CN117070668B - Aspergillus flavus detection primer set, kit and application thereof - Google Patents

Aspergillus flavus detection primer set, kit and application thereof Download PDF

Info

Publication number
CN117070668B
CN117070668B CN202311337139.0A CN202311337139A CN117070668B CN 117070668 B CN117070668 B CN 117070668B CN 202311337139 A CN202311337139 A CN 202311337139A CN 117070668 B CN117070668 B CN 117070668B
Authority
CN
China
Prior art keywords
primer
aspergillus flavus
detection
kit
afla
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202311337139.0A
Other languages
Chinese (zh)
Other versions
CN117070668A (en
Inventor
李翔
陈海琴
李婷婷
陈冬冬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu Mics Medical Technology Co ltd
Original Assignee
Jiangsu Mics Medical Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Mics Medical Technology Co ltd filed Critical Jiangsu Mics Medical Technology Co ltd
Priority to CN202311337139.0A priority Critical patent/CN117070668B/en
Publication of CN117070668A publication Critical patent/CN117070668A/en
Application granted granted Critical
Publication of CN117070668B publication Critical patent/CN117070668B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/66—Aspergillus
    • C12R2001/67—Aspergillus flavus
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides an aspergillus flavus detection primer set, a kit and application thereof, belongs to the technical field of fungus detection, and solves the problem of inaccurate aspergillus flavus detection in the prior art. The Aspergillus flavus detection primer set provided by the invention has high sensitivity and strong specificity, and the detection limit is as low as 1000copies/mL, thereby being beneficial to early screening and early diagnosis of Aspergillus flavus infection and being convenient for timely intervention treatment and disease control. The kit for detecting the aspergillus flavus provided by the invention adopts a isothermal amplification-nucleic acid colloidal gold chromatography method, can complete detection reaction within 35min, and is simple and convenient in result judgment; the kit provided by the invention has the advantages of low single detection cost, low cost and low requirements on instruments and equipment, is suitable for basic medical units, can perform home self-test, and is beneficial to early diagnosis of fungal infection.

Description

Aspergillus flavus detection primer set, kit and application thereof
Technical Field
The invention relates to the technical field of fungus detection, in particular to an aspergillus flavus detection primer group, a kit and application thereof.
Background
Invasive aspergillosis (Invasive aspergillosis, IA) is common in patients with immunodeficiency due to steroid therapy, chemotherapy, organ, bone marrow transplantation, etc., and has rapid disease progression, difficult early diagnosis, and high mortality. IA is located at position 2 in invasive mycoses and there is still an increasing trend. The IA pathogenic bacteria mainly comprise aspergillus fumigatusAspergillus fumigatus) Aspergillus flavus (L.) KuntzeAspergillus flavus) Aspergillus nigerAspergillus niger) Aspergillus terreus (He) HeAspergillus terreus). Among them, aspergillus flavus is the predominant IA pathogen in asia, middle east and africa. Therefore, the method for early diagnosis of the aspergillus flavus infection is developed, is beneficial to accurate and rapid early diagnosis of IA, and is beneficial to carrying out targeted antifungal treatment in real time, so that the disease condition is controlled, the death rate is reduced, and the prognosis is improved.
At present, diagnosis of IA infection can be divided into two major categories, namely a culture method and an non-culture method. The traditional culture method is a gold standard for IA infection diagnosis, and can accurately identify strains, but the strain can not meet the requirement of clinical early diagnosis due to long time consumption and low positive rate. In the non-culture method, the histopathological examination cannot distinguish specific species, the sampling process is invasive and traumatic, and the clinical application is limited; both imaging and serological detection methods lack sensitivity or specificity and do not meet the needs of early clinical diagnosis. In recent years, molecular biological detection methods based on biochemistry, bioinformatics and molecular biology have been applied to the detection of mold infections. Although the QPCR detection technology has higher sensitivity and specificity, the QPCR detection technology has the characteristics of high dependence on instruments (QPCR instruments), detection places (professional laboratories), professional personnel operation, longer reporting time and the like, and is not beneficial to the convenience of detection.
Chinese patent CN104087665A discloses a clinical Aspergillus flavus detection technology using helicase-dependent isothermal amplification (helicase dependent amplification, HDA) in combination with fluorescent PCR detection, but the method has the disadvantages of low sensitivity (about 10000 copies/mL), long time consumption (detection time greater than 90 min), dependence on a fluorescent quantitative PCR instrument and the like.
Disclosure of Invention
The invention aims to provide an aspergillus flavus detection primer group, a kit and application thereof, so as to solve the problem of low aspergillus flavus detection sensitivity in the prior art.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides an aspergillus flavus detection primer group, which comprises the following primers:
a primer AFla F3 with a nucleotide sequence shown as SEQ ID NO. 1;
a primer AFla FIP with a nucleotide sequence shown as SEQ ID NO. 2;
a primer AFla LF with a nucleotide sequence shown as SEQ ID NO. 3;
a primer AFla BIP with a nucleotide sequence shown as SEQ ID NO. 4;
a primer AFla LB with a nucleotide sequence shown as SEQ ID NO. 5;
the nucleotide sequence is shown as a primer AFla B3 shown in SEQ ID NO. 6.
Preferably, the 5' end of the primer AFla FIP is marked with a fluorescent group;
the 5' end of the primer AFla LF is marked with biotin.
Preferably, the fluorophore is FAM or FITC.
The invention also provides application of the aspergillus flavus detection primer group in preparation of a kit for detecting aspergillus flavus.
The invention also provides a kit for detecting the aspergillus flavus, which comprises the aspergillus flavus detection primer set and a detection reagent.
Preferably, the final concentration of the primer AFla FIP in the kit is 1.6-2.4 mu mol/L;
the final concentration of the primer AFla BIP in the kit is 1.6-2.4 mu mol/L.
Preferably, the detection reagent comprises isothermal amplification buffer, dNTPs and Bst DNA polymerase.
Preferably, the isothermal amplification buffer comprises Tris-HCl, (NH) 4 ) 2 SO 4 、KCl、MgSO 4 And Tween-20.
Preferably, the kit further comprises a colloidal gold immunochromatographic test strip.
Preferably, the colloidal gold immunochromatographic test strip comprises a bottom plate, a sample pad, an interpretation area and a water absorption pad; the sample pad, the interpretation area and the water absorption pad are sequentially arranged on the bottom plate; the interpretation area is sequentially provided with a detection line and a quality control line;
FAM antibodies are coated in the detection line, and the concentration of the FAM antibodies is 0.05-0.15 mg/mL;
the quality control line is coated with a biotin-BSA solution, and the concentration of the biotin-BSA solution is 1.5-3 mg/mL.
The invention has the beneficial effects that:
the Aspergillus flavus detection primer set provided by the invention has high sensitivity and strong specificity, and the detection limit is as low as 500 copies/mL, thereby being beneficial to early screening and early diagnosis of Aspergillus flavus infection and being convenient for timely intervention treatment and disease control.
The kit for detecting the aspergillus flavus provided by the invention adopts a isothermal amplification-nucleic acid colloidal gold chromatography method, can complete detection reaction within 35min, and is simple and convenient in result judgment; the kit provided by the invention has low single detection cost and low requirements on instruments and equipment, is suitable for basic medical units, can perform home self-test, and is beneficial to early diagnosis of deep fungal infection.
Drawings
FIG. 1 is a graph of the repeated detection results of the present invention;
FIG. 2 is a graph showing the results of the specific assay of the present invention.
Detailed Description
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. In case of conflict, the present specification, definitions, will control.
As used herein, the term "prepared from …" is synonymous with "comprising. The terms "comprising," "including," "having," "containing," or any other variation thereof, as used herein, are intended to cover a non-exclusive inclusion.
The conjunction "consisting of …" excludes any unspecified element, step or component. If used in a claim, such phrase will cause the claim to be closed, such that it does not include materials other than those described, except for conventional impurities associated therewith. When the phrase "consisting of …" appears in a clause of the claim body, rather than immediately following the subject, it is limited to only the elements described in that clause; other elements are not excluded from the stated claims as a whole.
When an equivalent, concentration, or other value or parameter is expressed as a range, preferred range, or a range bounded by a list of upper preferable values and lower preferable values, this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value, regardless of whether ranges are separately disclosed. For example, when ranges "1 to 5" are disclosed, the described ranges should be construed to include ranges "1 to 4", "1 to 3", "1-2 and 4-5", "1-3 and 5", and the like. When a numerical range is described herein, unless otherwise indicated, the range is intended to include its endpoints and all integers and fractions within the range.
The invention provides an aspergillus flavus detection primer group, which comprises the following primers:
a primer AFla F3 with a nucleotide sequence shown as SEQ ID NO. 1;
a primer AFla FIP with a nucleotide sequence shown as SEQ ID NO. 2;
a primer AFla LF with a nucleotide sequence shown as SEQ ID NO. 3;
a primer AFla BIP with a nucleotide sequence shown as SEQ ID NO. 4;
a primer AFla LB with a nucleotide sequence shown as SEQ ID NO. 5;
a primer AFla B3 with a nucleotide sequence shown as SEQ ID NO. 6;
the target of the primer group is 82-295 nucleic acid sequences in the aspergillus flavus KF562227.1 gene.
In the invention, the 5' end of the primer AFla FIP is preferably marked with a fluorescent group, and the fluorescent group is preferably FAM or FITC; the 5' end of the primer AFla LF is marked with biotin.
The invention also provides application of the aspergillus flavus detection primer group in preparation of a kit for detecting aspergillus flavus, and the kit for detecting aspergillus flavus is preferably a kit adopting a isothermal amplification principle.
The invention also provides a kit for detecting the aspergillus flavus, which comprises the aspergillus flavus detection primer group and a detection reagent, wherein the final concentration of the primer AFla FIP in the kit is preferably 1.6-2.4 mu mol/L, more preferably 1.8-2.2 mu mol/L, the final concentration of the primer AFla BIP in the kit is preferably 1.6-2.4 mu mol/L, more preferably 1.8-2.2 mu mol/L, the final concentration of the primer AFla F3 in the kit is preferably 0.1-0.3 mu mol/L, more preferably 0.15-0.25 mu mol/L, the final concentration of the primer AFla LB in the kit is preferably 0.5-0.8 mu mol/L, more preferably 0.6-0.7 mu mol/L, the final concentration of the primer AFla B3 in the kit is preferably 0.1-0.3 mu mol/L, more preferably 0.8-0.25 mu mol/L, and the final concentration of the primer AFla LB in the kit is preferably 0.5-0.7 mu mol/L.
In the present invention, the detection reagent preferably comprises an isothermal amplification buffer, preferably comprising Tris-HCl, (NH), dNTP and Bst DNA polymerase 4 ) 2 SO 4 、KCl、MgSO 4 And Tween-20, wherein the concentration of Tris-HCl in the kit is preferably 15-18 mmol/L, and more preferably 16-17 mmol/L; in the kit (NH) 4 ) 2 SO 4 The final concentration of KCl in the kit is preferably 7 to 9mmol/L, more preferably 7.5 to 8.5mmol/L, the final concentration of KCl in the kit is preferably 11 to 13mmol/L, more preferably 11.5 to 12.5mmol/L, and the MgSO in the kit 4 The final concentration of Tween-20 in the kit is preferably 1-3 mmol/L, more preferably 1.5-2.5 mmol/L, the final concentration of Tween-20 in the kit is preferably 0.06-0.1%, more preferably 0.07-0.09%, and the test is performedThe final concentration of dNTP in the kit is preferably 0.55-0.65 mmol/L, more preferably 0.58-0.62 mmol/L, and the final enzyme activity of Bst DNA polymerase in the kit is preferably 0.2-0.3U/mL, more preferably 0.24-0.28U/mL.
In the present invention, the method of using the kit preferably comprises the steps of: (1) extracting DNA of a sample to be detected by adopting a genome DNA extraction kit; (2) reagent configuration: preparing a reaction system by taking 1.5mL centrifuge tubes (DNase/RNase-Free, sterilization), adding isothermal amplification PCR reaction liquid and primer mixed liquid, carrying out vortex oscillation for 10 seconds, centrifuging for standby, and sub-packaging 20 mu L/tube into the PCR reaction tubes (sterile and DNase/RNase-Free); (3) sample adding: transferring 10 mu L of the extracted nucleic acid into each PCR reaction tube, covering a tube cover, centrifuging, and transferring to a PCR detection area; (4) and (3) PCR amplification: and (3) placing the PCR reaction tube into a sample tank for isothermal amplification, reacting for 30min at 60 ℃ to obtain a sample amplification product, and determining whether the sample amplification product contains 82-295 th nucleic acid sequences in the aspergillus flavus KF562227.1 gene in the aspergillus flavus genome, so as to obtain whether the sample contains the aspergillus flavus.
In the invention, the kit also preferably comprises a colloidal gold immunochromatographic test strip, wherein the colloidal gold immunochromatographic test strip preferably comprises a bottom plate, a sample pad, an interpretation area and a water absorption pad; the sample pad, the interpretation area and the water absorption pad are sequentially arranged on the bottom plate; the interpretation area is sequentially provided with a detection line and a quality control line; the read zone preferably comprises a conjugate pad and a nitrocellulose membrane; the sample pad, the bonding pad, the nitrocellulose membrane and the water absorbing pad are sequentially overlapped with each other in a staggered manner to form a strip shape and then are adhered to a bottom plate, and the bottom plate is a PVC plate; the binding pad is sprayed with a streptavidin marked tracer marker, the tracer marker is nano particles comprising colloidal gold, latex microspheres and fluorescent microspheres, a C line (quality control line) and a T line (detection line) are sequentially arranged on a nitrocellulose membrane from absorbent paper to the binding pad, a biotin-BSA solution is coated in the C line region, and FAM antibodies are coated in the T line region. The concentration of the biotin-BSA solution is preferably 1.5-3 mg/mL, the concentration of the FAM antibody is preferably 0.05-0.15 mg/mL, and the FAM antibody is preferably a rabbit anti-FAM antibody; in the invention, the test strip is assembled into the shell to prepare the detection card.
The detection principle of the test strip provided by the invention is as follows: the label marker marked by streptavidin is sprayed on the binding pad in the interpretation area, the label marker is nano particles including colloidal gold, latex microspheres and fluorescent microspheres, a biotin-BSA is coated on a C line of a nitrocellulose membrane, and a rabbit anti-FAM antibody is coated on a T line; meanwhile, when the double-chain amplification product with FITC/FAM and biotin marks flows through the test strip, the double-chain amplification product can be recognized and captured by specific antibodies on the colloidal gold labeled antibodies and nitrocellulose membranes, strips are formed in corresponding T line areas (detection lines), unbound colloidal gold labeled antibodies are chromatographed to C line areas (quality control lines) along with buffer solution, and specific antigens fixed on the membranes are recognized and captured to form strips, so that quality control of the test strip is completed.
Result determination criteria:
the C line is provided with a strip, and the T line is provided with a strip at the same time, so that the detected sample is positive;
the C line shows a strip, and the T line does not show a strip, so that the detected sample is negative;
the absence of a strip on line C indicates that the test card failed.
In the invention, the kit is also provided with a conventional DNA extraction kit, a chromatographic buffer solution, and more than five standby disposable pipettes and reaction tubes; the loop-mediated isothermal amplification reaction solution, the primer mixture and the chromatographic buffer solution are placed in independent reaction tubes for aseptic sealing.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
Taking 82 th-295 th nucleic acid sequence in aspergillus flavus KF562227.1 gene as a specific detection target for detecting aspergillus flavus, designing a primer group according to a target region sequence, wherein the nucleotide sequence of the primer group is as follows (the sequences are 5'to 3'):
primer AFla F3: ACACAAGCTGACTTTGCT, shown in SEQ NO.1, is located at positions 82-99 of the sequence KF 562227.1;
primer AFla FIP: CGCATTTGATGGGAGAATGAATAAACTTGGGTTTCCTATAGGACAA, shown in SEQ NO.2, is composed of two spaced fragments of sequence KF562227.1, and is located at 103-123 and 149-173 on sequence KF562227.1 respectively;
primer AFla LF: ACTGTACTAACCATCACCGTCC, shown in SEQ NO.3, at positions 124-145 of the sequence KF 562227.1;
primer AFla BIP: TAGCCGCCATAATTTTATCCAGTTTGTGATCTGGCCTGCATAT, shown in SEQ NO.4, consists of two fragments spaced apart on the sequence KF562227.1, at positions 186-210 and 253-270 of the sequence KF562227.1, respectively;
primer AFla LB: CGATCGGCTGAAGTCTTGGC, shown in SEQ NO.5, at positions 216-235 on the sequence KF 562227.1;
primer AFla B3: CATGACAGTGCCCAACTC, shown in SEQ NO.6, at positions 278-295 on the sequence KF 562227.1;
wherein, the 5 'end of the primer AFla FIP is marked with FAM group, and the 5' end of the primer AFla LF is marked with biotin.
Example 2
The only difference from example 1 is that FITC groups are labeled at the 5 'end of the primer AFla FIP and biotin is labeled at the 5' end of the primer AFla LF.
Example 3
Preparing the components of the kit: the method comprises the steps of mixing the primer combination in the embodiment 1, loop-mediated isothermal amplification reaction liquid and a nucleic acid colloidal gold detection card;
the loop-mediated isothermal amplification reaction solution comprises: 2.5. Mu.L of 10 Xisothermal amplification buffer, 1.4. Mu.L of dNTPs (25 mmol/L), 1. Mu.L of Bst DNA polymerase (8000U/mL).
10 Xisothermal amplification buffer is prepared from Tris-HCl, (NH) 4 ) 2 SO 4 、KCl、MgSO 4 The mixture ratio of the components in the reaction system is as follows:
primer AFla F3: 0.2. Mu. Mol/L;
primer AFla FIP: 1.6. Mu. Mol/L;
primer AFla LF: 0.67. Mu. Mol/L;
primer AFla BIP: 1.6. Mu. Mol/L;
primer AFla LB: 0.67. Mu. Mol/L;
primer AFla B3: 0.2. Mu. Mol/L;
dNTP：0.58mmol/L；
Tris-HCl：16.67mmol/L；
(NH 4 ) 2 SO 4 ：8.33mmol/L；
KCl：12.5mmol/L；
MgSO 4 ：1.67mmol/L；
Tween-20：0.08%；
bst polymer: 0.27U/L.
Nucleic acid colloidal gold detection cards are commercially available, for example, from Jiangsu Hunting Biotechnology Inc., under the accession number HDu.
Example 4
Extracting DNA of a sample to be detected by adopting a genome DNA extraction kit;
reagent configuration: the experiment was performed by selecting the kit of example 3, preparing a reaction system by taking a 1.5mL centrifuge tube (DNase/RNase-Free, sterilization), adding a mixed solution of a loop-mediated isothermal amplification PCR reaction solution and a primer combination, performing vortex oscillation for 10 seconds, centrifuging for standby, and sub-packaging 20 mu L/tube into a PCR reaction tube (sterile and DNase/RNase-Free).
Sample adding: the extracted nucleic acid was transferred to each PCR reaction tube by 10. Mu.L, the tube cap of the reaction tube was closed, and transferred to the PCR detection zone after centrifugation.
And (3) PCR amplification: the PCR reaction tube was placed in an isothermal amplification sample tank and reacted at 60℃for 30min.
Preparing a detection card: the test card was removed from the aluminum foil bag and placed on a dry horizontal table top.
Sample adding detection: 20 mu L of sample amplification product is taken into a sample adding hole of a detection card by using a liquid transfer device, 100 mu L of chromatographic buffer solution is added, and the result is read within 2 minutes.
Result determination criteria:
the C line is provided with a strip, and the T line is provided with a strip at the same time, so that the detected sample is positive;
the C line shows a strip, and the T line does not show a strip, so that the detected sample is negative;
the absence of a strip on line C indicates that the test card failed.
Example 5
The difference from example 3 was only that the final concentration of the primer AFla FIP in the reaction system was replaced with 2.4. Mu. Mol/L.
Example 6
The difference from example 3 was only that the final concentration of the primer AFla BIP in the reaction system was replaced with 2.4. Mu. Mol/L.
Example 7
The difference from example 3 was that the final concentration of the primer AFla FIP in the reaction system was replaced with 2.4. Mu. Mol/L and the final concentration of the primer AFla BIP was replaced with 2.4. Mu. Mol/L.
Experimental example 1
The primers shown in example 1 were used as described in example 4 for Aspergillus flavus standard strain @Aspergillus flavusPurchased from the american type ATCC collection, no. ATCC 9643 DQ), the concentration of the Aspergillus flavus sample was about 10000copies/mL, and the test was repeated 10 times, and the test results are shown in FIG. 1.
As can be seen from FIG. 1, the results of 10 times of detection are positive to Aspergillus flavus and have uniform color development, which shows that the combination of the invention has good detection consistency.
Experimental example 2 detection sensitivity of Aspergillus flavus detection kit
Aspergillus flavus is preparedAspergillus flavusSamples to be tested, prepared at 5000copies/mL, 2500 copies/mL, 1000copies/mL, 500 copies/mL and 250 copies/mL, from the American type ATCC deposit, no. ATCC 9643DQ, were tested as described in example 4, each gradient was repeated 5 times, the results were recorded, and the sample concentration at all tested was the limit of detection, and the results were shown in Table 1 below (positive "+", negative "-"):
TABLE 1 sensitivity test results
As a result, all of 5000copies/mL, 2500 copies/mL and 1000copies/mL were detected, and 500 copies/mL was detected with a probability. Therefore, the detection limit of the combined reagent for aspergillus flavus is 1000copies/mL, the sensitivity is high, and the combined reagent can be used for aspergillus flavus nucleic acid detection.
Experimental example 3 specificity of Aspergillus flavus detection kit
Use of Aspergillus flavus from American ATCCAspergillus flavusAFla, no. ATCC 9643DQ, aspergillus fumigatusAspergillus fumigatusAF, no. ATCC 1022 DQ), aspergillus nigerAspergillus nigerAN, no. ATCC 1015 DQ), aspergillus oryzaeAspergillus oryzaeAO, no. ATCC 1011), aspergillus nidulansAspergillus nidulansANi, no. ATCC 10074), cryptococcus neoformansCryptococcus neoformansCN, no. ATCC 32045), cryptococcus gartertiaryanaCryptococcus gattiCG, no. atcc MYA-4562), yersinia pneumosporePneumocystis jiroveciiPJ, no. ATCC MYA-5006 SD), streptococcus pneumoniaeStreptococcus pneumoniaeSP, no. ATCC 49619DQ, staphylococcus aureusStaphylococcus aureusSA, no. ATCC 29213), pertussisBordetella pertussisBP, no. ATCC 9797DQ, haemophilus influenzaeHaemophilus influenzaeHI, no. ATCC 51907 DQ), candida albicansCandida albicansCA, no. ATCC 10231DQ, candida parapsilosisCandida parapsilosisCP, no. atcc 22019 DQ), candida tropicalisCandida tropicalisCT, no. ATCC 66029 DQ) and Saccharomyces cerevisiaeSaccharomyces cerevisiaeA total of 16 samples were subjected to a specificity test by SC, no. ATCC MYA-4941 DQ). The concentration of each sample to be tested was 5000copies/mL and was measured as in example 4.
As shown in FIG. 2, in the detection results of 16 samples, only Aspergillus flavus is positive, and the rest are negative, which shows that the combination of the invention can eliminate the interference of different pathogens and accurately detect Aspergillus flavus.
Experimental example 4 comparison of different primer sets
Primer combinations (nucleotide sequences and modification modes) are key factors influencing the detection capability of a nucleic acid detection platform, and the primer combinations used are required to have higher specificity and sensitivity, so that the preference of the primer combinations is particularly important. In the development stage of the kit, comparison of different primer combinations and different modification modes is carried out.
The present invention designed the following alternative primers, (all 5'to 3'):
aspergillus flavus alternative primer combination 1 is located at 160-353 nucleic acid sequences of sequence KF562227.1, specifically:
the AFla F3-1 primer is positioned at 160 th-177 th positions on a sequence KF562227.1, and the sequence is as follows: TCCCATCAAATGCGATCA, as shown in SEQ NO. 7;
the AFla FIP-1 primer is formed by combining two fragments which are arranged at intervals on KF562227.1 and are respectively positioned at 188-207 and 228-252 positions on KF562227.1, and the sequence is as follows: CAAGTCAATTCATCAATGCCAAGACGCCGCCATAATTTTATCCAG, as shown in SEQ NO. 8;
the AFla BIP-1 primer consists of two fragments which are spaced on KF562227.1, are respectively positioned at 253 th to 272 th positions and 315 th to 332 th positions on KF562227.1, and have the following sequences: ATATGCAGGCCAGATCACCAGGAGTTCCGACTCAGAGG, as shown in SEQ NO. 9;
the AFla LB-1 primer is positioned at 276-296 th position of KF562227.1, and has the sequence: AGGAGTTGGGCACTGTCATGC, as shown in SEQ NO. 10;
AFla B3-1 primer was located at positions 334-353 on KF 562227.1. The sequence is as follows: CAACCTCGTTAATCATGTCC, as shown in SEQ NO. 11;
aspergillus flavus alternative primer combination 2 is located at 51-250 positions of a nucleic acid sequence KF562227.1, and specifically:
the AFla F3-2 primer has the position of 51-72 on KF562227.1 and the sequence of AAAATTGGTTTTGTTAGTCGTC, and is shown in SEQ NO. 12;
the AFla FIP-2 primer is formed by combining two fragments which are arranged at intervals on KF562227.1 and are respectively positioned at 73 rd to 93 rd and 114 th to 136 th positions on KF562227.1, and the sequence is ACCATCACCGTCCTTGTCCTATAATGATTTGAACACAAGCTGAC, as shown in SEQ NO. 13;
the AFla BIP-2 primer consists of two fragments which are spaced on KF562227.1 and are respectively positioned at 151 th to 174 th positions and 191 th to 214 th positions, and the sequence is TATTCATTCTCCCATCAAATGCGAACAGAAACTGGATAAAATTATGGC, as shown in SEQ NO. 14;
the AFla B3-2 primer is positioned at 231-250 th position on KF562227.1, and has a sequence of AGTCAATTCATCAATGCCAA as shown in SEQ NO. 15.
Wherein, the concentration of the F3 primer and the B3 primer in each alternative primer combination reaction system is 0.2 mu mol/L, FIP primer and the concentration of the BIP primer are 1.6 mu mol/L, and the concentration of the LF primer (if any) and the LB primer (if any) are 0.67 mu mol/L; the other components and concentrations in the reaction system were the same as in example 3.
A comparison scheme for binding different modification sites on the basis of example 1, comprising:
example 1 (primer AFla FIP 5 'end labeled FAM group, primer AFla LF 5' end labeled biotin);
alternative modification scheme 1 (primer AFla FIP 5 'end labeled FAM group, primer AFla LB 5' end labeled biotin);
alternative modification scheme 2 (primer AFla BIP 5 'end labeled FAM group, primer AFla LF 5' end labeled biotin).
The aspergillus flavus standard strain is used as a sample to be tested for detection, and the results are shown in table 2:
table 2 detection results of combinations of primers
The results showed that the detection limit of the alternative primer set 1 was 5000copies/mL, while the detection limit of the alternative modification 1, the alternative modification 2 and the alternative primer set 2 were 2500 copies/mL. In conclusion, the detection limit of the combination is the lowest, and the sensitivity is the highest.
Experimental example 5 comparison of the different primer concentrations
In view of the fact that the primer concentrations of FIP and BIP in the LAMP reaction system have a large influence on the detection sensitivity, different concentration detection comparison experiments of FIP and BIP are performed on the primer set of the invention so as to obtain optimal reaction concentrations, and the concentrations of the primer FIP and the primer BIP are adjusted on the basis of example 3, as shown in the following table 3:
TABLE 3 experiment set of different primer concentrations
Each combination was tested using a standard strain of aspergillus flavus (1000 copies/mL) as the test sample, and the test was repeated 10 times, the test method was the same as in example 4, and the results are shown in table 4:
TABLE 4 detection results of different primer concentrations
As is clear from Table 4, when the concentrations of FIP and BIP in the reaction system were not less than 1.6. Mu. Mol/L, the standard strain of Aspergillus flavus of 1000copies/mL could be stably detected in the combinations 5, 6, 8 and 9, and therefore, the concentrations of FIP and BIP primers in the reaction system were set to 1.6. Mu. Mol/L in view of the cost of the reagents.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (10)

1. An aspergillus flavus detection primer set is characterized by comprising the following primers:
a primer AFla F3 with a nucleotide sequence shown as SEQ ID NO. 1;
a primer AFla FIP with a nucleotide sequence shown as SEQ ID NO. 2;
a primer AFla LF with a nucleotide sequence shown as SEQ ID NO. 3;
a primer AFla BIP with a nucleotide sequence shown as SEQ ID NO. 4;
a primer AFla LB with a nucleotide sequence shown as SEQ ID NO. 5;
the nucleotide sequence is shown as a primer AFla B3 shown in SEQ ID NO. 6.
2. The aspergillus flavus detection primer set according to claim 1, wherein the 5' end of the primer AFla FIP is marked with a fluorescent group;
the 5' end of the primer AFla LF is marked with biotin.
3. The aspergillus flavus detection primer set according to claim 2, wherein the fluorescent group is FAM or FITC.
4. The use of the aspergillus flavus detection primer set according to any one of claims 1-3 in the preparation of a kit for detecting aspergillus flavus.
5. A kit for detecting aspergillus flavus, which is characterized by comprising the aspergillus flavus detection primer set and the detection reagent according to any one of claims 1-3.
6. The kit for detecting aspergillus flavus according to claim 5, wherein the final concentration of the primer AFla FIP in the kit is 1.6-2.4 mu mol/L;
the final concentration of the primer AFla BIP in the kit is 1.6-2.4 mu mol/L.
7. The kit for detecting aspergillus flavus as claimed in claim 5, wherein the detection reagent comprises isothermal amplification buffer, dNTP and Bst DNA polymerase.
8. The kit for detecting aspergillus flavus as claimed in claim 7, wherein the isothermal amplification buffer comprises Tris-HCl, (NH) 4 ) 2 SO 4 、KCl、MgSO 4 And Tween-20.
9. The kit for detecting aspergillus flavus as claimed in claim 5, further comprising a colloidal gold immunochromatographic test strip.
10. The kit for detecting aspergillus flavus as claimed in claim 9, wherein the colloidal gold immunochromatographic test strip comprises a bottom plate, a sample pad, an interpretation zone and a water absorption pad; the sample pad, the interpretation area and the water absorption pad are sequentially arranged on the bottom plate; the interpretation area is sequentially provided with a detection line and a quality control line;
FAM antibodies are coated in the detection line, and the concentration of the FAM antibodies is 0.05-0.15 mg/mL;
the quality control line is coated with a biotin-BSA solution, and the concentration of the biotin-BSA solution is 1.5-3 mg/mL.
CN202311337139.0A 2023-10-17 2023-10-17 Aspergillus flavus detection primer set, kit and application thereof Active CN117070668B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311337139.0A CN117070668B (en) 2023-10-17 2023-10-17 Aspergillus flavus detection primer set, kit and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311337139.0A CN117070668B (en) 2023-10-17 2023-10-17 Aspergillus flavus detection primer set, kit and application thereof

Publications (2)

Publication Number Publication Date
CN117070668A CN117070668A (en) 2023-11-17
CN117070668B true CN117070668B (en) 2023-12-26

Family

ID=88704664

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311337139.0A Active CN117070668B (en) 2023-10-17 2023-10-17 Aspergillus flavus detection primer set, kit and application thereof

Country Status (1)

Country Link
CN (1) CN117070668B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102586455A (en) * 2012-03-14 2012-07-18 万俊松 Aflatoxin detection reagent kit based on loop-mediated isothermal gene amplification method
CN103451294A (en) * 2013-09-04 2013-12-18 福建省农业科学院植物保护研究所 Aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and visualized detection method thereof
CN105154431A (en) * 2015-08-25 2015-12-16 张初署 Method for establishing DNA (deoxyribonucleic acid) fingerprint spectra of peanut aspergillus flavus in different producing areas with ISSR (inter-simple sequence repeat) molecular marker technology
CN105219655A (en) * 2015-09-25 2016-01-06 浙江大学 Flavus biocontrol strain and the application thereof of aflatoxin do not produced to sterilant resistance
CN115478114A (en) * 2022-07-29 2022-12-16 首都医科大学附属北京胸科医院 Specific primer group of mycobacteria and fungal gene and sequencing method of mycobacteria and fungal infection

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102586455A (en) * 2012-03-14 2012-07-18 万俊松 Aflatoxin detection reagent kit based on loop-mediated isothermal gene amplification method
CN103451294A (en) * 2013-09-04 2013-12-18 福建省农业科学院植物保护研究所 Aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and visualized detection method thereof
CN105154431A (en) * 2015-08-25 2015-12-16 张初署 Method for establishing DNA (deoxyribonucleic acid) fingerprint spectra of peanut aspergillus flavus in different producing areas with ISSR (inter-simple sequence repeat) molecular marker technology
CN105219655A (en) * 2015-09-25 2016-01-06 浙江大学 Flavus biocontrol strain and the application thereof of aflatoxin do not produced to sterilant resistance
CN115478114A (en) * 2022-07-29 2022-12-16 首都医科大学附属北京胸科医院 Specific primer group of mycobacteria and fungal gene and sequencing method of mycobacteria and fungal infection

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Application of loop-mediated isothermal amplification assays for direct identification of pure cultures of Aspergillus flavus, A. nomius, and A. caelatus and for their rapid detection in shelled Brazil nuts;Jie Luo等;Int J Food Microbiol;第172卷;5-12 *
Development of PCR, LAMP and qPCR Assays for the Detection of Aflatoxigenic Strains of Aspergillus flavus and A. parasiticus in Hazelnut;Sara Franco Ortega等;Toxins (Basel);第12卷(第12期);757 *
Misidentification of Aspergillus nomius and Aspergillus tamarii as Aspergillus flavus: Characterization by Internal Transcribed Spacer, β-Tubulin, and Calmodulin Gene Sequencing, Metabolic Fingerprinting, and Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry;Emily W T Tam等;J Clin Microbiol;第52卷(第4期);1153-1160 *
评价ITS、BenA和CaM序列分析在曲霉菌种鉴定方面的应用;李颖等;中国真菌学杂志;第12卷(第02期);74-77 *
食用酱油中曲霉的检测方法;王建伟等;江苏农业学报;第26卷(第4期);848-852 *

Also Published As

Publication number Publication date
CN117070668A (en) 2023-11-17

Similar Documents

Publication Publication Date Title
Wahyuningsih et al. Simple and rapid detection of Candida albicans DNA in serum by PCR for diagnosis of invasive candidiasis
Maaroufi et al. Comparison of different methods of isolation of DNA of commonly encountered Candida species and its quantitation by using a real-time PCR-based assay
EP4219743A1 (en) Sample nucleic acid measurement test kit, reagent, and application thereof
CN106987626B (en) Primer and probe for rapidly detecting various fungi and identifying strains and application thereof
CN117143868B (en) Cryptococcus neoformans detection primer set, kit and application thereof
CN117143867A (en) Yersinia pneumosporium detection primer group, kit and application thereof
CN110093432B (en) sRNA marker for distinguishing mycobacterium tuberculosis from BCG vaccine and application thereof
CN114672585A (en) Primer probe for detecting lung pathogenic bacteria and kit thereof
CN110079621A (en) Oligonucleotide combinatorial, method and kit for mycobacteria strain identification
CN117070668B (en) Aspergillus flavus detection primer set, kit and application thereof
CN112359125A (en) Method for rapidly detecting cryptococcus gatherensis
CN117144053B (en) Aspergillus fumigatus detection primer set, kit and application thereof
CN105525036B (en) A kind of hepatitis b virus hbv real-time fluorescence nucleic acid isothermal amplification detection kit
CN114438238B (en) Primer for detecting infectious endocarditis pathogen and digital PCR kit
CN105567867B (en) Human immunodeficiency virus type 1 real-time fluorescence nucleic acid isothermal amplification detection kit
Hajia et al. Is PCR assay reliable for diagnosis of extrapulmonary tuberculosis
Borman et al. Genomics and proteomics as compared to conventional phenotypic approaches for the identification of the agents of invasive fungal infections
CN116769975B (en) HPV detection primer set, kit and application thereof
Mallus et al. Usefulness of capillary electrophoresis-based multiplex PCR assay for species-specific identification of Candida spp.
JP6318239B2 (en) Method for extracting fungal nucleic acid
CN112725494B (en) Method and primer for detecting 17 tomato pathogens by using micro-fluidic chip
CN114015800B (en) SNP molecular marker linked with rice blast indica-japonica-derived traits and application thereof
CN113151570B (en) Loop-mediated isothermal amplification LAMP technology based on LNA modification and application of LAMP technology in rapid detection of candida
CN102417935B (en) Nucleic acid quantitative determination kit, detection method, primers and probes for Newcastle disease virus (NDV)
CN117418028A (en) Primer group and kit for detecting cryptococcus and application of primer group and kit

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant