CN109988855A - For detecting the LAMP primer composition and its application of six kinds of aspergillus - Google Patents
For detecting the LAMP primer composition and its application of six kinds of aspergillus Download PDFInfo
- Publication number
- CN109988855A CN109988855A CN201711471982.2A CN201711471982A CN109988855A CN 109988855 A CN109988855 A CN 109988855A CN 201711471982 A CN201711471982 A CN 201711471982A CN 109988855 A CN109988855 A CN 109988855A
- Authority
- CN
- China
- Prior art keywords
- sequence
- aspergillus
- primer
- primer sets
- tested
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000228212 Aspergillus Species 0.000 title claims abstract description 62
- 239000000203 mixture Substances 0.000 title claims abstract description 25
- 241001225321 Aspergillus fumigatus Species 0.000 claims abstract description 67
- 229940091771 aspergillus fumigatus Drugs 0.000 claims abstract description 67
- 241001465318 Aspergillus terreus Species 0.000 claims abstract description 66
- 241000351920 Aspergillus nidulans Species 0.000 claims abstract description 65
- 241000228197 Aspergillus flavus Species 0.000 claims abstract description 64
- 241000789823 Aspergillus calidoustus Species 0.000 claims abstract description 62
- 241000228245 Aspergillus niger Species 0.000 claims abstract description 62
- 230000003321 amplification Effects 0.000 claims description 85
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 85
- 238000012217 deletion Methods 0.000 claims description 72
- 230000037430 deletion Effects 0.000 claims description 72
- 239000002773 nucleotide Substances 0.000 claims description 72
- 125000003729 nucleotide group Chemical group 0.000 claims description 72
- 238000006467 substitution reaction Methods 0.000 claims description 72
- 244000005700 microbiome Species 0.000 claims description 65
- 238000000034 method Methods 0.000 claims description 50
- 238000002360 preparation method Methods 0.000 claims description 30
- 230000001404 mediated effect Effects 0.000 claims description 21
- 238000011901 isothermal amplification Methods 0.000 claims description 20
- 239000003153 chemical reaction reagent Substances 0.000 claims description 12
- 238000012856 packing Methods 0.000 claims description 2
- 238000001514 detection method Methods 0.000 abstract description 15
- 230000035945 sensitivity Effects 0.000 abstract description 9
- 230000001737 promoting effect Effects 0.000 abstract description 2
- 108020004414 DNA Proteins 0.000 description 181
- 230000006870 function Effects 0.000 description 36
- 238000006243 chemical reaction Methods 0.000 description 27
- 108090000623 proteins and genes Proteins 0.000 description 21
- 238000012360 testing method Methods 0.000 description 18
- 208000015181 infectious disease Diseases 0.000 description 9
- 239000013612 plasmid Substances 0.000 description 9
- 241000233866 Fungi Species 0.000 description 7
- 239000012895 dilution Substances 0.000 description 5
- 238000010790 dilution Methods 0.000 description 5
- 208000037026 Invasive Fungal Infections Diseases 0.000 description 4
- 238000007397 LAMP assay Methods 0.000 description 4
- 206010036790 Productive cough Diseases 0.000 description 4
- 238000003745 diagnosis Methods 0.000 description 4
- 238000007689 inspection Methods 0.000 description 4
- 210000003802 sputum Anatomy 0.000 description 4
- 208000024794 sputum Diseases 0.000 description 4
- 206010017533 Fungal infection Diseases 0.000 description 3
- 208000031888 Mycoses Diseases 0.000 description 3
- 238000012790 confirmation Methods 0.000 description 3
- 239000013256 coordination polymer Substances 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 201000002909 Aspergillosis Diseases 0.000 description 2
- 208000036641 Aspergillus infections Diseases 0.000 description 2
- 102000053602 DNA Human genes 0.000 description 2
- 208000019693 Lung disease Diseases 0.000 description 2
- 206010028980 Neoplasm Diseases 0.000 description 2
- 238000004364 calculation method Methods 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 230000036039 immunity Effects 0.000 description 2
- 239000003018 immunosuppressive agent Substances 0.000 description 2
- 230000003020 moisturizing effect Effects 0.000 description 2
- 108020004707 nucleic acids Proteins 0.000 description 2
- 102000039446 nucleic acids Human genes 0.000 description 2
- 150000007523 nucleic acids Chemical class 0.000 description 2
- 239000000376 reactant Substances 0.000 description 2
- -1 that is Substances 0.000 description 2
- 206010002198 Anaphylactic reaction Diseases 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- 241000222122 Candida albicans Species 0.000 description 1
- 208000003322 Coinfection Diseases 0.000 description 1
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 241000282414 Homo sapiens Species 0.000 description 1
- 206010061218 Inflammation Diseases 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 108020004682 Single-Stranded DNA Proteins 0.000 description 1
- 238000002835 absorbance Methods 0.000 description 1
- 230000000172 allergic effect Effects 0.000 description 1
- 230000036783 anaphylactic response Effects 0.000 description 1
- 208000003455 anaphylaxis Diseases 0.000 description 1
- 230000000844 anti-bacterial effect Effects 0.000 description 1
- 229940088710 antibiotic agent Drugs 0.000 description 1
- 239000000427 antigen Substances 0.000 description 1
- 108091007433 antigens Proteins 0.000 description 1
- 102000036639 antigens Human genes 0.000 description 1
- 208000010668 atopic eczema Diseases 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 229940095731 candida albicans Drugs 0.000 description 1
- YZBQHRLRFGPBSL-RXMQYKEDSA-N carbapenem Chemical compound C1C=CN2C(=O)C[C@H]21 YZBQHRLRFGPBSL-RXMQYKEDSA-N 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 238000002512 chemotherapy Methods 0.000 description 1
- 230000001684 chronic effect Effects 0.000 description 1
- 235000019504 cigarettes Nutrition 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000037029 cross reaction Effects 0.000 description 1
- 230000006378 damage Effects 0.000 description 1
- 206010012601 diabetes mellitus Diseases 0.000 description 1
- 238000002405 diagnostic procedure Methods 0.000 description 1
- 238000006073 displacement reaction Methods 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000004043 dyeing Methods 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000004362 fungal culture Methods 0.000 description 1
- 230000002538 fungal effect Effects 0.000 description 1
- 208000024386 fungal infectious disease Diseases 0.000 description 1
- 239000003862 glucocorticoid Substances 0.000 description 1
- 230000002489 hematologic effect Effects 0.000 description 1
- 238000011134 hematopoietic stem cell transplantation Methods 0.000 description 1
- 230000002962 histologic effect Effects 0.000 description 1
- 210000000987 immune system Anatomy 0.000 description 1
- 230000004054 inflammatory process Effects 0.000 description 1
- 230000009545 invasion Effects 0.000 description 1
- 201000009085 invasive aspergillosis Diseases 0.000 description 1
- 230000003902 lesion Effects 0.000 description 1
- 210000004072 lung Anatomy 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000007479 molecular analysis Methods 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 230000004768 organ dysfunction Effects 0.000 description 1
- 238000004806 packaging method and process Methods 0.000 description 1
- 230000007170 pathology Effects 0.000 description 1
- 230000002685 pulmonary effect Effects 0.000 description 1
- 238000003906 pulsed field gel electrophoresis Methods 0.000 description 1
- 238000012113 quantitative test Methods 0.000 description 1
- 230000035484 reaction time Effects 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 238000012552 review Methods 0.000 description 1
- 230000000405 serological effect Effects 0.000 description 1
- 239000002689 soil Substances 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 239000008223 sterile water Substances 0.000 description 1
- 239000004575 stone Substances 0.000 description 1
- 230000009885 systemic effect Effects 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of for detecting the LAMP primer composition and its application of six kinds of aspergillus.Primer combination provided by the invention, 36 primers shown in sequence 1 to sequence 36 form.Whether primer combination provided by the invention can be applied in detection sample to be tested containing aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus and/or aspergillus niger and/or Aspergillus calidoustus.Primer combination identification provided by the invention has high specific and high sensitivity, easy, quick, accurate detection may be implemented for detecting 6 kinds of aspergillus of aspergillus.The present invention has great promotional value.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to a kind of LAMP primer composition for detecting six kinds of aspergillus and its
Using.
Background technique
Studies of invasive fungal infections (invasive fungal disease, IFD) is also known as invasive infections with fungi (invasive
Fungal infection, IFI), deep fungal infection (deep fungal infection, DFI), refer to fungi invade people
Body tissue, blood grow wherein and breed, cause inflammatory reaction, and cause the pathology of histologic lesion, organ dysfunction raw
Reason process.Over nearly twenty or thirty year, with the new technologies such as solid organ and hematopoietic stem cell transplantation, chemotherapy of tumors, immunosuppressor
Extensive use in clinic increases the disease incidence of studies of invasive fungal infections and case fatality rate year by year, and having become causes to be hospitalized
One of the main reason for death.ICU is moved in since infection studies of invasive fungal infections is mainly in, advanced age, diabetes, hematologic
Systemic disease, candida albicans field planting, invasion operation, using in the crowds such as antibacterials, glucocorticoid, immunosuppressor,
Immunity of organisms is low, and the severe death rate is high, therefore early detection to invasive infections with fungi and determines that infection bacteria species have pole
For important meaning.
Aspergillosis is usually caused by aspergillus (Aspergillus), frequently results in people's pulmonary disease or damage immune system.
About 2-5 μM size of the spore of Aspergillus easily suspends in air.Majority suck spore and can't catch, but immunity energy
Power is low or has the patient of pulmonary disease to have higher infection rate, causes infection or secondary infection, such as allergic bronchial song
Mycosis, anaphylaxis aspergillus nasosinusitis, aspergillus tumor, chronic pulmonary aspergilosis, invasive aspergillosis, Cutaneous Aspergillosis etc..2011
Liu is again peaceful to wait the multicenter Retrospective review to the pneumonomycosis patient of Chinese 1998 to 2007 clinical definites to show that lung is bent
Mildew is 37.9%, ranked first position.
Existing invasive infections with fungi detection method mainly includes routine inspection method and two kinds of special examined method.Wherein often
Rule inspection technique specifically includes that 1) fungi microscope inspection, i.e. direct smear dyeing microscopic examination；2) fungal culture is identified；3) histopathology
It learns and checks.Special examined method specifically includes that 1) Serological testing；2) Bio-molecular analysis.Wherein routine inspection method is still regarded
For the foundation stone for making a definite diagnosis invasive infections with fungi, but its that there are susceptibilitys is lower, operate complicated, negative findings can not rule out diagnosis,
The problems such as detection cycle longer (it is generally necessary to time of a few days to a few weeks), and lead to delay treatment and medication, increase the death rate
Deng；Serologic detection is difficult to exclude the inter-species antibody and antigen cross-reaction of the certain categories of fungi so as to cause erroneous judgement.Compare first two
Method, Protocols in Molecular Biology have the advantages that high specific and high accuracy, and can be illustrated from gene level fungal population it
Between and in taxonomic relation, thus be increasingly widely recognized and apply in recent years.The relevant molecule established at present
Learning diagnostic method has regular-PCR method, Pulse field gel electrophoresis (PFGE), Multilocus sequence typing (MLST), restricted
Fragment length polymorphism analyzes (RFLP), Real-Time Fluorescent Quantitative PCR Technique (RTFQ-PCR) etc., and shared problem is to experiment
Operate more demanding, detection time longer (2.5h-3h) left and right.Therefore, fast and accurately molecular diagnosis method is established, for clinic
There is provided early stage diagnosis and treatment foundation is the key that solve status.
Summary of the invention
The object of the present invention is to provide a kind of for detecting the LAMP primer composition and its application of six kinds of aspergillus.
Present invention firstly provides primer combinations, by primer sets I, primer sets II, primer sets III, primer sets IV, primer sets
V and primer sets VI form；
The primer sets I are by I-F3 of primer, I-B3 of primer, I-FIP of primer, I-LB of I-BIP of primer, I-LF of primer and primer
Composition；
I-the F3 of primer is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) sequence 1 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1
The DNA molecular of identical function；
I-the B3 of primer is following (a3) or (a4):
(a3) single strand dna shown in the sequence 2 of sequence table；
(a4) sequence 2 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2
The DNA molecular of identical function；
I-the FIP of primer is following (a5) or (a6):
(a5) single strand dna shown in the sequence 3 of sequence table；
(a6) sequence 3 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 3
The DNA molecular of identical function；
I-the BIP of primer is following (a7) or (a8):
(a7) single strand dna shown in the sequence 4 of sequence table；
(a8) sequence 4 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 4
The DNA molecular of identical function；
I-the LF of primer is following (a9) or (a10):
(a9) single strand dna shown in the sequence 5 of sequence table；
(a10) sequence 5 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 5
The DNA molecular of identical function；
I-the LB of primer is following (a11) or (a12):
(a11) single strand dna shown in the sequence 6 of sequence table；
(a12) sequence 6 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 6
The DNA molecular of identical function；
The primer sets II are by II-F3 of primer, II-B3 of primer, II-FIP of primer, II-BIP of primer, II-LF of primer and draw
II-LB of object composition；
II-the F3 of primer is following (b1) or (b2):
(b1) single strand dna shown in the sequence 7 of sequence table；
(b2) sequence 7 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 7
The DNA molecular of identical function；
II-the B3 of primer is following (b3) or (b4):
(b3) single strand dna shown in the sequence 8 of sequence table；
(b4) sequence 8 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 8
The DNA molecular of identical function；
II-the FIP of primer is following (b5) or (b6):
(b5) single strand dna shown in the sequence 9 of sequence table；
(b6) sequence 9 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 9
The DNA molecular of identical function；
II-the BIP of primer is following (b7) or (b8):
(b7) single strand dna shown in the sequence 10 of sequence table；
(b8) sequence 10 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 10
There is the DNA molecular of identical function；
II-the LF of primer is following (b9) or (b 10):
(b9) single strand dna shown in the sequence 11 of sequence table；
(b10) sequence 11 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 11
There is the DNA molecular of identical function；
II-the LB of primer is following (b11) or (b12):
(b11) single strand dna shown in the sequence 12 of sequence table；
(b12) sequence 12 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 12
There is the DNA molecular of identical function；
The primer sets III are by III-F3 of primer, III-B3 of primer, III-FIP of primer, III-BIP of primer, III-LF of primer and draw
III-LB of object composition；
III-the F3 of primer is following (c1) or (c2):
(c1) single strand dna shown in the sequence 13 of sequence table；
(c2) sequence 13 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 13
There is the DNA molecular of identical function；
III-the B3 of primer is following (c3) or (c4):
(c3) single strand dna shown in the sequence 14 of sequence table；
(c4) sequence 14 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 14
There is the DNA molecular of identical function；
III-the FIP of primer is following (c5) or (c6):
(c5) single strand dna shown in the sequence 15 of sequence table；
(c6) sequence 15 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 15
There is the DNA molecular of identical function；
III-the BIP of primer is following (c7) or (c8):
(c7) single strand dna shown in the sequence 16 of sequence table；
(c8) sequence 16 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 16
There is the DNA molecular of identical function；
III-the LF of primer is following (c9) or (c10):
(c9) single strand dna shown in the sequence 17 of sequence table；
(c10) sequence 17 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 17
There is the DNA molecular of identical function；
III-the LB of primer is following (c11) or (c12):
(c11) single strand dna shown in the sequence 18 of sequence table；
(c12) sequence 18 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 18
There is the DNA molecular of identical function；
The primer sets IV are by IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-BIP of primer, IV-LF of primer and draw
IV-LB of object composition；
IV-the F3 of primer is following (d1) or (d2):
(d1) single strand dna shown in the sequence 19 of sequence table；
(d2) sequence 19 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 19
There is the DNA molecular of identical function；
IV-the B3 of primer is following (d3) or (d4):
(d3) single strand dna shown in the sequence 20 of sequence table；
(d4) sequence 20 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 20
There is the DNA molecular of identical function；
IV-the FIP of primer is following (d5) or (d6):
(d5) single strand dna shown in the sequence 21 of sequence table；
(d6) sequence 21 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 21
There is the DNA molecular of identical function；
IV-the BIP of primer is following (d7) or (d8):
(d7) single strand dna shown in the sequence 22 of sequence table；
(d8) sequence 22 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 22
There is the DNA molecular of identical function；
IV-the LF of primer is following (d9) or (d10):
(d9) single strand dna shown in the sequence 23 of sequence table；
(d10) sequence 23 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 23
There is the DNA molecular of identical function；
IV-the LB of primer is following (d11) or (d12):
(d11) single strand dna shown in the sequence 24 of sequence table；
(d12) have by sequence 24 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 24
There is the DNA molecular of identical function；
The primer sets V are by V-F3 of primer, V-B3 of primer, V-FIP of primer, V-BIP of primer, V-LF of primer and draw
V-LB of object composition；
V-the F3 of primer is following (e1) or (e2):
(e1) single strand dna shown in the sequence 25 of sequence table；
(e2) sequence 25 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 25
There is the DNA molecular of identical function；
V-the B3 of primer is following (e3) or (e4):
(e3) single strand dna shown in the sequence 26 of sequence table；
(e4) sequence 26 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 26
There is the DNA molecular of identical function；
V-the FIP of primer is following (e5) or (e6):
(e5) single strand dna shown in the sequence 27 of sequence table；
(e6) sequence 27 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 27
There is the DNA molecular of identical function；
V-the BIP of primer is following (e7) or (e8):
(e7) single strand dna shown in the sequence 28 of sequence table；
(e8) sequence 28 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 28
There is the DNA molecular of identical function；
V-the LF of primer is following (e9) or (e10):
(e9) single strand dna shown in the sequence 29 of sequence table；
(e10) sequence 29 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 29
There is the DNA molecular of identical function；
V-the LB of primer is following (e11) or (e12):
(e11) single strand dna shown in the sequence 30 of sequence table；
(e12) sequence 30 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 30
There is the DNA molecular of identical function；
The primer sets VI are by VI-F3 of primer, VI-B3 of primer, VI-FIP of primer, VI-BIP of primer, VI-LF of primer and draw
VI-LB of object composition；
VI-the F3 of primer is following (f1) or (f2):
(f1) single strand dna shown in the sequence 31 of sequence table；
(f2) sequence 31 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 31
There is the DNA molecular of identical function；
VI-the B3 of primer is following (f3) or (f4):
(f3) single strand dna shown in the sequence 32 of sequence table；
(f4) sequence 32 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 32
There is the DNA molecular of identical function；
VI-the FIP of primer is following (f5) or (f6):
(f5) single strand dna shown in the sequence 33 of sequence table；
(f6) sequence 33 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 33
There is the DNA molecular of identical function；
VI-the BIP of primer is following (f7) or (f8):
(f7) single strand dna shown in the sequence 34 of sequence table；
(f8) sequence 34 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 34
There is the DNA molecular of identical function；
VI-the LF of primer is following (f9) or (f10):
(f9) single strand dna shown in the sequence 35 of sequence table；
(f10) sequence 35 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 35
There is the DNA molecular of identical function；
VI-the LB of primer is following (f11) or (f12):
(f11) single strand dna shown in the sequence 36 of sequence table；
(f12) sequence 36 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 36
There is the DNA molecular of identical function.
The purposes of the primer combination is any one in following (g1)-(g6):
(g1) identify aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and Aspergillus
calidoustus；
(g2) preparation is for identifying aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and Aspergillus
The kit of calidoustus；
(g3) identify tested microorganism whether be aspergillus fumigatus or Aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger or
Aspergillus calidoustus；
(g4) preparation is for identifying whether tested microorganism is aspergillus fumigatus or Aspergillus terreus or aspergillus nidulans or aspergillus flavus or black
The kit of aspergillus or Aspergillus calidoustus；
(g5) it whether detects in sample to be tested containing aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus
And/or aspergillus niger and/or Aspergillus calidoustus；
(g6) preparation for detect in sample to be tested whether containing aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or
The kit of aspergillus flavus and/or aspergillus niger and/or Aspergillus calidoustus.
The present invention also protects the application of the primer combination, is any one in following (g1)-(g6):
(g1) identify aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and Aspergillus
calidoustus；
(g2) preparation is for identifying aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and Aspergillus
The kit of calidoustus；
(g3) identify tested microorganism whether be aspergillus fumigatus or Aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger or
Aspergillus calidoustus；
(g4) preparation is for identifying whether tested microorganism is aspergillus fumigatus or Aspergillus terreus or aspergillus nidulans or aspergillus flavus or black
The kit of aspergillus or Aspergillus calidoustus；
(g5) it whether detects in sample to be tested containing aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus
And/or aspergillus niger and/or Aspergillus calidoustus；
(g6) preparation for detect in sample to be tested whether containing aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or
The kit of aspergillus flavus and/or aspergillus niger and/or Aspergillus calidoustus.
The present invention also protects the kit containing primer combination；The purposes of the kit is following (h1) or (h2)
Or (h3):
(h1) identify aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and Aspergillus
calidoustus；
(h2) identify tested microorganism whether be aspergillus fumigatus or Aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger or
Aspergillus calidoustus；
(h3) it whether detects in sample to be tested containing aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus
And/or aspergillus niger and/or Aspergillus calidoustus.
The present invention also protects the preparation method of the kit, includes the steps that individually packing each primer.
The present invention, which also protects, identifies aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and Aspergillus
The method of calidoustus is method A or method B.
The method A includes the following steps: that the primer sets are respectively adopted using the genomic DNA of aspergillus to be measured as template
Primer sets I to primer sets VI in conjunction carry out ring mediated isothermal amplification, if the primer sets I is used to may be implemented with the base
Because of the specific amplification that group DNA is template, aspergillus to be measured is or candidate is aspergillus fumigatus；If can be real using the primer sets II
Now using the genomic DNA as the specific amplification of template, aspergillus to be measured is or candidate is Aspergillus terreus；If using the primer
Group III may be implemented using the genomic DNA as the specific amplification of template, and aspergillus to be measured is or candidate is aspergillus nidulans；If
The primer sets IV are used to may be implemented using the genomic DNA as the specific amplification of template, aspergillus to be measured is or candidate is
Aspergillus flavus；If using the primer sets V to may be implemented using the genomic DNA as the specific amplification of template, aspergillus to be measured
For or candidate be aspergillus niger；If the primer sets VI is used to may be implemented to expand by the specificity of template of the genomic DNA
Increase, aspergillus to be measured is or candidate is Aspergillus calidoustus.
The method B include the following steps: to detect in aspergillus genomic DNA to be measured whether containing the primer sets I to drawing
The target sequence of object group VI, if containing the target sequence of the primer sets I in the genomic DNA, aspergillus to be measured is or candidate is
Aspergillus fumigatus；If containing the target sequence of the primer sets II in the genomic DNA, aspergillus to be measured is or candidate is Aspergillus terreus；
If containing the target sequence of the primer sets III in the genomic DNA, aspergillus to be measured is or candidate is aspergillus nidulans；If institute
The target sequence for containing the primer sets IV in genomic DNA is stated, aspergillus to be measured is or candidate is aspergillus flavus；If the genome
Contain the target sequence of the primer sets V in DNA, aspergillus to be measured is or candidate is aspergillus niger；If contained in the genomic DNA
There is the target sequence of the primer sets VI, aspergillus to be measured is or candidate is Aspergillus calidoustus.
The present invention, which also protects, identifies whether tested microorganism is aspergillus fumigatus or Aspergillus terreus or aspergillus nidulans or aspergillus flavus or black
The method of aspergillus or Aspergillus calidoustus is method C or method D.
The method C includes the following steps: that the primer is respectively adopted using the genomic DNA of tested microorganism as template
Primer sets I to primer sets VI in combination carry out ring mediated isothermal amplification, if the primer sets I is used to may be implemented with described
Genomic DNA is the specific amplification of template, and tested microorganism is or candidate is aspergillus fumigatus；If can using the primer sets II
To realize that, using the genomic DNA as the specific amplification of template, tested microorganism is or candidate is Aspergillus terreus；If using institute
Stating primer sets III may be implemented using the genomic DNA as the specific amplification of template, and tested microorganism is or candidate is structure nest
Aspergillus；If the primer sets IV is used to may be implemented using the genomic DNA as the specific amplification of template, tested microorganism
For or candidate be aspergillus flavus；If the primer sets V is used to may be implemented to expand by the specificity of template of the genomic DNA
Increase, tested microorganism is or candidate is aspergillus niger；If the primer sets VI is used to may be implemented using the genomic DNA as mould
The specific amplification of plate, tested microorganism is or candidate is Aspergillus calidoustus, if using primer pair I to
Primer sets VI can not achieve using the genomic DNA as the specific amplification of template, and tested microorganism is non-aspergillus fumigatus and non-
Aspergillus terreus and non-aspergillus nidulans and non-aspergillus flavus and non-aspergillus niger and non-Aspergillus calidoustus.
The method D include the following steps: detect tested microorganism genomic DNA in whether containing the primer sets I to
The target sequence of primer sets VI, if containing the target sequence of the primer sets I in the genomic DNA, tested microorganism is or waits
It is selected as aspergillus fumigatus；If containing the target sequence of the primer sets II in the genomic DNA, tested microorganism is or candidate is soil
Aspergillus；If containing the target sequence of the primer sets III in the genomic DNA, tested microorganism is or candidate is that structure nest is bent
It is mould；If containing the target sequence of the primer sets IV in the genomic DNA, tested microorganism is or candidate is aspergillus flavus；Such as
Contain the target sequence of the primer sets V in genomic DNA described in fruit, tested microorganism is or candidate is aspergillus niger；If described
Contain the target sequence of the primer sets VI in genomic DNA, tested microorganism is or candidate is Aspergillus
calidoustus；If not containing the target sequence of the primer sets I any primer sets into primer sets VI in the genomic DNA
Column, tested microorganism are non-aspergillus fumigatus and non-Aspergillus terreus and non-aspergillus nidulans and non-aspergillus flavus and non-aspergillus niger and non-
Aspergillus calidoustus。
The present invention also protect in detection sample to be tested whether containing aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or
The method of aspergillus flavus and/or aspergillus niger and/or Aspergillus calidoustus is method E or method F.
The method E includes the following steps: to be respectively adopted in the primer combination using the total DNA of sample to be tested as template
Primer sets I to primer sets VI carry out ring mediated isothermal amplification, if the primer sets I is used to may be implemented with the total DNA
For the specific amplification of template, contain aspergillus fumigatus in sample to be tested；If using the primer sets II may be implemented with described total
DNA is the specific amplification of template, contains Aspergillus terreus in sample to be tested；If the primer sets III is used to may be implemented with described
Total DNA is the specific amplification of template, contains aspergillus nidulans in sample to be tested；If use the primer sets IV and may be implemented with
The total DNA is the specific amplification of template, contains aspergillus flavus in sample to be tested；If may be implemented using the primer sets V
Using the total DNA as the specific amplification of template, contain aspergillus niger in sample to be tested；If can be real using the primer sets VI
Now using the total DNA as the specific amplification of template, Aspergillus calidoustus is contained in sample to be tested, if adopted
It can not achieve with primer pair I to primer sets VI using the total DNA as the specific amplification of template, cigarette do not contained in sample to be tested
It aspergillus and does not contain Aspergillus terreus and does not contain aspergillus nidulans and do not contain aspergillus flavus and do not contain aspergillus niger and do not contain
Aspergillus calidoustus。
Whether the method F includes the following steps: to detect in sample to be tested total DNA containing the primer sets I to primer sets
VI target sequence contains aspergillus fumigatus in sample to be tested if containing the target sequence of the primer sets I in the total DNA；If institute
The target sequence for containing the primer sets II in total DNA is stated, contains Aspergillus terreus in sample to be tested；If containing in the total DNA
The target sequence of primer sets III is stated, contains aspergillus nidulans in sample to be tested；If containing the target of the primer sets IV in the total DNA
Sequence contains aspergillus flavus in sample to be tested；If containing the target sequence of the primer sets V in the total DNA, in sample to be tested
Contain aspergillus niger；If containing the target sequence of the primer sets VI in the total DNA, contain Aspergillus in sample to be tested
calidoustus；If not containing the target sequence of any primer sets into primer sets VI of primer sets I in the total DNA, to
Without containing aspergillus fumigatus and without containing Aspergillus terreus and without containing aspergillus nidulans and without containing aspergillus flavus and without containing black song in test sample sheet
It is mould and do not contain Aspergillus calidoustus.
In any description above method, when carrying out ring mediated isothermal amplification using the primer sets I, primer in reaction system
I-F3, I-B3 of primer, I-FIP of primer, I-LB of I-BIP of primer, I-LF of primer and primer molar concentration be followed successively by 0.5 μM, 0.5
μM、2μM、2μM、1μM、1μM。
In any description above method, when carrying out ring mediated isothermal amplification using the primer sets II, draw in reaction system
II-F3 of object, II-B3 of primer, II-FIP of primer, II-LB of II-BIP of primer, II-LF of primer and primer molar concentration be followed successively by
0.5μM、0.5μM、2μM、2μM、1μM、1μM。
In any description above method, when carrying out ring mediated isothermal amplification using the primer sets III, draw in reaction system
III-F3 of object, III-B3 of primer, III-FIP of primer, III-LB of III-BIP of primer, III-LF of primer and primer molar concentration be followed successively by
0.5μM、0.5μM、2μM、2μM、1μM、1μM。
In any description above method, when carrying out ring mediated isothermal amplification using the primer sets IV, draw in reaction system
IV-F3 of object, IV-B3 of primer, IV-FIP of primer, IV-LB of IV-BIP of primer, IV-LF of primer and primer molar concentration be followed successively by
0.5μM、0.5μM、2μM、2μM、1μM、1μM。
In any description above method, when carrying out ring mediated isothermal amplification using the primer sets V, draw in reaction system
V-F3 of object, V-B3 of primer, V-FIP of primer, V-LB of V-BIP of primer, V-LF of primer and primer molar concentration be followed successively by
0.5μM、0.5μM、2μM、2μM、1μM、1μM。
In any description above method, when carrying out ring mediated isothermal amplification using the primer sets VI, draw in reaction system
VI-F3 of object, VI-B3 of primer, VI-FIP of primer, VI-LB of VI-BIP of primer, VI-LF of primer and primer molar concentration be followed successively by
0.5μM、0.5μM、2μM、2μM、1μM、1μM。
In any description above method, loop-mediated isothermal amplification condition are as follows: 65 DEG C of constant temperature 50min.
The present invention also protects the primer sets I or primer sets II or primer sets III or primer sets IV or primer sets V or draws
Object group VI.
The present invention also protects application of the primer sets I in reagent preparation box A, or, the primer sets II are tried in preparation
Application in agent box B, or, application of the primer sets III in reagent preparation box C, or, the primer sets IV are in reagent preparation
Application in box D, or, application of the primer sets V in reagent preparation box E, or, the primer sets VI are in reagent preparation box F
In application；
The purposes of the kit A is following (i1) or (i2):
(i1) identify whether tested microorganism is aspergillus fumigatus；
(i2) detect in sample to be tested whether contain aspergillus fumigatus；
The purposes of the kit B is following (i3) or (i4):
(i3) identify whether tested microorganism is Aspergillus terreus；
(i4) detect in sample to be tested whether contain Aspergillus terreus；
The purposes of the kit C is following (i5) or (i6):
(i5) identify whether tested microorganism is aspergillus nidulans；
(i6) detect in sample to be tested whether contain aspergillus nidulans；
The purposes of the kit D is following (i7) or (i8):
(i7) identify whether tested microorganism is aspergillus flavus；
(i8) detect in sample to be tested whether contain aspergillus flavus；
The purposes of the kit E is following (i9) or (i10):
(i9) identify whether tested microorganism is aspergillus niger；
(i10) detect in sample to be tested whether contain aspergillus niger；
The purposes of the kit F is following (i11) or (i12):
(i11) identify whether tested microorganism is Aspergillus calidoustus；
(i12) it detects in sample to be tested and whether contains Aspergillus calidoustus.
The present invention also protects the kit A containing the primer sets I, or, contain the kit B of the primer sets II,
Or, containing the kit C of the primer sets III, or, containing the kit D of the primer sets IV, or, containing the primer sets V
Kit E, or, contain the primer sets VI kit F；
The purposes of the kit A is following (i1) or (i2):
(i1) identify whether tested microorganism is aspergillus fumigatus；
(i2) detect in sample to be tested whether contain aspergillus fumigatus；
The purposes of the kit B is following (i3) or (i4):
(i3) identify whether tested microorganism is Aspergillus terreus；
(i4) detect in sample to be tested whether contain Aspergillus terreus；
The purposes of the kit C is following (i5) or (i6):
(i5) identify whether tested microorganism is aspergillus nidulans；
(i6) detect in sample to be tested whether contain aspergillus nidulans；
The purposes of the kit D is following (i7) or (i8):
(i7) identify whether tested microorganism is aspergillus flavus；
(i8) detect in sample to be tested whether contain aspergillus flavus；
The purposes of the kit E is following (i9) or (i10):
(i9) identify whether tested microorganism is aspergillus niger；
(i10) detect in sample to be tested whether contain aspergillus niger；
The purposes of the kit F is following (i11) or (i12):
(i11) identify whether tested microorganism is Aspergillus calidoustus；
(i12) it detects in sample to be tested and whether contains Aspergillus calidoustus.
Any description above aspergillus to be measured or tested microorganism concretely aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, Huang Qu
Mould, aspergillus niger or Aspergillus calidoustus.The aspergillus fumigatus concretely CGMCC, strain number: 3.08027
Aspergillus fumigatus.The Aspergillus terreus concretely CGMCC, strain number: 3.08115 Aspergillus terreus.The aspergillus nidulans are concretely
CGMCC, strain number: 3.06379 aspergillus nidulans.The aspergillus flavus concretely CGMCC, strain number: 3.06434 Huang
Aspergillus.The aspergillus niger concretely CGMCC, strain number: 3.06478 aspergillus niger.
The sputum of any description above sample to be tested concretely people (Homo sapiens).
Loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) is in recent years
Come a kind of sensitive, special, the simple, fast nucleic acid amplification technologies developed, principle is that have strand-displacement activity in one kind
Archaeal dna polymerase under the action of, identify 6-8 region 4-6 primer, under isothermal conditions quickly, specifically expand purpose
Gene can be applied to and fast and accurately detect common Carbapenem-resistant gene.LAMP method has sensitivity
Height, specificity is good, the reaction time is short, determines that result is convenient, does not need the advantages such as expensive instrument.
Primer provided by the invention combination identification has high specific and highly sensitive for detecting six kinds of common Aspergillus
Easy, quick, accurate detection may be implemented in degree.The present invention has great promotional value.
Detailed description of the invention
Fig. 1 is the testing result that primer sets I are used in embodiment 2.
Fig. 2 is the testing result that primer sets II are used in embodiment 2.
Fig. 3 is the testing result that primer sets III are used in embodiment 2.
Fig. 4 is the testing result that primer sets IV are used in embodiment 2.
Fig. 5 is the testing result that primer sets V are used in embodiment 2.
Fig. 6 is the testing result that primer sets VI are used in embodiment 2.
Fig. 7 is the testing result of sample one in embodiment 4.
Fig. 8 is the testing result of sample two in embodiment 4.
Fig. 9 is the testing result of sample three in embodiment 4.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even
Mean value.
Reaction solution is Capitalbio Corporation Co., Ltd.'s product, catalog number CP.440020.
The calculation method of DNA copy number is as follows:
50 μ g/ml of 1A260 absorbance value=ds DNA；
Nucleic acid concentration=(OD260) × (extension rate) × (50)=x ng/ μ l；
Average molecular weight (MW) representative gram/mol, unit dalton (dolton), i.e. 1dolton=1g/mol；
Mole=6.02 × 1023；
Average molecular weight (MW): dsDNA=(base number) × (660 dalton/base)；
Copy number calculation formula:
(6.02×1023Copies/ moles) × (l × 10 xng/ μ-9)/(DNA length × 660)=copies/ μ l.
The preparation that embodiment 1, the primer for detecting six kinds of aspergillus combine
The primer combination for detecting six kinds of aspergillus is made of six LAMP primer groups, and each primer sets are for detecting a koji
It is mould.
It is following (5 ' → 3 ') for detecting aspergillus fumigatus primer sets:
I-F3 of primer (sequence 1): GGATGCTGACAACAACGG；
I-B3 of primer (sequence 2): GGTCGAAGACCTTGAAAGCT；
I-FIP of primer (sequence 3): TGTTCTCTCCCCTCCCGAGCACCATCGATTTCCCCGG；
I-BIP of primer (sequence 4): ATCAGAATTCCTTACCATGATGGCCCGAATTTCCTCTTCGGAGTC；
I-LF of primer (sequence 5): TCATACCGAAAGTATCACATA；
I-LB of primer (sequence 6): TCGGAAGATGAAGGACAC.
It is following (5 ' → 3 ') for detecting Aspergillus terreus primer sets:
II-F3 of primer (sequence 7): GATTGCCTCATGCGACC；
II-B3 of primer (sequence 8): TTGTTGTCAGCATCAACCTC；
II-FIP of primer (sequence 9): GGCCTACATGGTGTTAAATGATCGAATCGATTGCATCGTTCTATGTCG；
II-BIP of primer (sequence 10): CACCACCAAGGAGCTGGGAGTTGATCATGTCCTGGAGC；
II-LF of primer (sequence 11): ACAGAAGATAAAGTCAAGACTC；
II-LB of primer (sequence 12): CAGAACCCCTCCGAGT.
It is following (5 ' → 3 ') for detecting aspergillus nidulans primer sets:
III-F3 of primer (sequence 13): ACGCGAACTCCCCA；
III-B3 of primer (sequence 14): GTCATGACGTGACGC；
III-FIP of primer (sequence 15): CTGGCCATCATGGTAAGGAACTCATCTACTTCGCACCAGC；
III-BIP of primer (sequence 16): AGGACACCGATTCCGAGGAGAGCAGCGGAGATGAAAC；
III-LF of primer (sequence 17): TTAGCATTAGTACATTTCT；
III-LB of primer (sequence 18): GGCGTTCAAGGTCT.
It is following (5 ' → 3 ') for detecting aspergillus flavus primer sets:
IV-F3 of primer (sequence 19): ATCTCGGATGTGTCCTGTT；
IV-B3 of primer (sequence 20): GATCGGAGGAGCCATTGT；
IV-FIP of primer (sequence 21): ACACACCGGAGCCGTCAAGATATCTGCCACATGTTTGCT；
IV-BIP of primer (sequence 22): AAGTACAGCCTGTATACACCTCGACCTTGCCGTCAGATCCATTC；
IV-LF of primer (sequence 23): GGTTTGCCTGCAAAGTTG；
IV-LB of primer (sequence 24): ACGAACGACGACCATATG.
It is following (5 ' → 3 ') for detecting aspergillus niger primer sets:
V-F3 of primer (sequence 25): CCAGATCACCACCAAGGAG；
V-B3 of primer (sequence 26): CGAGCCATCATGGTAAGGAATT；
V-FIP of primer (sequence 27): GTTGATCATGTCCTGAAGCTCAGACCTCGGCACTGTGATGCG；
V-BIP of primer (sequence 28): GACGCTGACAACAACGGAACGATCACAATCCAGCCCGCAT；
V-LF of primer (sequence 29): GGTTCTGGCCAAGGGAG；
V-LB of primer (sequence 30): CGACTTCCCCGGTATGT.
It is following (5 ' → 3 ') for detecting Aspergillus calidoustus primer sets:
VI-F3 of primer (sequence 31): CCCTATTTGTAAGTCG；
VI-B3 of primer (sequence 32): CCTAAACGCATTCACAC；
VI-FIP of primer (sequence 33): TCACCATCCTTGTCCTGTTCAAAGCACCGATCG；
VI-BIP of primer (sequence 34): ACTCCGGCAACGTTAAGGCTAATTGATGGGGCTA；
VI-LF of primer (sequence 35): GAAAAGGGTAAATAA；
VI-LB of primer (sequence 36): CGCATACGCTCAGC.
Primer sets for detecting aspergillus fumigatus are named as primer sets I.
Primer sets for detecting Aspergillus terreus are named as primer sets II.
Primer sets for detecting aspergillus nidulans are named as primer sets III.
Primer sets for detecting aspergillus flavus are named as primer sets IV.
Primer sets for detecting aspergillus niger are named as primer sets V.
Primer sets for detecting Aspergillus calidoustus are named as primer sets VI.
In primer combination, the respectively independent packaging of each single stranded DNA.
In primer sets I, I-F3 of primer, I-B3 of primer, I-FIP of primer, I-BIP of primer, I-LF of primer and primer I-LB
Molar ratio is 0.5:0.5:2:2:1:1；
In primer sets II, II-F3 of primer, II-B3 of primer, II-FIP of primer, II-BIP of primer, II-LF of primer and primer
The molar ratio of II-LB is 0.5:0.5:2:2:1:1；
In primer sets III, III-F3 of primer, III-B3 of primer, III-FIP of primer, III-BIP of primer, III-LF of primer and primer
The molar ratio of III-LB is 0.5:0.5:2:2:1:1.
In primer sets IV, IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-BIP of primer, IV-LF of primer and primer
The molar ratio of IV-LB is 0.5:0.5:2:2:1:1.
In primer sets V, V-F3 of primer, V-B3 of primer, V-FIP of primer, V-BIP of primer, V-LF of primer and primer
The molar ratio of V-LB is 0.5:0.5:2:2:1:1.
In primer sets VI, VI-F3 of primer, VI-B3 of primer, VI-FIP of primer, VI-BIP of primer, VI-LF of primer and primer
The molar ratio of VI-LB is 0.5:0.5:2:2:1:1.
Embodiment 2, specificity
One, the preparation of sample to be tested
Sample to be tested 1: aspergillus fumigatus (CGMCC, strain number: 3.08027) genomic DNA；
Sample to be tested 2: Aspergillus terreus (CGMCC, strain number: 3.08115) genomic DNA；
Sample to be tested 3: aspergillus nidulans (CGMCC, strain number: 3.06379) genomic DNA；
Sample to be tested 4: aspergillus flavus (CGMCC, strain number: 3.06434) genomic DNA；
Sample to be tested 5: aspergillus niger (CGMCC, strain number: 3.06478) genomic DNA；
Sample to be tested 6:Aspergillus calidoustus detects gene plasmid DNA；Plasmid the preparation method is as follows:
Being inserted into No. Genebank in the site SacI of pUC57 plasmid (Sangon Biotech (Shanghai) Co., Ltd.) is
The DNA molecular of HE650910.1, obtains recombinant plasmid, which is Aspergillus calidoustus detection gene matter
Grain.
Two, the detection of sample to be tested
Using each sample to be tested in step 1 as template, the primer sets I of the preparation of embodiment 1 are respectively adopted, primer sets II, draw
Object group III, primer sets IV, primer sets V and primer sets VI carry out ring mediated isothermal amplification detection to template.
Reaction system (10 μ L): 7.0 μ L reaction solutions (Capitalbio Corporation Co., Ltd.'s product, catalog number:
CP.440020), 1 μ L primer mixture, 1 μ L template DNA (5pg-50pg), moisturizing to 10 μ L.Primer mixture, that is, primer sets I,
The mixture of each primer composition in primer sets II, primer sets III, primer sets IV, primer sets V or primer sets VI.Reactant
In system, the final concentration of primers F 3 and primer B3 are 0.5 μM, and the final concentration of primers F IP and primer BIP are 2 μM, primer LF and
The final concentration of primer LB is 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
In reaction process, fluorescence signal is detected using fluorescent PCR instrument.
If occurring positive amplification curve (i.e. amplification curve is typical " S type " amplification curve) in 50min, show anti-
Answer the corresponding gene group content in system that can be detected.If not occurring positive amplification curve in 50min (to expand
Increasing curve is typical " S type " amplification curve), show that the corresponding gene group content in reaction system cannot be detected.
Using the result is shown in Figure 1 of primer sets I.The result shows that only when sample to be tested is that aspergillus fumigatus genomic DNA is (to be measured
Sample 1) when show positive amplification curve (i.e. amplification curve be typical " S type " amplification curve).When sample to be tested be to
Positive amplification curve is not shown when test sample sheet 2,3,4,5 or 6.
Result using primer sets II is shown in Fig. 2.The result shows that only when sample to be tested is that Aspergillus terreus genomic DNA is (to be measured
Sample 2) when show positive amplification curve (i.e. amplification curve be typical " S type " amplification curve).When sample to be tested be to
Positive amplification curve is not shown when test sample sheet 1,3,4,5 or 6.
Result using primer sets III is shown in Fig. 3.The result shows that only when sample to be tested be aspergillus nidulans genomic DNA (to
Test sample sheet 3) when show positive amplification curve (i.e. amplification curve be typical " S type " amplification curve).When sample to be tested is
Positive amplification curve is not shown when sample to be tested 1,2,4,5 or 6.
Result using primer sets IV is shown in Fig. 4.The result shows that only when sample to be tested is that aspergillus flavus genomic DNA is (to be measured
Sample 4) when show positive amplification curve (i.e. amplification curve be typical " S type " amplification curve).When sample to be tested be to
Positive amplification curve is not shown when test sample sheet 1,2,3,5 or 6.
Result using primer sets V is shown in Fig. 5.The result shows that only when sample to be tested is that aspergillus niger genomic DNA is (to be measured
Sample 5) when show positive amplification curve (i.e. amplification curve be typical " S type " amplification curve).When sample to be tested be to
Positive amplification curve is not shown when test sample sheet 1,2,3,4 or 6.
Result using primer sets VI is shown in Fig. 6.The result shows that only when sample to be tested is Aspergillus
Calidoustus shows that (i.e. amplification curve is typical case to positive amplification curve when detecting gene plasmid DNA (sample to be tested 6)
" S type " amplification curve).Positive amplification curve is not shown when sample to be tested is sample to be tested 1,2,3,4 or 5.
The above result shows that six primer sets in aspergillus primer combination provided by the invention respectively have its target gene
Very high specificity.
Embodiment 3, sensitivity
Sample to be tested 1: aspergillus fumigatus (CGMCC, strain number: 3.08027) genomic DNA；
Sample to be tested 2: Aspergillus terreus (CGMCC, strain number: 3.08115) genomic DNA；
Sample to be tested 3: aspergillus nidulans (CGMCC, strain number: 3.06379) genomic DNA；
Sample to be tested 4: aspergillus flavus (CGMCC, strain number: 3.06434) genomic DNA；
Sample to be tested 5: aspergillus niger (CGMCC, strain number: 3.06478) genomic DNA；
Sample to be tested 6:Aspergillus calidoustus detects gene plasmid DNA；Plasmid the preparation method is as follows:
Being inserted into No. Genebank in the site SacI of pUC57 plasmid (Sangon Biotech (Shanghai) Co., Ltd.) is
The DNA molecular of HE650910.1, obtains recombinant plasmid, which is Aspergillus calidoustus detection gene matter
Grain.
1, sample to be tested is subjected to gradient dilution with sterile water, obtains each dilution.
2, the dilution obtained using step 1 is respectively adopted the primer sets I of the preparation of embodiment 1, primer sets II, drawn as template
Object group III, primer sets IV, primer sets V and primer sets VI carry out ring mediated isothermal amplification.
When sample to be tested is sample to be tested 1, ring mediated isothermal amplification is carried out using primer sets I.Sample to be tested is to test sample
When sheet 2, ring mediated isothermal amplification is carried out using primer sets II.When sample to be tested is sample to be tested 3, ring is carried out using primer sets III
Mediated isothermality amplification.When sample to be tested is sample to be tested 4, ring mediated isothermal amplification is carried out using primer sets IV.Sample to be tested is
When sample to be tested 5, ring mediated isothermal amplification is carried out using primer sets V.When sample to be tested is sample to be tested 6, using primer sets VI
Carry out ring mediated isothermal amplification.
Reaction system (10 μ L): 7.0 μ L reaction solutions (Capitalbio Corporation Co., Ltd.'s product, catalog number:
CP.440020), (genome copy numbers contained in 1 μ L dilution are respectively 10 for 1 μ L primer mixture, 1 μ L dilution3、5×
102、102、5×101Or 101), moisturizing to 10 μ L.Primer mixture, that is, primer sets I, primer sets II, primer sets III, primer sets
IV, the mixture of primer sets V or each primer composition in primer sets VI.In reaction system, the end of primers F 3 and primer B3 are dense
Degree is 0.5 μM, and the final concentration of primers F IP and primer BIP are 2 μM, and the final concentration of primer LF and primer LB are 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
In reaction process, fluorescence signal is detected using fluorescent PCR instrument.
If occurring positive amplification curve (i.e. amplification curve is typical " S type " amplification curve) in 50min, show anti-
Answer the corresponding gene group content in system that can be detected.If not occurring positive amplification curve in 50min (to expand
Increasing curve is typical " S type " amplification curve), show that the corresponding gene group content in reaction system cannot be detected.
The results show that the sensitivity that primer sets I detect target gene is 5 × 102A copy number/reaction system, primer sets
The sensitivity of II detection target gene is 5 × 101A copy number/reaction system, primer sets III detect the sensitivity of target gene
It is 5 × 102A copy number/reaction system, the sensitivity that primer sets IV detect target gene is 5 × 102A copy number/reactant
System, the sensitivity that primer sets V detect target gene is 5 × 102A copy number/reaction system, primer sets VI detect target gene
Sensitivity be 5 × 102A copy number/reaction system.
Embodiment 4, clinical sample detection
Sample to be tested is following sample one, sample two or sample three:
Sample one: the sputum of people of the identification confirmation containing aspergillus fumigatus has been sequenced；
Sample two: the sputum of people of the identification confirmation containing aspergillus flavus has been sequenced；
Sample three: the sputum of people of the identification confirmation containing aspergillus niger has been sequenced.
1, the total DNA of sample to be tested is extracted.
2, each primer sets of the preparation of embodiment 1 are respectively adopted to these three samples as template in the total DNA extracted using step 1
This progress ring mediated isothermal amplification, each primer combination detect three kinds of samples.
Reaction system and reaction condition are the same as embodiment 2.
In reaction process, fluorescence signal is detected using fluorescent PCR instrument.
If occurring positive amplification curve (i.e. amplification curve is typical " S type " amplification curve) in 50min, show anti-
Answer the corresponding gene group content in system that can be detected.If not occurring positive amplification curve in 50min (to expand
Increasing curve is typical " S type " amplification curve), show that the corresponding gene group content in reaction system cannot be detected.
The result of sample one is shown in Fig. 7.Positive amplification curve is shown when the result shows that only detecting using primer sets I.
Positive amplification curve is not shown when using other several primer sets other than primer sets I, it is consistent with actual conditions.
The result of sample two is shown in Fig. 8.Positive amplification song is shown when the result shows that only detecting using primer sets IV
Line.Positive amplification curve is not shown when using other several primer sets other than primer sets IV, with actual conditions one
It causes.
The result of sample three is shown in Fig. 9.Positive amplification song is shown when the result shows that only detecting using primer sets V
Line.Positive amplification curve is not shown when using other several primer sets other than primer sets V, with actual conditions one
It causes.
It is detected the above result shows that 6 kinds of common aspergillus can be carried out using aspergillus primer provided by the invention combination, as a result
Accurately and reliably.
<110>Capitalbio Corporation Co., Ltd.
<120>for detecting the LAMP primer composition and its application of six kinds of aspergillus
<160> 36
<210> 1
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 1
ggatgctgac aacaacgg 18
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 2
ggtcgaagac cttgaaagct 20
<210> 3
<211> 37
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 3
tgttctctcc cctcccgagc accatcgatt tccccgg 37
<210> 4
<211> 45
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 4
atcagaattc cttaccatga tggcccgaat ttcctcttcg gagtc 45
<210> 5
<211> 21
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 5
tcataccgaa agtatcacat a 21
<210> 6
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 6
tcggaagatg aaggacac 18
<210> 7
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 7
gattgcctca tgcgacc 17
<210> 8
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 8
ttgttgtcag catcaacctc 20
<210> 9
<211> 48
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 9
ggcctacatg gtgttaaatg atcgaatcga ttgcatcgtt ctatgtcg 48
<210> 10
<211> 38
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 10
caccaccaag gagctgggag ttgatcatgt cctggagc 38
<210> 11
<211> 22
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 11
acagaagata aagtcaagac tc 22
<210> 12
<211> 16
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 12
cagaacccct ccgagt 16
<210> 13
<211> 14
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 13
acgcgaactc ccca 14
<210> 14
<211> 15
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 14
gtcatgacgt gacgc 15
<210> 15
<211> 40
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 15
ctggccatca tggtaaggaa ctcatctact tcgcaccagc 40
<210> 16
<211> 37
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 16
aggacaccga ttccgaggag agcagcggag atgaaac 37
<210> 17
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 17
ttagcattag tacatttct 19
<210> 18
<211> 14
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 18
ggcgttcaag gtct 14
<210> 19
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 19
atctcggatg tgtcctgtt 19
<210> 20
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 20
gatcggagga gccattgt 18
<210> 21
<211> 39
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 21
acacaccgga gccgtcaaga tatctgccac atgtttgct 39
<210> 22
<211> 44
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 22
aagtacagcc tgtatacacc tcgaccttgc cgtcagatcc attc 44
<210> 23
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 23
ggtttgcctg caaagttg 18
<210> 24
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 24
acgaacgacg accatatg 18
<210> 25
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 25
ccagatcacc accaaggag 19
<210> 26
<211> 22
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 26
cgagccatca tggtaaggaa tt 22
<210> 27
<211> 42
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 27
gttgatcatg tcctgaagct cagacctcgg cactgtgatg cg 42
<210> 28
<211> 40
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 28
gacgctgaca acaacggaac gatcacaatc cagcccgcat 40
<210> 29
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 29
ggttctggcc aagggag 17
<210> 30
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 30
cgacttcccc ggtatgt 17
<210> 31
<211> 16
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 31
ccctatttgt aagtcg 16
<210> 32
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 32
cctaaacgca ttcacac 17
<210> 33
<211> 33
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 33
tcaccatcct tgtcctgttc aaagcaccga tcg 33
<210> 34
<211> 34
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 34
actccggcaa cgttaaggct aattgatggg gcta 34
<210> 35
<211> 15
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 35
gaaaagggta aataa 15
<210> 36
<211> 14
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 36
cgcatacgct cagc 14
Claims (10)
1. primer combines, it is made of primer sets I, primer sets II, primer sets III, primer sets IV, primer sets V and primer sets VI；
The primer sets I are by I-F3 of primer, I-B3 of primer, I-FIP of primer, I-LB group of I-BIP of primer, I-LF of primer and primer
At；
I-the F3 of primer is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) have by sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1 identical
The DNA molecular of function；
I-the B3 of primer is following (a3) or (a4):
(a3) single strand dna shown in the sequence 2 of sequence table；
(a4) have by sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2 identical
The DNA molecular of function；
I-the FIP of primer is following (a5) or (a6):
(a5) single strand dna shown in the sequence 3 of sequence table；
(a6) have by sequence 3 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 3 identical
The DNA molecular of function；
I-the BIP of primer is following (a7) or (a8):
(a7) single strand dna shown in the sequence 4 of sequence table；
(a8) have by sequence 4 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 4 identical
The DNA molecular of function；
I-the LF of primer is following (a9) or (a10):
(a9) single strand dna shown in the sequence 5 of sequence table；
(a10) have by sequence 5 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 5 identical
The DNA molecular of function；
I-the LB of primer is following (a11) or (a12):
(a11) single strand dna shown in the sequence 6 of sequence table；
(a12) have by sequence 6 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 6 identical
The DNA molecular of function；
The primer sets II are by II-F3 of primer, II-B3 of primer, II-FIP of primer, II-BIP of primer, II-LF of primer and primer
II-LB composition；
II-the F3 of primer is following (b1) or (b2):
(b1) single strand dna shown in the sequence 7 of sequence table；
(b2) have by sequence 7 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 7 identical
The DNA molecular of function；
II-the B3 of primer is following (b3) or (b4):
(b3) single strand dna shown in the sequence 8 of sequence table；
(b4) have by sequence 8 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 8 identical
The DNA molecular of function；
II-the FIP of primer is following (b5) or (b6):
(b5) single strand dna shown in the sequence 9 of sequence table；
(b6) have by sequence 9 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 9 identical
The DNA molecular of function；
II-the BIP of primer is following (b7) or (b8):
(b7) single strand dna shown in the sequence 10 of sequence table；
(b8) there is phase by sequence 10 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 10
The DNA molecular of congenerous；
II-the LF of primer is following (b9) or (b 10):
(b9) single strand dna shown in the sequence 11 of sequence table；
(b10) there is phase by sequence 11 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 11
The DNA molecular of congenerous；
II-the LB of primer is following (b11) or (b12):
(b11) single strand dna shown in the sequence 12 of sequence table；
(b12) there is phase by sequence 12 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 12
The DNA molecular of congenerous；
The primer sets III are by III-F3 of primer, III-B3 of primer, III-FIP of primer, III-BIP of primer, III-LF of primer and primer
III-LB composition；
III-the F3 of primer is following (c1) or (c2):
(c1) single strand dna shown in the sequence 13 of sequence table；
(c2) there is phase by sequence 13 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 13
The DNA molecular of congenerous；
III-the B3 of primer is following (c3) or (c4):
(c3) single strand dna shown in the sequence 14 of sequence table；
(c4) there is phase by sequence 14 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 14
The DNA molecular of congenerous；
III-the FIP of primer is following (c5) or (c6):
(c5) single strand dna shown in the sequence 15 of sequence table；
(c6) there is phase by sequence 15 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 15
The DNA molecular of congenerous；
III-the BIP of primer is following (c7) or (c8):
(c7) single strand dna shown in the sequence 16 of sequence table；
(c8) there is phase by sequence 16 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 16
The DNA molecular of congenerous；
III-the LF of primer is following (c9) or (c10):
(c9) single strand dna shown in the sequence 17 of sequence table；
(c10) there is phase by sequence 17 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 17
The DNA molecular of congenerous；
III-the LB of primer is following (c11) or (c12):
(c11) single strand dna shown in the sequence 18 of sequence table；
(c12) there is phase by sequence 18 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 18
The DNA molecular of congenerous；
The primer sets IV are by IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-BIP of primer, IV-LF of primer and primer
IV-LB composition；
IV-the F3 of primer is following (d1) or (d2):
(d1) single strand dna shown in the sequence 19 of sequence table；
(d2) there is phase by sequence 19 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 19
The DNA molecular of congenerous；
IV-the B3 of primer is following (d3) or (d4):
(d3) single strand dna shown in the sequence 20 of sequence table；
(d4) there is phase by sequence 20 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 20
The DNA molecular of congenerous；
IV-the FIP of primer is following (d5) or (d6)；
(d5) single strand dna shown in the sequence 21 of sequence table；
(d6) there is phase by sequence 21 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 21
The DNA molecular of congenerous；
IV-the BIP of primer is following (d7) or (d8):
(d7) single strand dna shown in the sequence 22 of sequence table；
(d8) there is phase by sequence 22 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 22
The DNA molecular of congenerous；
IV-the LF of primer is following (d9) or (d10):
(d9) single strand dna shown in the sequence 23 of sequence table；
(d10) there is phase by sequence 23 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 23
The DNA molecular of congenerous；
IV-the LB of primer is following (d11) or (d12):
(d11) single strand dna shown in the sequence 24 of sequence table；
(d12) there is phase by sequence 24 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 24
The DNA molecular of congenerous；
The primer sets V are by V-F3 of primer, V-B3 of primer, V-FIP of primer, V-BIP of primer, V-LF of primer and primer
V-LB composition；
V-the F3 of primer is following (e1) or (e2):
(e1) single strand dna shown in the sequence 25 of sequence table；
(e2) there is phase by sequence 25 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 25
The DNA molecular of congenerous；
V-the B3 of primer is following (e3) or (e4):
(e3) single strand dna shown in the sequence 26 of sequence table；
(e4) there is phase by sequence 26 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 26
The DNA molecular of congenerous；
V-the FIP of primer is following (e5) or (e6):
(e5) single strand dna shown in the sequence 27 of sequence table；
(e6) there is phase by sequence 27 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 27
The DNA molecular of congenerous；
V-the BIP of primer is following (e7) or (e8):
(e7) single strand dna shown in the sequence 28 of sequence table；
(e8) there is phase by sequence 28 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 28
The DNA molecular of congenerous；
V-the LF of primer is following (e9) or (e10):
(e9) single strand dna shown in the sequence 29 of sequence table；
(e10) there is phase by sequence 29 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 29
The DNA molecular of congenerous；
V-the LB of primer is following (e11) or (e12):
(e11) single strand dna shown in the sequence 30 of sequence table；
(e12) there is phase by sequence 30 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 30
The DNA molecular of congenerous；
The primer sets VI are by VI-F3 of primer, VI-B3 of primer, VI-FIP of primer, VI-BIP of primer, VI-LF of primer and primer
VI-LB composition；
VI-the F3 of primer is following (f1) or (f2):
(f1) single strand dna shown in the sequence 31 of sequence table；
(f2) there is phase by sequence 31 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 31
The DNA molecular of congenerous；
VI-the B3 of primer is following (f3) or (f4):
(f3) single strand dna shown in the sequence 32 of sequence table；
(f4) there is phase by sequence 32 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 32
The DNA molecular of congenerous；
VI-the FIP of primer is following (f5) or (f6):
(f5) single strand dna shown in the sequence 33 of sequence table；
(f6) there is phase by sequence 33 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 33
The DNA molecular of congenerous；
VI-the BIP of primer is following (f7) or (f8):
(f7) single strand dna shown in the sequence 34 of sequence table；
(f8) there is phase by sequence 34 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 34
The DNA molecular of congenerous；
VI-the LF of primer is following (f9) or (f10):
(f9) single strand dna shown in the sequence 35 of sequence table；
(f10) there is phase by sequence 35 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 35
The DNA molecular of congenerous；
VI-the LB of primer is following (f11) or (f12):
(f11) single strand dna shown in the sequence 36 of sequence table；
(f12) there is phase by sequence 36 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 36
The DNA molecular of congenerous.
2. the application of the combination of primer described in claim 1, is any one in following (g1)-(g6):
(g1) identify aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and Aspergillus calidoustus；
(g2) preparation is for identifying aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and Aspergillus
The kit of calidoustus；
(g3) identify tested microorganism whether be aspergillus fumigatus or Aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger or
Aspergillus calidoustus；
(g4) preparation is for identifying whether tested microorganism is aspergillus fumigatus or Aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger
Or the kit of Aspergillus calidoustus；
(g5) detect in sample to be tested whether containing aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus and/or
Aspergillus niger and/or Aspergillus calidoustus；
(g6) whether preparation is for detecting in sample to be tested containing aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or Huang Qu
The kit of mould and/or aspergillus niger and/or Aspergillus calidoustus.
3. the kit containing the combination of primer described in claim 1；The purposes of the kit be following (h1) or (h2) or
(h3):
(h1) identify aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and Aspergillus calidoustus；
(h2) identify tested microorganism whether be aspergillus fumigatus or Aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger or
Aspergillus calidoustus；
(h3) detect in sample to be tested whether containing aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus and/or
Aspergillus niger and/or Aspergillus calidoustus.
4. the preparation method of kit described in claim 3 includes the steps that individually packing each primer.
5. identify aspergillus fumigatus, Aspergillus terreus, aspergillus nidulans, aspergillus flavus, aspergillus niger and Aspergillus calidoustus side
Method is method A or method B；
The method A includes the following steps: to be respectively adopted described in claim 1 and draw using the genomic DNA of aspergillus to be measured as template
Primer sets I to primer sets VI in object combination carry out ring mediated isothermal amplification, if the primer sets I is used to may be implemented with institute
The specific amplification that genomic DNA is template is stated, aspergillus to be measured is or candidate is aspergillus fumigatus；If can using the primer sets II
To realize that, using the genomic DNA as the specific amplification of template, aspergillus to be measured is or candidate is Aspergillus terreus；If described in
Primer sets III may be implemented using the genomic DNA as the specific amplification of template, and aspergillus to be measured is or candidate is aspergillus nidulans；
If the primer sets IV is used to may be implemented using the genomic DNA as the specific amplification of template, aspergillus to be measured is or waits
It is selected as aspergillus flavus；It is to be measured if the primer sets V is used to may be implemented using the genomic DNA as the specific amplification of template
Aspergillus is or candidate is aspergillus niger；If the primer sets VI is used to may be implemented using the genomic DNA as the special of template
Property amplification, aspergillus to be measured is or candidate is Aspergillus calidoustus；
Whether the method B includes the following steps: to detect in aspergillus genomic DNA to be measured containing primer sets described in claim 1
Primer sets I in conjunction to primer sets VI target sequence, if containing the target sequence of the primer sets I in the genomic DNA, to
Survey aspergillus is or candidate is aspergillus fumigatus；If containing the target sequence of the primer sets II in the genomic DNA, aspergillus to be measured is
Or candidate is Aspergillus terreus；If containing the target sequence of the primer sets III in the genomic DNA, aspergillus to be measured is or candidate is
Aspergillus nidulans；If containing the target sequence of the primer sets IV in the genomic DNA, aspergillus to be measured is or candidate is Huang Qu
It is mould；If containing the target sequence of the primer sets V in the genomic DNA, aspergillus to be measured is or candidate is aspergillus niger；If
Contain the target sequence of the primer sets VI in the genomic DNA, aspergillus to be measured is or candidate is Aspergillus
calidoustus。
6. identify tested microorganism whether be aspergillus fumigatus or Aspergillus terreus or aspergillus nidulans or aspergillus flavus or aspergillus niger or
The method of Aspergillus calidoustus is method C or method D；
The method C includes the following steps: to be respectively adopted described in claim 1 using the genomic DNA of tested microorganism as template
Primer combination in primer sets I to primer sets VI carry out ring mediated isothermal amplification, if use the primer sets I may be implemented with
The genomic DNA is the specific amplification of template, and tested microorganism is or candidate is aspergillus fumigatus；If using the primer sets
II may be implemented using the genomic DNA as the specific amplification of template, and tested microorganism is or candidate is Aspergillus terreus；If adopted
It may be implemented with the primer sets III using the genomic DNA as the specific amplification of template, tested microorganism is or candidate is
Aspergillus nidulans；If the primer sets IV is used to may be implemented using the genomic DNA as the specific amplification of template, to micrometer
Biology is or candidate is aspergillus flavus；If the primer sets V is used to may be implemented using the genomic DNA as the special of template
Property amplification, tested microorganism is or candidate is aspergillus niger；If the primer sets VI is used to may be implemented with the genomic DNA
For the specific amplification of template, tested microorganism is or candidate is Aspergillus calidoustus, if using primer pair
I can not achieve using the genomic DNA as the specific amplification of template to primer sets VI, tested microorganism be non-aspergillus fumigatus and
Non- Aspergillus terreus and non-aspergillus nidulans and non-aspergillus flavus and non-aspergillus niger and non-Aspergillus calidoustus；
Whether the method D includes the following steps: to detect in tested microorganism genomic DNA containing primer described in claim 1
Primer sets I in combination to primer sets VI target sequence, if containing the target sequence of the primer sets I in the genomic DNA,
Tested microorganism is or candidate is aspergillus fumigatus；If containing the target sequence of the primer sets II in the genomic DNA, to micrometer
Biology is or candidate is Aspergillus terreus；If containing the target sequence of the primer sets III in the genomic DNA, tested microorganism is
Or candidate is aspergillus nidulans；If containing the target sequence of the primer sets IV in the genomic DNA, tested microorganism is or waits
It is selected as aspergillus flavus；If containing the target sequence of the primer sets V in the genomic DNA, tested microorganism is or candidate is black
Aspergillus；If containing the target sequence of the primer sets VI in the genomic DNA, tested microorganism is or candidate is
Aspergillus calidoustus；If any into primer sets VI without containing the primer sets I in the genomic DNA
The target sequence of primer sets, tested microorganism are non-aspergillus fumigatus and non-Aspergillus terreus and non-aspergillus nidulans and non-aspergillus flavus and non-aspergillus niger
And non-Aspergillus calidoustus.
Whether contain aspergillus fumigatus and/or Aspergillus terreus and/or aspergillus nidulans and/or aspergillus flavus and/or black 7. detecting in sample to be tested
The method of aspergillus and/or Aspergillus calidoustus is method E or method F；
The method E includes the following steps: that primer sets described in claim 1 are respectively adopted using the total DNA of sample to be tested as template
Primer sets I to primer sets VI in conjunction carry out ring mediated isothermal amplification, if using the primer sets I may be implemented with described total
DNA is the specific amplification of template, contains aspergillus fumigatus in sample to be tested；If the primer sets II is used to may be implemented with described
Total DNA is the specific amplification of template, contains Aspergillus terreus in sample to be tested；If the primer sets III is used to may be implemented with institute
The specific amplification that total DNA is template is stated, contains aspergillus nidulans in sample to be tested；If may be implemented using the primer sets IV
Using the total DNA as the specific amplification of template, contain aspergillus flavus in sample to be tested；If can be real using the primer sets V
Now using the total DNA as the specific amplification of template, contain aspergillus niger in sample to be tested；If using the primer sets VI can be with
It realizes using the total DNA as the specific amplification of template, Aspergillus calidoustus is contained in sample to be tested；If
It uses primer pair I to primer sets VI to can not achieve using the total DNA as the specific amplification of template, is not contained in sample to be tested
It aspergillus fumigatus and does not contain Aspergillus terreus and does not contain aspergillus nidulans and do not contain aspergillus flavus and do not contain aspergillus niger and do not contain
Aspergillus calidoustus；
Whether the method F includes the following steps: to detect in sample to be tested total DNA containing in the combination of primer described in claim 1
Primer sets I to primer sets VI target sequence, if containing the target sequence of the primer sets I in the total DNA, in sample to be tested
Contain aspergillus fumigatus；If containing the target sequence of the primer sets II in the total DNA, contain Aspergillus terreus in sample to be tested；If
Contain the target sequence of the primer sets III in the total DNA, contains aspergillus nidulans in sample to be tested；If contained in the total DNA
There is the target sequence of the primer sets IV, contains aspergillus flavus in sample to be tested；If containing the primer sets V in the total DNA
Target sequence contains aspergillus niger in sample to be tested；If containing the target sequence of the primer sets VI, sample to be tested in the total DNA
In contain Aspergillus calidoustus；If appointed without containing the primer sets I into primer sets VI in the total DNA
The target sequence of one primer sets without containing aspergillus fumigatus and does not contain Aspergillus terreus and does not contain aspergillus nidulans and do not contain in sample to be tested
Aspergillus flavus and without containing aspergillus niger and do not contain Aspergillus calidoustus.
8. primer sets I described in claim 1 or primer sets II or primer sets III or primer sets IV or primer sets V or primer
Group VI.
9. application of the primer sets I described in claim 1 in reagent preparation box A, or, the primer sets II are in reagent preparation
Application in box B, or, application of the primer sets III in reagent preparation box C, or, the primer sets IV are in reagent preparation box D
In application, or, application of the primer sets V in reagent preparation box E, or, the primer sets VI are in reagent preparation box F
Application；
The purposes of the kit A is following (i1) or (i2):
(i1) identify whether tested microorganism is aspergillus fumigatus；
(i2) detect in sample to be tested whether contain aspergillus fumigatus；
The purposes of the kit B is following (i3) or (i4):
(i3) identify whether tested microorganism is Aspergillus terreus；
(i4) detect in sample to be tested whether contain Aspergillus terreus；
The purposes of the kit C is following (i5) or (i6):
(i5) identify whether tested microorganism is aspergillus nidulans；
(i6) detect in sample to be tested whether contain aspergillus nidulans；
The purposes of the kit D is following (i7) or (i8):
(i7) identify whether tested microorganism is aspergillus flavus；
(i8) detect in sample to be tested whether contain aspergillus flavus；
The purposes of the kit E is following (i9) or (i10):
(i9) identify whether tested microorganism is aspergillus niger；
(i10) detect in sample to be tested whether contain aspergillus niger；
The purposes of the kit F is following (i11) or (i12):
(i11) identify whether tested microorganism is Aspergillus calidoustus；
(i12) it detects in sample to be tested and whether contains Aspergillus calidoustus.
10. the kit A containing the primer sets I described in claim 1, or, contain the kit B of the primer sets II, or,
Kit C containing the primer sets III, or, contain the kit D of the primer sets IV, or, containing the primer sets V
Kit E, or, containing the kit F of the primer sets VI；
The purposes of the kit A is following (i1) or (i2):
(i1) identify whether tested microorganism is aspergillus fumigatus；
(i2) detect in sample to be tested whether contain aspergillus fumigatus；
The purposes of the kit B is following (i3) or (i4):
(i3) identify whether tested microorganism is Aspergillus terreus；
(i4) detect in sample to be tested whether contain Aspergillus terreus；
The purposes of the kit C is following (i5) or (i6):
(i5) identify whether tested microorganism is aspergillus nidulans；
(i6) detect in sample to be tested whether contain aspergillus nidulans；
The purposes of the kit D is following (i7) or (i8):
(i7) identify whether tested microorganism is aspergillus flavus；
(i8) detect in sample to be tested whether contain aspergillus flavus；
The purposes of the kit E is following (i9) or (i10):
(i9) identify whether tested microorganism is aspergillus niger；
(i10) detect in sample to be tested whether contain aspergillus niger；
The purposes of the kit F is following (i11) or (i12):
(i11) identify whether tested microorganism is Aspergillus calidoustus；
(i12) it detects in sample to be tested and whether contains Aspergillus calidoustus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711471982.2A CN109988855B (en) | 2017-12-29 | 2017-12-29 | LAMP primer combination for detecting six kinds of aspergillus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711471982.2A CN109988855B (en) | 2017-12-29 | 2017-12-29 | LAMP primer combination for detecting six kinds of aspergillus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109988855A true CN109988855A (en) | 2019-07-09 |
| CN109988855B CN109988855B (en) | 2022-07-12 |
Family
ID=67109504
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711471982.2A Active CN109988855B (en) | 2017-12-29 | 2017-12-29 | LAMP primer combination for detecting six kinds of aspergillus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109988855B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111304349A (en) * | 2019-12-17 | 2020-06-19 | 北京百康芯生物科技有限公司 | Method for combined detection of multiple pathogen nucleic acids difficult to culture and identify |
| CN117144053A (en) * | 2023-10-27 | 2023-12-01 | 江苏美克医学技术有限公司 | Aspergillus fumigatus detection primer set, kit and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001066790A2 (en) * | 2000-03-10 | 2001-09-13 | Universiteit Gent | Detection of aspergillus fumigatus |
| CN102586455A (en) * | 2012-03-14 | 2012-07-18 | 万俊松 | Aflatoxin detection reagent kit based on loop-mediated isothermal gene amplification method |
| CN103451294A (en) * | 2013-09-04 | 2013-12-18 | 福建省农业科学院植物保护研究所 | Aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and visualized detection method thereof |
| CN105624290A (en) * | 2016-01-12 | 2016-06-01 | 中国人民解放军疾病预防控制所 | Application of Aspergillus fumigatus annexin anxC4 gene (anxC4 gene) |
-
2017
- 2017-12-29 CN CN201711471982.2A patent/CN109988855B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001066790A2 (en) * | 2000-03-10 | 2001-09-13 | Universiteit Gent | Detection of aspergillus fumigatus |
| CN102586455A (en) * | 2012-03-14 | 2012-07-18 | 万俊松 | Aflatoxin detection reagent kit based on loop-mediated isothermal gene amplification method |
| CN103451294A (en) * | 2013-09-04 | 2013-12-18 | 福建省农业科学院植物保护研究所 | Aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and visualized detection method thereof |
| CN105624290A (en) * | 2016-01-12 | 2016-06-01 | 中国人民解放军疾病预防控制所 | Application of Aspergillus fumigatus annexin anxC4 gene (anxC4 gene) |
Non-Patent Citations (4)
| Title |
|---|
| TETSUHIRO MATSUZAWA等: "Development of rapid and specific molecular discrimination methods for pathogenic emericella species", 《NIHON ISHINKIN GAKKAI ZASSHI》 * |
| 戴维丝•拉荣著: "《医学重要真菌鉴定指南》", 30 September 2016, 医学重要真菌鉴定指南 * |
| 李颖等: "评价ITS、BenA和CaM序列分析在曲霉菌种鉴定方面的应用", 《中国真菌学杂志》 * |
| 鲁勇等: "环介导等温扩增快速检测临床常见曲霉菌方法的建立和应用", 《中华检验医学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111304349A (en) * | 2019-12-17 | 2020-06-19 | 北京百康芯生物科技有限公司 | Method for combined detection of multiple pathogen nucleic acids difficult to culture and identify |
| CN117144053A (en) * | 2023-10-27 | 2023-12-01 | 江苏美克医学技术有限公司 | Aspergillus fumigatus detection primer set, kit and application thereof |
| CN117144053B (en) * | 2023-10-27 | 2024-01-19 | 江苏美克医学技术有限公司 | Aspergillus fumigatus detection primer set, kit and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109988855B (en) | 2022-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5935803B2 (en) | Mold detection method, PCR reaction solution, and mold detection carrier | |
| Nada et al. | Comparison of DNA fingerprinting by PFGE and PCR-RFLP of the coagulase gene to distinguish MRSA isolates | |
| CN111286530A (en) | Primer group and kit for detecting 27 respiratory pathogens based on nucleic acid mass spectrometry and application of primer group and kit | |
| CN112980997B (en) | Primer and probe for invasive mucormycosis pathogenic bacteria, implementation method and detection system thereof | |
| CN113881789B (en) | Probe and primer pair composition for detecting cryptococcus and detection method and application | |
| CN105331714B (en) | A kind of peronophythora litchi LAMP primer and its rapid detection method | |
| CN107541509B (en) | LAMP primer combination for detecting 6 infectious pathogens of cow mastitis and application thereof | |
| CN108823325B (en) | Application of riemerella anatipestifer Imp gene, PCR detection kit and method thereof | |
| CN103602738A (en) | Multiple PCR (Polymerase Chain Reaction) primer and method for quickly identifying variety of scallops | |
| CN109706145A (en) | Primer sets and its application | |
| CN110029191A (en) | The primer sets of the monocaryon mating type of a kind of identification mushroom Shen 215 strains of perfume and its Essentially derived variety, identification method and application | |
| CN109988857A (en) | For detecting two kinds of cryptococcal LAMP primer compositions and its application | |
| CN109487000A (en) | Primer combination and its application | |
| CN109988855A (en) | For detecting the LAMP primer composition and its application of six kinds of aspergillus | |
| CN107541567B (en) | LAMP primer combination for detecting 8 environmental pathogens of cow mastitis and application thereof | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN101560515B (en) | Specific gene sequence of tilletia controversa kuhn, specific SCAR marker and PCR detection method | |
| CN109988856A (en) | For detecting the LAMP primer composition and its application of formula lung pityrosporion ovale | |
| CN110055345A (en) | Primer sets and its application | |
| CN109706259A (en) | Primer sets and its application | |
| McBreen et al. | The use of molecular techniques to resolve relationships among traditional weaving cultivars of Phormium | |
| CN112538543A (en) | Specific primer for detecting salmonella and kit thereof | |
| CN109355412A (en) | It is a kind of artificial synthesized exogenous referring to molecule compared with fungal species and abundance for measuring bacterium | |
| CN111575412A (en) | Method for distinguishing four serotypes of avian adenovirus group I | |
| CN109680080A (en) | A kind of the nfo-RPA detection method and detection kit of Mycoplasma bovis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20240920 Address after: 102206 No. 18, life science Road, Beijing, Changping District Patentee after: CAPITALBIO Corp. Country or region after: China Patentee after: TSINGHUA University Address before: 102206 No. 18, life science Road, Beijing, Changping District Patentee before: CAPITALBIO Corp. Country or region before: China |