no. ATCC MYA-5006 SD), streptococcus pneumoniaeStreptococcus pneumoniaeSP, no. ATCC 49619DQ, staphylococcus aureusStaphylococcus aureusSA, no. ATCC 29213), pertussisBordetella pertussisBP, no. ATCC 9797DQ, haemophilus influenzaeHaemophilus influenzaeHI, no. ATCC 51907 DQ), candida albicansCandida albicansCA, no. ATCC 10231DQ, candida parapsilosisCandida parapsilosisCP, no. atcc 22019 DQ), candida tropicalisCandida tropicalisCT, no. ATCC 66029 DQ) and Saccharomyces cerevisiaeSaccharomyces cerevisiaeA total of 16 samples were subjected to a specificity test by SC, no. ATCC MYA-4941 DQ). The concentration of each sample to be tested was 2500copies/mL and was measured as in example 4.
As shown in FIG. 2, in the detection results of 16 samples, only Aspergillus fumigatus is positive, and the rest are negative, which shows that the combination of the invention can eliminate the interference of different pathogens and accurately detect Aspergillus fumigatus.
Experimental example 4 comparison of different primer sets
Primer combinations (nucleotide sequences and modification modes) are key factors influencing the detection capability of a nucleic acid detection platform, and the primer combinations used are required to have higher specificity and sensitivity, so that the preference of the primer combinations is particularly important. In the development stage of the kit, comparison of different primer combinations and different modification modes is carried out.
The invention designs the following alternative primers (the sequences are all 5'to 3'):
aspergillus fumigatus alternative primer combination 1 nucleic acid sequence located at positions 561-768 of the ANXC4 CDS region, specifically:
the AF F3-1 primer is positioned in 561-578 positions on the CDS region, and the sequence is: GCTCAATGGTGCTCCTCC, as shown in SEQ NO. 7;
the AF FIP-1 primer is formed by combining two fragments which are separated on CDS, and the fragments are respectively positioned at 597-614 and 643-663 positions on the CDS, and the sequences are as follows: CTGTCCGGGTCTGGCATAGCT-GCGTTCCCGTCATGCTTC as shown in SEQ NO. 8;
AF LF-1 primer is located at 622-642 th bit of CDS region, and has the sequence: GGGATGATGACCGGGAATGTC, as shown in SEQ NO. 9;
the AF BIP-1 primer is similar to the FIP-1 primer and also consists of two fragments which are spaced on the CDS, and are respectively positioned at 666-686 and 729-746 on the CDS, and the sequence is as follows: CCAGTATGCCATGCCGTCACA-GCCCAATTTGACTGCGGT as shown in SEQ NO. 10;
AF LB-1 primer is located at 687-707 th position on CDS region, and the sequence is: GTATGGCCAATTCCAGCCTAG, as shown in SEQ NO. 11;
the AF B3-1 primer is located at 749-768 positions on the CDS region. The sequence is as follows: TCGTTCACACTCTGGAATGG, as shown in SEQ NO. 12;
aspergillus fumigatus alternative primer combination 2 is located in the 384-578 nucleic acid sequence of the ANXC4 CDS region, in particular:
the AF F3-2 primer is positioned at 384-403 th position on the CDS region, and the sequence is GCCAAATCTTCGACCAGTGA, as shown in SEQ NO. 13;
the AF FIP-2 primer is formed by combining two fragments which are separated on CDS, and the fragments are respectively positioned at the 404 th site to the 422 th site and the 464 th site to the 483 th site on the CDS, and the sequences are CAGATCGCTAGGCGCATCGC to CGTATGAGAGTCCCTCGGA, as shown in SEQ NO. 14;
AF LF-2 primer is located in 425-446 th position of CDS region, and has sequence TCGTCCGTATCTGAGTAGGAGT as shown in SEQ NO. 15;
the AF BIP-2 primer is similar to the FIP primer, and also consists of two fragments which are spaced on the CDS, are respectively positioned at 497-517 and 538-557 on the CDS, and have the sequence of ACGGATACAGAAAGCCAGCGC-CCGGACATAACTGGACCATC as shown in SEQ NO. 16;
the AF B3-2 primer is located in 561-578 position on CDS region, and has sequence GGAGGAGCACCATTGAGC as shown in SEQ NO. 17.
Wherein, the concentration of the F3 primer and the B3 primer in each alternative primer combination reaction system is 0.2 mu mol/L, FIP primer and the concentration of the BIP primer are 1.6 mu mol/L, and the concentration of the LF primer (if any) and the LB primer (if any) are 0.67 mu mol/L; the other components and concentrations in the reaction system were the same as in example 3.
A comparison scheme for binding different modification sites on the basis of example 1, comprising:
example 1 (primer AF FIP 5 'labeled FAM group, primer AF LB 5' labeled biotin);
alternative modification scheme 1 (primer AF FIP 5 'end labeled FAM group, primer AF LF 5' end labeled biotin);
alternative modification scheme 2 (primer AF FIP 5 'labeled FAM group, primer AF BIP 5' labeled biotin).
The aspergillus fumigatus standard strain is used as a sample to be tested, and the results are shown in table 2:
table 2 detection results of combinations of primers
The results showed that the detection limit of each of the alternative modification scheme 1, the alternative modification scheme 2, the alternative primer set 1 and the alternative primer set 2 was 1000 copies/mL. In conclusion, the detection limit of the combination is the lowest, and the sensitivity is the highest.
Experimental example 5 comparison of the different primer concentrations
In view of the fact that the primer concentrations of FIP and BIP in the LAMP reaction system have a large influence on the detection sensitivity, different concentration detection comparison experiments of FIP and BIP are performed on the primer set of the invention so as to obtain optimal reaction concentrations, and the concentrations of the primer FIP and the primer BIP are adjusted on the basis of example 3, as shown in the following table 3:
TABLE 3 experiment set of different primer concentrations
Each combination was tested using Aspergillus fumigatus standard strain (500 copies/mL) as test sample, and the test was repeated 10 times, and the test method was the same as in example 4, and the results are shown in Table 4:
TABLE 4 detection results of different primer concentrations
As is clear from Table 4, in the case of combinations 5, 6, 8 and 9, that is, in which the FIP and BIP concentrations in the reaction system were not lower than 1.6. Mu. Mol/L, 500copies/mL of the A.fumigatus standard strain could be stably detected, and therefore, the FIP and BIP primer concentrations in the reaction system were set to 1.6. Mu. Mol/L in view of the cost of the reagents.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (9)

1. An aspergillus fumigatus detection primer set, which is characterized by comprising the following primers:
a primer AF F3 with a nucleotide sequence shown as SEQ ID NO. 1;
a primer AF FIP with a nucleotide sequence shown as SEQ ID NO. 2;
the nucleotide sequence is shown as a primer AF LF shown as SEQ ID NO. 3;
the nucleotide sequence is shown as a primer AF BIP shown in SEQ ID NO. 4;
the nucleotide sequence is shown as a primer AF LB shown in SEQ ID NO. 5;
the nucleotide sequence is shown as a primer AF B3 shown in SEQ ID NO. 6.
2. The aspergillus fumigatus detection primer set according to claim 1, wherein the 5' end of the primer AF FIP is labeled with a fluorescent group;
the 5' end of the primer AF LB is marked with biotin.
3. The aspergillus fumigatus detection primer set according to claim 2, wherein the fluorescent group is FAM or FITC.
4. Use of the aspergillus fumigatus detection primer set according to any one of claims 1-3 in the preparation of a kit for detecting aspergillus fumigatus.
5. A kit for detecting aspergillus fumigatus, which is characterized by comprising a detection reagent and the aspergillus fumigatus detection primer set according to any one of claims 1 to 3.
6. The kit for detecting aspergillus fumigatus according to claim 5, wherein the final concentration of the primer AF FIP in the kit is 1.6-2.4 mu mol/L;
the final concentration of the primer AF BIP in the kit is 1.6-2.4 mu mol/L.
7. The kit for detecting aspergillus fumigatus according to claim 5, wherein the detection reagent comprises isothermal amplification buffer, dNTP and Bst DNA polymerase.
8. The kit for detecting aspergillus fumigatus according to claim 7, wherein the isothermal amplification buffer comprises Tris-HCl, (NH) 4 ) 2 SO 4 、KCl、MgSO 4 And Tween-20.
9. The kit for detecting aspergillus fumigatus according to claim 5, wherein the kit further comprises a colloidal gold immunochromatographic test strip.
CN202311401969.5A 2023-10-27 2023-10-27 Aspergillus fumigatus detection primer set, kit and application thereof Active CN117144053B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311401969.5A CN117144053B (en) 2023-10-27 2023-10-27 Aspergillus fumigatus detection primer set, kit and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311401969.5A CN117144053B (en) 2023-10-27 2023-10-27 Aspergillus fumigatus detection primer set, kit and application thereof

Publications (2)

Publication Number Publication Date
CN117144053A CN117144053A (en) 2023-12-01
CN117144053B true CN117144053B (en) 2024-01-19

Family

ID=88910253

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311401969.5A Active CN117144053B (en) 2023-10-27 2023-10-27 Aspergillus fumigatus detection primer set, kit and application thereof

Country Status (1)

Country Link
CN (1) CN117144053B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105368918A (en) * 2014-08-21 2016-03-02 黄耀江 LAMP primer for detecting Asperillus Parasiticus, and kit including primer
CN105624290A (en) * 2016-01-12 2016-06-01 中国人民解放军疾病预防控制所 Application of Aspergillus fumigatus annexin anxC4 gene (anxC4 gene)
CN108486258A (en) * 2018-01-29 2018-09-04 南昌大学 A kind of kit and its method of visual quickly detection food-borne pathogens
CN108707691A (en) * 2018-06-07 2018-10-26 杭州缔蓝生物技术有限公司 A kind of primer combination of probe of specific detection aspergillus fumigatus and the kit that aspergillus fumigatus is detected based on fluorescent PCR method
CN109988855A (en) * 2017-12-29 2019-07-09 博奥生物集团有限公司 For detecting the LAMP primer composition and its application of six kinds of aspergillus
CN110760605A (en) * 2019-10-31 2020-02-07 中国人民解放军疾病预防控制中心 Real-time fluorescence RPA detection kit for aspergillus fumigatus and special primer and probe thereof

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105368918A (en) * 2014-08-21 2016-03-02 黄耀江 LAMP primer for detecting Asperillus Parasiticus, and kit including primer
CN105624290A (en) * 2016-01-12 2016-06-01 中国人民解放军疾病预防控制所 Application of Aspergillus fumigatus annexin anxC4 gene (anxC4 gene)
CN109988855A (en) * 2017-12-29 2019-07-09 博奥生物集团有限公司 For detecting the LAMP primer composition and its application of six kinds of aspergillus
CN108486258A (en) * 2018-01-29 2018-09-04 南昌大学 A kind of kit and its method of visual quickly detection food-borne pathogens
CN108707691A (en) * 2018-06-07 2018-10-26 杭州缔蓝生物技术有限公司 A kind of primer combination of probe of specific detection aspergillus fumigatus and the kit that aspergillus fumigatus is detected based on fluorescent PCR method
CN110760605A (en) * 2019-10-31 2020-02-07 中国人民解放军疾病预防控制中心 Real-time fluorescence RPA detection kit for aspergillus fumigatus and special primer and probe thereof

Also Published As

Publication number Publication date
CN117144053A (en) 2023-12-01

Similar Documents

Publication Publication Date Title
CN105441595B (en) It is a kind of for detecting the digital pcr absolute quantitation parting detecting reagent of HBV-B/C
WO2010015607A2 (en) Method of evaluating oral cancer risk in human
CN106987626B (en) Primer and probe for rapidly detecting various fungi and identifying strains and application thereof
CN111518948B (en) Method for detecting SARS-CoV-2 by reverse transcription multi-cross displacement amplification combined with nano biological sensing
CN117143868B (en) Cryptococcus neoformans detection primer set, kit and application thereof
CN117143867A (en) Yersinia pneumosporium detection primer group, kit and application thereof
AU2014200609A1 (en) Methods and compositions for detecting Aspergillus terreus, Aspergillus niger, and mycotoxins
CN117144053B (en) Aspergillus fumigatus detection primer set, kit and application thereof
CN110791570B (en) Primer group and kit for simultaneously detecting Wei-type, Si-type and heterodiscal paragonimiasis
Matos et al. Laboratory diagnosis of Pneumocystis jirovecii pneumonia
CN114438238B (en) Primer for detecting infectious endocarditis pathogen and digital PCR kit
CN117070668B (en) Aspergillus flavus detection primer set, kit and application thereof
CN102181567A (en) Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for detecting candida glabrata
CN106048051B (en) A kind of candida krusei fluorescence PCR detection reagent kit
CN115873979A (en) Constant-temperature nucleic acid amplification RAA primer probe combination for detecting candida auricula and application thereof
EP4211266A1 (en) Tools & methods useful for detection of lactose intolerance and uses thereof
CN112501349A (en) Primer probe composition and kit for synchronously detecting 8 children digestive tract infection fungi and parasite-related pathogens
CN102181566A (en) Real-time fluorescence quantitative PCR (Polymerase Chain Reaction) kit for detecting candida tropicalis
CN110055345A (en) Primer sets and its application
CN115927636B (en) Cervical high-level lesion related gene methylation qPCR detection kit, and use method and system thereof
CN111560475A (en) Redondvirus virus nucleic acid detection kit
CN102417935B (en) Nucleic acid quantitative determination kit, detection method, primers and probes for Newcastle disease virus (NDV)
CN107130015B (en) Fluorescent quantitative PCR kit for detecting aspergillus fumigatus
CN118086550A (en) Fluorescent probe combination for detecting fungi in sputum, detection kit and application
CN117187416A (en) Home self-test kit for detecting neisseria gonorrhoeae

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant