CN109706259A - Primer sets and its application - Google Patents
Primer sets and its application Download PDFInfo
- Publication number
- CN109706259A CN109706259A CN201811631670.8A CN201811631670A CN109706259A CN 109706259 A CN109706259 A CN 109706259A CN 201811631670 A CN201811631670 A CN 201811631670A CN 109706259 A CN109706259 A CN 109706259A
- Authority
- CN
- China
- Prior art keywords
- primer
- nucleotide sequence
- seq
- amplification
- histoplasma capsulatum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to field of biotechnology, and in particular to a kind of primer sets and its application.It particularly discloses a kind of for detecting Histoplasma capsulatum LAMP primer composition and its application.Primer combination provided by the invention, 6 primers shown in No.1~6 SEQ ID form.Primer combination provided by the invention can be applied to detect whether can be applied in detection sample to be tested whether contain Histoplasma capsulatum containing Histoplasma capsulatum.Primer combination identification provided by the invention has high specific and high sensitivity, easy, quick, accurate detection may be implemented for detecting Histoplasma capsulatum.
Description
Technical field
The present invention relates to field of biotechnology, in particular to primer sets and its application.
Background technique
Studies of invasive fungal infections (invasive fungaldisease, IFD) is also known as invasive infections with fungi (invasive
Fungal infection, IFI), deep fungal infection (deep fungal infection, DFI), refer to fungi invade people
Body tissue, blood grow wherein and breed, cause inflammatory reaction, and cause the pathology of histologic lesion, organ dysfunction raw
Reason process.Over nearly twenty or thirty year, with the new technologies such as solid organ and hematopoietic stem cell transplantation, chemotherapy of tumors, immunosuppressor
Extensive use in clinic increases the disease incidence of studies of invasive fungal infections and case fatality rate year by year, and having become causes to be hospitalized
One of the main reason for death.ICU is moved in since infection studies of invasive fungal infections is mainly in, advanced age, diabetes, hematologic
Systemic disease, candida albicans field planting, invasion operation, using in the crowds such as antibacterials, glucocorticoid, immunosuppressor,
Immunity of organisms is low, and the severe death rate is high, therefore early detection to invasive infections with fungi and determines that infection bacteria species have pole
For important meaning.
Histoplasmosis (histoplasmosis) divide two types, relatively conventional with american type, also known as capsule tissue
Endochylema bacterium disease, classical histoplasmosis or small form histoplasmosis.Its pathogenic bacteria is Histoplasma capsulatum
(Histoplasma capsulatum) is diphasic fungi, invades through respiratory tract, diseased region is mostly lung.The bacterium can
Cause primary acute histoplasmosis, chronic cavity type and serious disseminated etc..As immune deficient patients increase, morbidity
Rate increases.
Existing invasive infections with fungi detection method mainly includes routine inspection method and two kinds of special examined method.Wherein often
Rule inspection technique specifically includes that 1) fungi microscope inspection, i.e. direct smear dyeing microscopic examination；2) fungal culture is identified；3) histopathology
It learns and checks.Special examined method specifically includes that 1) Serological testing；2) Bio-molecular analysis.Wherein routine inspection method is still regarded
For the foundation stone for making a definite diagnosis invasive infections with fungi, but its that there are susceptibilitys is lower, operate complicated, negative findings can not rule out diagnosis,
The problems such as detection cycle longer (it is generally necessary to time of a few days to a few weeks), and lead to delay treatment and medication, increase the death rate
Deng；Serologic detection is difficult to exclude the inter-species antibody and antigen cross-reaction of the certain categories of fungi so as to cause erroneous judgement.Compare first two
Method, Protocols in Molecular Biology have the advantages that high specific and high accuracy, and can be illustrated from gene level fungal population it
Between and in taxonomic relation, thus be increasingly widely recognized and apply in recent years.The relevant molecule established at present
Learning diagnostic method has regular-PCR method, Pulse field gel electrophoresis (PFGE), Multilocus sequence typing (MLST), restricted
Fragment length polymorphism analyzes (RFLP), Real-Time Fluorescent Quantitative PCR Technique (RTFQ-PCR) etc., and shared problem is to experiment
Operate more demanding, detection time longer (2.5h-3h) left and right.Therefore, fast and accurately molecular diagnosis method is established, for clinic
There is provided early stage diagnosis and treatment foundation is the key that solve status.
Summary of the invention
In view of this, the present invention provides a kind of primer sets and its application.Primer combination identification is for detecting capsule tissue born of the same parents
Bacterium is starched, there is high specific and high sensitivity, easy, quick, accurate detection may be implemented.
In order to achieve the above-mentioned object of the invention, the present invention the following technical schemes are provided:
The present invention provides a kind of primer sets, including primer-F3, primer-B3, primer-FIP, primer-BIP, primer-LF
With primer-LB；
Primer-the F3 has any one in nucleotide sequence as follows:
(a1), there is nucleotide sequence shown in SEQ ID NO:1；
(a2), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, deletion and/or addition one or more
The nucleotide sequence that a base obtains；
(a3), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；
(a4), the complementary series of the sequence as shown in (a1), (a2) or (a3)；
Primer-the B3 has any one in nucleotide sequence as follows:
(a5), there is nucleotide sequence shown in SEQ ID NO:2；
(a6), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, deletion and/or addition one or more
The nucleotide sequence that a base obtains；
(a7), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；
(a8), the complementary series of the sequence as shown in (a5), (a6) or (a7)；
Primer-the FIP has any one in nucleotide sequence as follows:
(a9), there is nucleotide sequence shown in SEQ ID NO:3；
(a10), have SEQ ID NO:3 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or
The nucleotide sequence that multiple bases obtain；
(a11), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:3；
(a12), the complementary series of the sequence as shown in (a9), (a10) or (a11)；
Primer-the BIP has any one in nucleotide sequence as follows:
(a13), there is nucleotide sequence shown in SEQ ID NO:4；
(a14), have SEQ ID NO:4 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or
The nucleotide sequence that multiple bases obtain；
(a15), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；
(a16), the complementary series of the sequence as shown in (a13), (a14) or (a15)；
Primer-the LF has any one in nucleotide sequence as follows:
(a17), there is nucleotide sequence shown in SEQ ID NO:5；
(a18), have SEQ ID NO:5 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or
The nucleotide sequence that multiple bases obtain；
(a19), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；
(a20), the complementary series of the sequence as shown in (a17), (a18) or (a19)；
Primer-the LB has any one in nucleotide sequence as follows:
(a21), there is nucleotide sequence shown in SEQ ID NO:6；
(a22), have SEQ ID NO:6 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or
The nucleotide sequence that multiple bases obtain；
(a23) I, the sequence with nucleotide sequence shown in SEQ ID NO:6 at least 80% homology；
(a24), the complementary series of the sequence as shown in (a21), (a22) or (a23).
In some specific embodiments of the invention, the primer-F3, the primer-B3, the primer-FIP, institute
The molar ratio for stating primer-BIP, the primer-LF and the primer-LB can be 0.5:0.5:2:2:1:1.
The present invention also provides application of the primer sets in the nucleic acid molecules of amplification Histoplasma capsulatum.
The present invention also provides the primer sets to detect and/or identify the application in Histoplasma capsulatum.
The present invention also provides the primer sets in the kit of preparation detection and/or identification Histoplasma capsulatum
Using.
The present invention also provides the kits of the primer sets, which is characterized in that the purposes of the kit includes:
I, Histoplasma capsulatum is identified；
II, detect in sample to be tested whether contain Histoplasma capsulatum.
The present invention also provides the preparation method of the kit, includes the steps that individually packing each primer.
The present invention also provides a kind of methods for identifying Histoplasma capsulatum, include the following steps:
(1) genomic DNA of bacterium to be measured is obtained；
(2) for the genomic DNA extracted using step (1) as template, the primer being respectively adopted in the primer sets carries out ring Jie
Isothermal duplication is led, amplification is obtained；
(3) qualification result is obtained according to the amplification.
In some specific embodiments of the invention, if amplification is specific amplification, i.e., if described in
Primer sets may be implemented then to contain in bacterium to be measured using the total DNA as the specific amplification of template or candidate contains capsule tissue
Endochylema bacterium.
The present invention also provides in a kind of detection sample to be tested whether the method containing Histoplasma capsulatum, including it is as follows
Step:
(1) total DNA of sample to be tested is obtained；
(2) for the total DNA extracted using step (1) as template, the primer being respectively adopted in the primer sets carries out ring mediation etc.
Temperature amplification, obtains amplification；
(3) testing result is obtained according to the amplification.
In some specific embodiments of the invention, if amplification is specific amplification, i.e., if described in
Primer sets may be implemented using the total DNA of the sample to be tested as the specific amplification of template, then contains in sample to be tested or candidate
Contain Histoplasma capsulatum.
In any description above method, when using the primer sets, draw in the reaction system of the ring mediated isothermal amplification
Object-F3, primer-B3, primer-FIP, primer-BIP, primer-LF and primer-LB molar concentration be followed successively by 0.5 μM, 0.5 μM, 2
μM、2μM、1μM、1μM。
Any description above bacterium to be measured of the present invention concretely aspergillus fumigatus, Aspergillus terreus, Cryptococcus neoformans or adds special cryptococcus.
The aspergillus fumigatus concretely CGMCC, strain number: 3.08027 aspergillus fumigatus.The Aspergillus terreus concretely CGMCC, bacterial strain
Number: 3.08115 Aspergillus terreus.The Cryptococcus neoformans concretely ATCC, bacterial strain number: 208821 Cryptococcus neoformans.Institute
State plus special cryptococcus can be ATCC, bacterial strain number: 14248 plus special cryptococcus.
In any description above method of the present invention, loop-mediated isothermal amplification condition are as follows: 65 DEG C of constant temperature 50min.
The kit may also include reaction solution, the reaction solution concretely Capitalbio Corporation Co., Ltd.'s product,
Its catalog number is CP.440020.
Heretofore described sample to be tested can be the bronchoalveolar lavage fluid of people (Homo sapiens).
In the present invention, the realization ring mediated isothermal amplification can specifically embody are as follows: be detected using quantitative fluorescent PCR
When may occur in which ring mediated isothermal amplification curve.The ring mediated isothermal amplification curve can be typical " S type " amplification curve.
Loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) is in recent years
Come a kind of sensitive, special, the simple, fast nucleic acid amplification technologies developed, principle is that have strand-displacement activity in one kind
Archaeal dna polymerase under the action of, identify 6-8 region 4-6 primer, under isothermal conditions quickly, specifically expand purpose
Gene can be applied to and fast and accurately detect common strain.LAMP method has sensitivity height, specific good, reaction
Time is short, determines that result is convenient, does not need the advantages such as expensive instrument.
10 L:(6.7~7.3 μ of reaction system applied by the present invention) (Capitalbio Corporation Co., Ltd. produces μ L reaction solution
Product, catalog number CP.440020), (0.8~1.2) μ L primer sets provided by the invention, 1 μ L dilution (1 μ L dilution
The genome copy numbers contained in liquid are 5*102Copies), moisturizing is to 10 μ L.
Primer provided by the invention combination identification has high specific and highly sensitive for detecting Histoplasma capsulatum
Easy, quick, accurate detection may be implemented in degree.The present invention has great promotional value.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described.
Fig. 1 shows the testing result that primer sets I are used in embodiment 2；
Fig. 2 shows the testing result of reaction system 1 in embodiment 3；
Fig. 3 shows the testing result of reaction system 2 in embodiment 3；
Fig. 4 shows the testing result of reaction system 3 in embodiment 3；
Fig. 5 shows the testing result of reaction system 1 in embodiment 4；
Fig. 6 shows the testing result of reaction system 2 in embodiment 4；
Fig. 7 shows the testing result of reaction system 3 in embodiment 4；
Fig. 8 shows the testing result of reaction system 4 in embodiment 4；
Fig. 9 is the testing result of reaction system 5 in embodiment 4；
Figure 10 shows the testing result of clinical sample in embodiment 5；
Figure 11 shows primer sets sensitivity technique result provided by the invention in comparative test；
Figure 12 shows control primer sets sensitivity technique result in comparative test；
Figure 13 shows primer sets specific detection result provided by the invention in comparative test；
Figure 14 shows control primer sets specific detection result in comparative test.
Specific embodiment
The invention discloses a kind of primer sets and its application, those skilled in the art can use for reference present disclosure, suitably change
Into realization of process parameters.In particular, it should be pointed out that all similar substitutions and modifications are aobvious for a person skilled in the art
And be clear to, they are considered as being included in the present invention.Method and application of the invention is carried out by preferred embodiment
Description, related personnel can obviously not depart from the content of present invention, carried out in spirit and scope to method described herein and application
Change or appropriate changes and combinations, carry out implementation and application the technology of the present invention.
Raw materials used, auxiliary material and reagent are available on the market in primer sets provided by the invention and its application.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Quantitative test in following embodiment, is respectively provided with three repeated experiments, and results are averaged.
Reaction solution is Capitalbio Corporation Co., Ltd.'s product, catalog number CP.440020.
The calculation method of DNA copy number is as follows:
50 μ g/ml of 1A260 absorbance value=ds DNA；
Nucleic acid concentration=(OD260) × (extension rate) × (50)=x ng/ μ l；
Average molecular weight (MW) representative gram/mol, unit dalton (dolton), i.e. 1dolton=1g/mol；
Mole=6.02 × 1023；
Average molecular weight (MW): dsDNA=(base number) × (660 dalton/base)；
Copy number calculation formula:
(6.02×1023Copies/ moles) × (l × 10 x ng/ μ-9)/(DNA length × 660)=copies/ μ l.
Below with reference to embodiment, the present invention is further explained:
The preparation of 1 primer sets I of embodiment
Kit is made of a LAMP primer group, for detecting Histoplasma capsulatum.
It is following (5 ' → 3 ') for detecting Histoplasma capsulatum primer sets:
Outer primer F3 (SEQ ID No.1): CGATTTTGCTGCTCTGGA；
Outer primer B3 (SEQ ID No.2): CAATTCAGCAGCATGGT；
Inner primer FIP (SEQ ID No.3):
GTTTTGCTGGCCCAACTCAGAAAGGCGTTGGTAC；
Inner primer BIP (SEQ ID No.4):
GTTATGCGATGGAATTCGCGTCTCTGGTTGCTTCTT；
Ring primer LF (SEQ ID No.5): GCCAGGGGATCTAAAG；
Ring primer LB (SEQ ID No.6): GAGTACCACAATCTATA.
Primer sets for detecting Histoplasma capsulatum are named as primer sets.
Detection Histoplasma capsulatum primer combination is made of primer sets, and in primer combination, each single stranded DNA is respectively independent
Packaging.
In primer sets, primer-F3, primer-B3, primer-FIP, primer-BIP, primer-LF and primer-LB molar ratio be
0.5:0.5:2:2:1:1.
2 specificity of embodiment
One, the preparation of sample to be tested
Sample to be tested 1: aspergillus fumigatus (CGMCC, strain number: 3.08027) genomic DNA；
Sample to be tested 2: Aspergillus terreus (CGMCC, strain number: 3.08115) genomic DNA；
Sample to be tested 3: Cryptococcus neoformans (ATCC, bacterial strain number: 208821) genomic DNA；
Sample to be tested 4: add special cryptococcus (ATCC, bacterial strain number: 14248) genomic DNA；
Sample to be tested 5: Histoplasma capsulatum detects gene plasmid DNA: pUC57 plasmid (raw work bioengineering (on
Sea) limited liability company) MCS between insertion No. Genebank for JX274604.1 nucleotide DNA molecular, obtain recombination matter
Grain, the plasmid are Histoplasma capsulatum detection gene plasmid.
Two, the detection of sample to be tested
Using each sample to be tested in step 1 as template, ring Jie is carried out using the primer combination of 1 step 2 of embodiment preparation
Lead isothermal duplication.
Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions
CP.440020), 1 μ L primer mixture, 1 μ L template DNA (5pg~50pg), moisturizing to 10 μ L.Primer mixture, that is, primer sets
The mixture of each primer composition in conjunction.In reaction system, the final concentration of primers F 3 and primer B3 are 0.5 μM, primers F IP
Final concentration with primer BIP is 2 μM, and the final concentration of primer LF and primer LB are 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
In reaction process, fluorescence signal is detected using fluorescent PCR instrument.
20 repetitions are arranged in each reaction system.
The result is shown in Figure 1.The result shows that only when sample to be tested is Histoplasma capsulatum Plasmid DNA (sample to be tested 5)
When show positive amplification curve (i.e. amplification curve be typical " S type " amplification curve).When sample to be tested be sample to be tested 1,
2,3,4 when do not show positive amplification curve.
The above result shows that primer combination provided by the invention has very high specificity to its target gene.
The sensitivity of the primer combination of 3 Histoplasma capsulatum of embodiment
Sample to be tested: the plasmid of Histoplasma capsulatum detection gene.
Histoplasma capsulatum detects gene plasmid: in pUC57 plasmid (the raw limited public affairs of work bioengineering (Shanghai) share
Department) MCS between insertion No. Genebank for JX274604.1 nucleotide DNA molecular, obtain recombinant plasmid, which is
Histoplasma capsulatum detects gene plasmid.
1, the Plasmid DNA for extracting sample to be tested, carries out gradient dilution with sterile water, obtains each dilution.
2, for the dilution obtained using step 1 as template, the primer sets I that the preparation of embodiment 1 is respectively adopted carry out ring mediation etc.
Temperature amplification.
When sample to be tested is sample to be tested 1, ring mediated isothermal amplification is carried out using primer sets I.
Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are respectively 10 for 1 μ L primer mixture, 1 μ L dilution3、5*
102、102), moisturizing to 10 μ L.The mixture of each primer composition in primer mixture, that is, primer sets I or primer sets II.Reaction
In system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, and the final concentration of inner primer FIP and inner primer BIP are 2 μ
The final concentration of M, ring primer LF and ring primer LB are 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
In reaction process, fluorescence signal is detected using constant-temperature amplification instrument.
According to the difference of genome copy numbers in dilution, total following 3 reaction systems:
The genome copy numbers contained in reaction system 1:1 μ L dilution are respectively 103；
The genome copy numbers contained in reaction system 2:1 μ L dilution are respectively 5 × 102；
The genome copy numbers contained in reaction system 3:1 μ L dilution are respectively 102；
20 repetitions are arranged in each reaction system.
If occurring positive amplification curve (i.e. amplification curve is typical " S type " amplification curve) in 50min, show anti-
Answer the corresponding gene group content in system that can be detected.If not occurring positive amplification curve in 50min (to expand
Increasing curve is typical " S type " amplification curve), show that the corresponding gene group content in reaction system cannot be detected.
As a result see Fig. 2-Fig. 4.Primer combine detection target gene genome copy numbers in 1 μ L dilution are 103(Fig. 2)
With 5 × 10220 detections are detectable out and reproducible when (Fig. 3), and 102When (Fig. 4) 20 detection can not completely appearance and
It is less reproducible, therefore the sensitivity of primer combination is 5 × 102A copy number/reaction system.
The screening of 4 reaction system of embodiment
Sample to be tested: Histoplasma capsulatum detects gene plasmid: in pUC57 plasmid (raw work bioengineering (Shanghai) stock
Part Co., Ltd) MCS between insertion Genebank nucleotide for JX274604.1 DNA molecular, obtain recombinant plasmid, should
Plasmid is Histoplasma capsulatum detection gene plasmid.
1, the Plasmid DNA for extracting sample to be tested, carries out gradient dilution with sterile water, obtains each dilution.
2, the dilution obtained using step 1 carries out ring mediated isothermal expansion using primer sets I prepared by embodiment 1 as template
Increase.
Reaction system 1 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 1 μ L primer mixture, 1 μ L dilution
102Copies), moisturizing is to 10 μ L.
Reaction system 2 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 6.7 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 1.2 μ L primer mixtures, 1 μ L dilution
102Copies), moisturizing is to 10 μ L.
Reaction system 3 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 6.5 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 1.3 μ L primer mixtures, 1 μ L dilution
102Copies), moisturizing is to 10 μ L.
Reaction system 4 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.3 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 0.8 μ L primer mixture, 1 μ L dilution
102Copies), moisturizing is to 10 μ L.
Reaction system 5 (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.5 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5* for 0.7 μ L primer mixture, 1 μ L dilution
102Copies), moisturizing is to 10 μ L.
The mixture of each primer composition of primer mixture, that is, primer sets I.In reaction system, outer primer F3 and outer primer
The final concentration of B3 is 0.5 μM, and the final concentration of inner primer FIP and inner primer BIP are 2 μM, ring primer LF and ring primer LB's
Final concentration is 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
In reaction process, fluorescence signal is detected using constant-temperature amplification instrument.
8 repetitions are arranged in each reaction system.
If occurring positive amplification curve (i.e. amplification curve is typical " S type " amplification curve) in 50min, show anti-
Answer the corresponding gene group content in system that can be detected.If not occurring positive amplification curve in 50min (to expand
Increasing curve is typical " S type " amplification curve), show that the corresponding gene group content in reaction system cannot be detected.
As a result see Fig. 5~Fig. 9.Primer combine detection target gene is in reaction system 1, reaction system 2 and reaction system 4
8 detections are detectable out and reproducible, and primer combine detection target gene is in reaction system 3 and reaction system 58
Detection can not appearance and less reproducible completely.
It is thus determined that reaction system matches are as follows:
10 L:(6.7~7.3 μ of reaction system) μ L reaction solution (Capitalbio Corporation Co., Ltd.'s product, catalog number
For CP.440020), (0.8~1.2) μ L primer mixture, 1 μ L dilution, (genome copy numbers contained in 1 μ L dilution are
5*102Copies), moisturizing is to 10 μ L.
Embodiment 5 identifies primer combine detection clinical sample using Histoplasma capsulatum
Sample to be tested is following sample one:
Sample one: the bronchoalveolar lavage fluid of people of the identification confirmation containing Histoplasma capsulatum is sequenced by PCR.
1, the total DNA of sample to be tested is extracted.
2, each primer sets of the preparation of embodiment 1 are respectively adopted to the two samples as template in the total DNA extracted using step 1
This progress ring mediated isothermal amplification, each primer combination detect two kinds of samples.
Reaction system and reaction condition are the same as embodiment 2.
In reaction process, fluorescence signal is detected using constant-temperature amplification instrument.
The result is shown in Figure 10 of sample one.Positive amplification curve is shown when only detection using primer sets I.Draw when using
Positive amplification curve is not shown when object group II, it is consistent with actual conditions.Figure 10 is primer sets I as a result, remaining is not
Add the result of template.
The above result shows that capsule tissue born of the same parents can be carried out using Histoplasma capsulatum primer provided by the invention combination
It starches bacterial examination to survey, as a result accurately and reliably.
Comparative test
It is as follows to compare primer sequence:
Table 1
| F3-1 | SEQ ID No.7 | ACCATCGGAAATCGCCA |
| B3-1 | SEQ ID No.8 | CATGCACTCTTCACGTAA |
| FIP-1 | SEQ ID No.9 | TTAGACGCAAACCCGGGGCCTCTTTCTGAAACCTCAG |
| BIP-1 | SEQ ID No.10 | TCGTTTCCCCTGGTATCGACTCTAGACTTCTCC |
| LF-1 | SEQ ID No.11 | TCATGGAAGTTGCTG |
| LB-1 | SEQ ID No.12 | CACGAAATTCTGTCG |
Using existing primer sequence and comparison primer sequence, test is compared.
Sensitivity comparison: (see Figure 11-12)
Experimental design: using existing primer and comparison primer, 20 repeat amplification protcols of detection limit grade are carried out.
Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 5 × 10 for 1 μ L primer mixture, 1 μ L dilution2), it mends
Water is to 10 μ L.In reaction system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, inner primer FIP and inner primer BIP
Final concentration be 2 μM, the final concentration of ring primer LF and ring primer LB are 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
React primer: current primer and comparison primer
As a result: now using primer repeatability better than comparison primer.
Specificity comparison: (see Figure 13-14)
Experimental design: using existing primer and comparison primer, the amplification of four kinds of unrelated bacterium templates is carried out.
Template: preparation aspergillus fumigatus (CGMCC, strain number: 3.08027) genomic DNA；Aspergillus terreus (compile by CGMCC, bacterial strain
Number: 3.08115) genomic DNA；Cryptococcus neoformans (ATCC, bacterial strain number: 208821) genomic DNA；Add special cryptococcus (ATCC,
Bacterial strain number: the 14248) template of genomic DNA.
Reaction system (10 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 7.0 μ L reaction solutions
CP.440020), (genome copy numbers contained in 1 μ L dilution are 10 for 1 μ L primer mixture, 1 μ L dilution4), moisturizing is extremely
10μL.In reaction system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, the end of inner primer FIP and inner primer BIP
Concentration is 2 μM, and the final concentration of ring primer LF and ring primer LB are 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
React primer: current primer and comparison primer
As a result: now good using primer specificity；There is the non-specific amplification of Aspergillus terreus in comparison primer.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Sequence table
<110>Capitalbio Corporation Co., Ltd.
<120>primer sets and its application
<130> MP1729045
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
cgattttgct gctctgga 18
<210> 2
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
caattcagca gcatggt 17
<210> 3
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gttttgctgg cccaactcag aaaggcgttg gtac 34
<210> 4
<211> 36
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gttatgcgat ggaattcgcg tctctggttg cttctt 36
<210> 5
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gccaggggat ctaaag 16
<210> 6
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
gagtaccaca atctata 17
<210> 7
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
accatcggaa atcgcca 17
<210> 8
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
catgcactct tcacgtaa 18
<210> 9
<211> 37
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
ttagacgcaa acccggggcc tctttctgaa acctcag 37
<210> 10
<211> 33
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
tcgtttcccc tggtatcgac tctagacttc tcc 33
<210> 11
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
tcatggaagt tgctg 15
<210> 12
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
cacgaaattc tgtcg 15
Claims (10)
1. primer sets, including primer-F3, primer-B3, primer-FIP, primer-BIP, primer-LF and primer-LB；
Primer-the F3 has any one in nucleotide sequence as follows:
(a1), there is nucleotide sequence shown in SEQ ID NO:1；
(a2), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(a3), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；
(a4), the complementary series of the sequence as shown in (a1), (a2) or (a3)；
Primer-the B3 has any one in nucleotide sequence as follows:
(a5), there is nucleotide sequence shown in SEQ ID NO:2；
(a6), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(a7), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；
(a8), the complementary series of the sequence as shown in (a5), (a6) or (a7)；
Primer-the FIP has any one in nucleotide sequence as follows:
(a9), there is nucleotide sequence shown in SEQ ID NO:3；
(a10), have nucleotide sequence shown in SEQ ID NO:3 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(a11), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:3；
(a12), the complementary series of the sequence as shown in (a9), (a10) or (a11)；
Primer-the BIP has any one in nucleotide sequence as follows:
(a13), there is nucleotide sequence shown in SEQ ID NO:4；
(a14), have nucleotide sequence shown in SEQ ID NO:4 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(a15), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；
(a16), the complementary series of the sequence as shown in (a13), (a14) or (a15)；
Primer-the LF has any one in nucleotide sequence as follows:
(a17), there is nucleotide sequence shown in SEQ ID NO:5；
(a18), have nucleotide sequence shown in SEQ ID NO:5 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(a19), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；
(a20), the complementary series of the sequence as shown in (a17), (a18) or (a19)；
Primer-the LB has any one in nucleotide sequence as follows:
(a21), there is nucleotide sequence shown in SEQ ID NO:6；
(a22), have nucleotide sequence shown in SEQ ID NO:6 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(a23) I, the sequence with nucleotide sequence shown in SEQ ID NO:6 at least 80% homology；
(a24), the complementary series of the sequence as shown in (a21), (a22) or (a23).
2. primer sets according to claim 1, which is characterized in that the primer-F3, the primer-B3, the primer-
FIP, the primer-BIP, the primer-LF and the primer-LB molar ratio can be 0.5:0.5:2:2:1:1.
3. application of the primer sets as described in claim 1 in the nucleic acid molecules of amplification Histoplasma capsulatum.
4. primer sets as described in claim 1 are detecting and/or are identifying the application in Histoplasma capsulatum.
5. application of the primer sets as described in claim 1 in the kit of preparation detection and/or identification Histoplasma capsulatum.
6. including the kit of primer sets as described in claim 1, which is characterized in that the purposes of the kit includes:
I, Histoplasma capsulatum is identified；
II, detect in sample to be tested whether contain Histoplasma capsulatum.
7. a kind of method for identifying Histoplasma capsulatum, which comprises the steps of:
(1) genomic DNA of bacterium to be measured is obtained；
(2) for the genomic DNA extracted using step (1) as template, the primer being respectively adopted in the primer sets carries out ring mediation etc.
Temperature amplification, obtains amplification；
(3) qualification result is obtained according to the amplification.
8. the method according to the description of claim 7 is characterized in that if amplification is specific amplification, in bacterium to be measured
Contain or candidate contains Histoplasma capsulatum.
9. in a kind of detection sample to be tested whether the method containing Histoplasma capsulatum, which comprises the steps of:
(1) total DNA of sample to be tested is obtained；
(2) for the total DNA extracted using step (1) as template, the primer being respectively adopted in the primer sets carries out ring mediated isothermal expansion
Increase, obtains amplification；
(3) testing result is obtained according to the amplification.
10. according to the method described in claim 9, it is characterized in that, if amplification be specific amplification, it is described to be measured
Contain in sample or candidate contains Histoplasma capsulatum.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811631670.8A CN109706259A (en) | 2018-12-29 | 2018-12-29 | Primer sets and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811631670.8A CN109706259A (en) | 2018-12-29 | 2018-12-29 | Primer sets and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109706259A true CN109706259A (en) | 2019-05-03 |
Family
ID=66258193
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811631670.8A Pending CN109706259A (en) | 2018-12-29 | 2018-12-29 | Primer sets and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109706259A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151557A (en) * | 2021-04-27 | 2021-07-23 | 中国医学科学院北京协和医院 | LAMP primer group, kit and method for detecting histoplasma capsulatum |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104762396A (en) * | 2015-04-15 | 2015-07-08 | 中国人民解放军第二军医大学 | Histoplasma infection molecular diagnosis kit based on loop-mediated isothermal amplification (LAMP) technique principles and application thereof |
| WO2018107129A1 (en) * | 2016-12-09 | 2018-06-14 | The Broad Institute, Inc. | Crispr effector system based diagnostics |
-
2018
- 2018-12-29 CN CN201811631670.8A patent/CN109706259A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104762396A (en) * | 2015-04-15 | 2015-07-08 | 中国人民解放军第二军医大学 | Histoplasma infection molecular diagnosis kit based on loop-mediated isothermal amplification (LAMP) technique principles and application thereof |
| WO2018107129A1 (en) * | 2016-12-09 | 2018-06-14 | The Broad Institute, Inc. | Crispr effector system based diagnostics |
Non-Patent Citations (2)
| Title |
|---|
| RAQUEL CORDEIROTHEODORO等: "PRP8 intein in cryptic species of Histoplasma capsulatum: evolution and phylogeny:5 PubMed，PRP8 Histoplasma capsulatum", 《INFECTION, GENETICS AND EVOLUTION》 * |
| 李娟等: "一种基于环介导等温扩增技术原理的组织胞浆菌分子诊断技术", 《中国真菌学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151557A (en) * | 2021-04-27 | 2021-07-23 | 中国医学科学院北京协和医院 | LAMP primer group, kit and method for detecting histoplasma capsulatum |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dijkshoorn | Acinetobacter—microbiology | |
| CN107746879A (en) | Detect RPA primers, probe, kit and the detection method of staphylococcus aureus | |
| WO2021082590A1 (en) | Lamp detection method for vibrio parahaemolyticus o9 serotype o antigen molecular typing | |
| CN113881789B (en) | Probe and primer pair composition for detecting cryptococcus and detection method and application | |
| CN104059977A (en) | Salmonella serotype identification method and kit thereof | |
| JP6160015B2 (en) | Genotyping method of Acinetobacter spp. And primer set used therefor | |
| CN111154900B (en) | Pseudomonas aeruginosa specific new molecular target and rapid detection method thereof | |
| CN109706145A (en) | Primer sets and its application | |
| CN109988857B (en) | LAMP primer combination for detecting two cryptococcus and application thereof | |
| CN110079621B (en) | Oligonucleotide combination, method and kit for identifying mycobacterium species | |
| CN109487000A (en) | Primer combination and its application | |
| CN110734993A (en) | nucleic acid detection test paper strip for distinguishing Brucella vaccine strain S19 from naturally infected strain | |
| KR20200060178A (en) | Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same | |
| CN109706259A (en) | Primer sets and its application | |
| CN112592992A (en) | Primer probe set and kit for combined detection of mycoplasma pneumoniae and chlamydia pneumoniae based on fluorescent RMA method | |
| CN110055345A (en) | Primer sets and its application | |
| CN103451305A (en) | Primers, probe, method and kit for detecting diffusely adherent Escherichia coli | |
| CN109988855A (en) | For detecting the LAMP primer composition and its application of six kinds of aspergillus | |
| CN109988856B (en) | LAMP primer combination for detecting yersinia pneumocystis and application thereof | |
| CN107365851A (en) | A kind of helicobacter hepaticus LAMP quick determination methods | |
| CN108034736B (en) | Detection kit for drug resistance of Escherichia coli fluoroquinolone antibiotics, detection method and application | |
| JP2006333785A (en) | Method for detecting clostridium difficile toxin b gene using lamp method, and primer set usable in the method | |
| CN101824482A (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| CN113718053A (en) | Probe and primer pair for detecting yersinia sporogenes, detection method and application | |
| CN106636422A (en) | LAMP (loop-mediated isothermal amplification) primer composition for detecting drug-resistant genes of three bacteria generating AmpC enzymes and application of primer composition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190503 |
|
| RJ01 | Rejection of invention patent application after publication |