KR20200060178A - Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same - Google Patents

Abstract

The present invention relates to a primer and a probe for identifying avian influenza, Newcastle disease and avian infectious bronchitis viruses, and a method for identifying avian influenza, Newcastle disease and avian infectious bronchitis viruses by using the same. Specifically, the primer and probe set of the present invention can specifically distinguish and detect avian influenza A, Newcastle disease and avian infectious bronchitis viruses at the same time, and show an excellent detection efficiency such as a degree of analytical sensitivity or the like, compared to a known primer set so the primer and probe set can be useful in detecting avian influenza A, Newcastle disease and avian infectious bronchitis viruses and help come up with effective preventive measures against the viruses.

Description

Primers and probes for detecting avian influenza, Newcastle disease and chicken infectious bronchitis virus, and methods for detecting avian influenza, Newcastle disease and chicken infectious bronchitis virus and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same}

The present invention relates to a primer and probe for detecting avian influenza, Newcastle disease and chicken infectious bronchitis virus, and a method for detecting avian influenza, Newcastle disease and chicken infectious bronchitis virus using the same.

Influenza virus (Influenza virus) is an RNA virus belonging to the Orthomyxoviridae family, and is classified into A, B, and C types. In the type A influenza virus, wild aquatic birds are mainly natural hosts, so spread through interspecies transmission is fast and strong, while the influenza B and C viruses have a lower incidence and a weaker virulence than the type A influenza virus.

Avian influenza virus (Avian influenza virus), which belongs to the type A influenza virus, mainly causes interspecies transmission through the respiratory tract, and is a virus that causes acute respiratory diseases such as high fever, headache, cough, and runny nose. A type avian influenza virus has eight single-stranded fragmented RNA genes, depending on the types of hemagglutinin (HA) and neuraminidase (NA) glycoproteins present on the virus surface. It is classified into several subtypes.

The occurrence of various subtypes is a point mutation of the HA or NA gene during the virus replication mechanism, and an antigenic stool that acquires a new HA or NA and an antigenic drift that causes antigenic variation, and becomes an entirely different subtype from the existing subtype This is done by an antigenic shift. Antigen mutants can be predicted to be mutant, whereas antigen mutants are difficult to predict because influenza viruses composed of 8 RNA segments can be made by genetic recombination between different subtypes.

Currently, various types of avian influenza virus subtypes and cases of human infection have been continuously reported. Since the outbreak of the avian influenza virus causes damage due to enormous economic loss and human infection of the bird farming business, prevention and treatment through rapid diagnosis of infection is very important.

On the other hand, the type A avian influenza virus has very similar clinical symptoms to the newcastle disease virus and the avian infectious bronchitis virus. For example, respiratory symptoms such as coughing, sneezing, and runny nose, and clinical symptoms such as rapid egg laying, deformed egg, egg roe, and decolorization in egg spawning are common symptoms caused by the three viruses. It corresponds. Therefore, in the diagnosis of avian influenza A virus, differential diagnosis with Newcastle disease virus and chicken infectious bronchitis virus having similar clinical symptoms is essential.

Diagnosis of type A avian influenza virus is tested and diagnosed based on the criteria set by the International Water Bureau (Organisation Mondiale de la Sante Animale, OIE). The causal segregation test has the disadvantage that it takes a long time to diagnose, and the antibody test has the disadvantage of low sensitivity, so the results can be quickly read, large-scale analysis is possible, and the use of molecular diagnostic methods with high analytical sensitivity and specificity increases. Doing.

Republic of Korea Registered Patent No. 10-1566156

An object of the present invention is to provide a primer set for detecting type A avian influenza, Newcastle disease and chicken infectious bronchitis virus.

Another object of the present invention is to provide a composition and kit for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus containing the primer set.

Another object of the present invention is to provide a method for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus using the primer set.

In order to achieve the above object, the present invention is a first forward primer described in the base sequence of SEQ ID NO: 1; A second forward primer described by the nucleotide sequence of SEQ ID NO: 4; A third forward primer described by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer described in SEQ ID NO: 10; A first reverse primer described as the nucleotide sequence of SEQ ID NO: 2; A second reverse primer described as the nucleotide sequence of SEQ ID NO: 6; A third reverse primer described as the nucleotide sequence of SEQ ID NO: 7; And it provides a primer set for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus consisting of a fourth reverse primer described by the base sequence of SEQ ID NO: 11.

In addition, the present invention provides a composition for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus containing the primer set.

In addition, the present invention provides a kit for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus containing the composition.

In addition, the present invention is a type A comprising a step of performing a real-time reverse transcription polymerase chain reaction (RT-PCR) using the primer set as a template for nucleic acids isolated from a sample. A method for detecting avian influenza, Newcastle disease and chicken infectious bronchitis virus is provided.

The primer and probe set of the present invention can specifically and simultaneously detect and detect type A avian influenza, Newcastle disease and chicken infectious bronchitis virus, and have excellent analytical sensitivity and detection efficiency compared to a known primer set. , Newcastle disease and chicken infectious bronchitis virus can be useful for detection, it can be helpful in preparing effective anti-measure measures against the virus.

1 is a graph of multiple real-time RT-PCR results using the primer and probe set of the present invention.
FIG. 2 is a graph (A) and a standard curve graph (B) of confirming analytical sensitivity to A-type avian influenza virus of multiple real-time RT-PCR using the primer and probe set of the present invention.
3 is a graph (A) and a standard curve graph (B) of confirming analytical sensitivity to Newcastle disease virus of multiple real-time RT-PCR using the primer and probe set of the present invention.
4 is a graph (A) and a standard curve graph (B) of confirming the analytical sensitivity of the multi-real-time RT-PCR using the primers and probe set of the present invention to the chicken infectious bronchitis virus.
5 is a multi-real-time RT-PCR result graph (A) using a primer and probe set of the present invention for avian influenza A virus and a real-time PCR result graph (B) using a commercialized primer set (D1 to D5: A This is a sample of 10-fold step-wise dilution of avian influenza virus-positive RNA samples, D1 being the highest concentration).
FIG. 6 is a graph showing multiple real-time RT-PCR result graphs (A) using primers and probe sets of the present invention and PCR results using known primer sets (B) (D1 to D5: Newcastle disease virus positive) RNA samples are diluted 10-fold stepwise, D1 is the highest concentration).
FIG. 7 is a graph (A) of multiple real-time RT-PCR results using primers and probe sets of the present invention for chicken infectious bronchitis virus and PCR results using known primer sets (B) (D1 to D5: chickens) This is a sample in which the infectious bronchitis virus-positive RNA sample is diluted 10-fold stepwise, and D1 is the highest concentration).
8 is a view showing the results of investigating the match rate of the sequence of 60 types of matrix genes of the A-type avian influenza virus and the primer and probe set for detecting A-type avian influenza virus of the present invention.
9 is a view showing the results of investigating the match rate of 60 sequences of known primer sets and the nuclear protein (nucleoprotein) gene of the type A avian influenza virus.
10 is a view showing the results of investigating the coincidence of the sequence of the primer and probe set for the detection of Newcastle disease virus of the present invention and the sequence of a known primer set for 50 kinds of Newcastle disease virus genes.
FIG. 11 is a diagram showing the results of investigating the coincidence between the primer and probe set for detecting chicken infectious bronchitis virus of the present invention and the sequence of 60 types of chicken infectious bronchitis virus genes.
FIG. 12 is a diagram showing the results of investigating the coincidence rate between the known primer set and the sequence of 60 chicken infectious bronchitis virus genes.
13 is a graph of multiple real-time RT-PCR results using the primers and probes of the present invention (AIV: type A avian influenza virus, NDV: Newcastle disease virus, and IBV: chicken infectious bronchitis virus).
14 is a diagram showing nested RT-PCR results using a known primer set (AIV: type A avian influenza virus, NDV: Newcastle disease virus, IBV: chicken infectious bronchitis virus, and red box: target band). .
FIG. 15 is a diagram showing nested RT-PCR results using a known primer set (AIV: avian influenza A virus, NDV: Newcastle disease virus, IBV: chicken infectious bronchitis virus, and red arrow: non-specific band).

Hereinafter, the present invention will be described in detail.

The present invention is the first forward primer described in the nucleotide sequence of SEQ ID NO: 1; A second forward primer described by the nucleotide sequence of SEQ ID NO: 4; A third forward primer described by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer described in SEQ ID NO: 10; A first reverse primer described as the nucleotide sequence of SEQ ID NO: 2; A second reverse primer described as the nucleotide sequence of SEQ ID NO: 6; A third reverse primer described as the nucleotide sequence of SEQ ID NO: 7; And it provides a primer set for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus consisting of a fourth reverse primer described by the base sequence of SEQ ID NO: 11.

The primer set may specifically amplify the matrix gene region of the type A avian influenza virus, the matrix gene region of the Newcastle disease virus, and the spike glycoprotein 1 region of the chicken infectious bronchitis virus. In addition, the primer set is 10 to 40 complementarily binding to the gene of the matrix gene region of the A type influenza virus, the matrix gene region of the Newcastle disease virus, or the spike glycoprotein 1 region of the chicken infectious bronchitis virus, specifically 15 It may be a forward and reverse primer pair consisting of 30 base sequences. In one embodiment of the present invention, the primer set is a first forward primer described by the base sequence of SEQ ID NO: 1; A second forward primer described by the nucleotide sequence of SEQ ID NO: 4; A third forward primer described by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer described in SEQ ID NO: 10; A first reverse primer described as the nucleotide sequence of SEQ ID NO: 2; A second reverse primer described as the nucleotide sequence of SEQ ID NO: 6; A third reverse primer described as the nucleotide sequence of SEQ ID NO: 7; And it may be made of a fourth reverse primer described in the base sequence of SEQ ID NO: 11.

The primer can be chemically synthesized using a phosphoramidite solid support method, or other well-known method. These primers can be modified using many means known in the art, as long as they have the effect of detecting type A avian influenza virus, Newcastle disease virus, or chicken infectious bronchitis virus. Examples of such modifications are methylation, capping, substitution with one or more homologs of natural nucleotides, and modification between nucleotides, such as uncharged linkages (eg methyl phosphonate, phosphotriester, phosphoroamidate , Carbamate, etc.) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids can include one or more additional covalently attached residues, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, the primers of the present invention, if necessary, may include a label that can be detected directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g. ³² P), fluorescent molecules and chemical groups (e.g. biotin), etc. There is this.

In addition, the present invention provides a composition for detecting avian influenza type A, influenza A, and Newcastle disease and chicken infectious bronchitis virus, which includes a primer set for detecting type A avian influenza, Newcastle disease and chicken infectious bronchitis virus of the present invention.

The primer set may have the characteristics as described above. For example, the primer set may specifically amplify the matrix gene region of the type A avian influenza virus, the matrix gene region of the Newcastle disease virus, and the spike glycoprotein 1 region of the chicken infectious bronchitis virus. In addition, the primer set is 10 to 40 complementarily binding to the gene of the matrix gene region of the A type influenza virus, the matrix gene region of the Newcastle disease virus, or the spike glycoprotein 1 region of the chicken infectious bronchitis virus, specifically 15 It may be a forward and reverse primer pair consisting of 30 base sequences. In one embodiment of the present invention, the primer set is a first forward primer described by the base sequence of SEQ ID NO: 1; A second forward primer described by the nucleotide sequence of SEQ ID NO: 4; A third forward primer described by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer described in SEQ ID NO: 10; A first reverse primer described as the nucleotide sequence of SEQ ID NO: 2; A second reverse primer described as the nucleotide sequence of SEQ ID NO: 6; A third reverse primer described as the nucleotide sequence of SEQ ID NO: 7; And it may be made of a fourth reverse primer described in the base sequence of SEQ ID NO: 11.

The composition may further include probes respectively described as base sequences of SEQ ID NOs: 3, 8, 9, and 12.

As used herein, the term "probe" refers to nucleic acid fragments corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, oligonucleotide probes, single-stranded DNA probes , It may be produced in the form of a double stranded DNA (double stranded DNA) probe or RNA probe.

The probe can be chemically synthesized using a phosphoramidite solid support method, or other well-known method. These probes can be modified using a number of means known in the art, as long as they have the effect of detecting type A avian influenza virus, Newcastle disease virus or chicken infectious bronchitis virus. Examples of such modifications are methylation, encapsulation, substitution with one or more homologs of natural nucleotides, and modification between nucleotides, such as uncharged linkages (eg methyl phosphonate, phosphotriester, phosphoroamidate , Carbamate, etc.) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids can include one or more additional covalently attached residues, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

The probe may be further bonded to a reporter at its 5 'end. The reporters are FAM (6-carboxyfluorescein), Texas red, fluorescein, fluorescein chlorotriazinyl, HEX (2 ', 4', 5 ', 7'-tetrachloro -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, fluorescein isothiocyanate (FITC), oregon green, alexa Fluoro (alexa fluor), JOE (6-Carboxy-4 ', 5'-Dichloro-2', 7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N- (1-Naphthyl) ethylenediamine), VIC (2′-chloro-7′phenyl-1,4-dichloro-6-carboxy-fluorescein), cyanine (Cyanine) may be any one or more selected from the group consisting of dyes and thiadicarbocyanine (thiadicarbocyanine), but can be used as long as it is known in the art that can be used as a reporter. In one embodiment of the present invention, the reporter may be FAM, VIC or Cy5.

The probe may further be conjugated with a quencher at its 3 'end. The quencher is TAMRA, black hole quencher (BHQ) 1, BHQ2, BHQ3, non-fluorescent quencher (NFQ), dabcyl, Eclipse, deep dark quencher (DDQ), Blackberry Quencher, Iowa Black ( Iowa black) may be any one or more selected from the group consisting of, but any other known in the art that can be used as a quencher can be used. In one embodiment of the present invention, the quencher may be a minor groove binder non-fluorescent quencher (MBGNFQ) or BHQ.

In addition to the primer set and probe, the composition may include a reverse transcriptase, a DNA polymerase, a cofactor such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP. A variety of DNA polymerases can be used in the amplification step of the present invention to amplify reverse transcribed cDNA, and examples of DNA polymerases include Klenow fragments of E.coli DNA polymerase I, thermostable DNA polymerases or bacteriophage T7 DNA polymerization There are enzymes. The polymerase can be obtained from cells that are isolated from the bacteria itself, purchased commercially or express high levels of the cloning gene encoding the polymerase.

In a specific embodiment of the present invention, the inventors of the first forward primer described in the nucleotide sequence of SEQ ID NO: 1, the second forward primer described in the nucleotide sequence of SEQ ID NO: 4, the third described in the nucleotide sequence of SEQ ID NO: 5 Forward primer, 4th forward primer described by nucleotide sequence of SEQ ID NO: 10, 1st reverse primer described by nucleotide sequence of SEQ ID NO: 2, 2nd reverse primer described by nucleotide sequence of SEQ ID NO: 6, base of SEQ ID NO: 7 A third reverse primer described as a sequence, and a fourth reverse primer described as a nucleotide sequence of SEQ ID NO: 11, and probes respectively described as nucleotide sequences of SEQ ID NOs: 3, 8, 9, and 12 were prepared (see Table 1). .

In addition, the present inventors confirmed that as a result of performing multiplex real-time RT-PCR using the primer and probe set, only type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus were specifically identified and detected (Table) 2 to 6, and FIG. 1), it was confirmed that the minimum detection limit for each virus is 13, 18 and 19 copies / reaction, respectively (see FIGS. 2 to 4).

In addition, the present inventors have confirmed that the primers and probe sets have excellent analytical sensitivity compared to known primer sets (see Tables 7 to 10, and FIGS. 5 to 7), and theoretical detectability compared to other known primer sets and It was confirmed that the actual RT-PCR detection efficiency is excellent (see Tables 11 to 19 and FIGS. 8 to 15).

Therefore, the primer and probe set can be useful for the detection and diagnosis of type A avian influenza, Newcastle disease and chicken infectious bronchitis virus.

In addition, the present invention provides a kit for detecting avian influenza type A, influenza A, and Newcastle disease and chicken infectious bronchitis virus, comprising the composition for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus of the present invention.

The composition may have the characteristics as described above. In one example, the composition is a first forward primer described in the base sequence of SEQ ID NO: 1; A second forward primer described by the nucleotide sequence of SEQ ID NO: 4; A third forward primer described by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer described in SEQ ID NO: 10; A first reverse primer described as the nucleotide sequence of SEQ ID NO: 2; A second reverse primer described as the nucleotide sequence of SEQ ID NO: 6; A third reverse primer described as the nucleotide sequence of SEQ ID NO: 7; And a set of primers for detecting type A avian influenza, Newcastle disease and chicken infectious bronchitis virus, consisting of a fourth reverse primer described by the nucleotide sequence of SEQ ID NO: 11. In addition, the composition may further include probes respectively described as nucleotide sequences of SEQ ID NOs: 3, 8, 9, and 12, wherein the probe further includes a reporter at its 5 'end and a quencher at its 3' end. It may be spliced.

The kit may further include one or more other component compositions, solutions, or devices suitable for analytical methods. The kit includes tubes or other suitable containers, reaction buffers (pH and magnesium concentrations) in addition to specific primer pairs for the matrix gene region of the A type influenza virus, the matrix gene region of the Newcastle disease virus, and the spike glycoprotein 1 region of the chicken infectious bronchitis virus. May vary), deoxynucleotides (dNTPs), Taq-polymerases and enzymes such as reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water (DEPC-water) and sterile water. Meanwhile, the components included in the kit may be manufactured in a liquid form, or may be manufactured in a dried form in order to improve the stability of the product by lowering the degrees of freedom of the components. In order to manufacture the dried form, application of a drying step is required, and at this time, heating, natural drying, vacuum drying, freeze drying, or a combination process thereof may be used.

In addition, the present invention is a type A avian influenza A, comprising performing a real-time RT-PCR using a primer set for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus of the present invention as a template nucleic acid isolated from a sample, A method of detecting Newcastle disease and chicken infectious bronchitis virus is provided.

The sample may be obtained from a clinical sample or an environmental sample. For example, the clinical sample may be a sample obtained from tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.

The primer set may have the characteristics as described above. For example, the primer set may specifically amplify the matrix gene region of the type A avian influenza virus, the matrix gene region of the Newcastle disease virus, and the spike glycoprotein 1 region of the chicken infectious bronchitis virus. In addition, the primer set is 10 to 40 complementarily binding to the gene of the matrix gene region of the A type influenza virus, the matrix gene region of the Newcastle disease virus, or the spike glycoprotein 1 region of the chicken infectious bronchitis virus, specifically 15 It may be a forward and reverse primer pair consisting of 30 base sequences. In one embodiment of the present invention, the primer set is a first forward primer described by the base sequence of SEQ ID NO: 1; A second forward primer described by the nucleotide sequence of SEQ ID NO: 4; A third forward primer described by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer described in SEQ ID NO: 10; A first reverse primer described as the nucleotide sequence of SEQ ID NO: 2; A second reverse primer described as the nucleotide sequence of SEQ ID NO: 6; A third reverse primer described as the nucleotide sequence of SEQ ID NO: 7; And it may be made of a fourth reverse primer described in the base sequence of SEQ ID NO: 11.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Manufacture of primers and probes for detecting type A avian influenza, Newcastle disease and chicken infectious bronchitis virus

The National Biological Information Center (NCBI, https://www.ncbi.nlm.nih.gov/) searches the gene sequences for each of the A type influenza A, Newcastle disease, and chicken infectious bronchitis virus, and then sorts each sequence Thus, 1500, 390, and 480 base sequence databases were obtained for each virus. Multi-alignment was performed using nucleotide sequences for each virus, and primers and probes were designed and prepared in a conserved region (Table 1). The produced probes (SEQ ID NOs: 3, 8, 9, and 12) were 97.7%, 96%, and 96% for the type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus, respectively, when sorting the entire database. The detection rate was shown.

virus Primer or
Probe Sequence (5 '→ 3') Target Sequence number Avian influenza virus Influenza A F AAT CCT GTC ACC TCT GAC TAA GG matrix
(matrix)
gene One Influenza A R CAT TYT GGA CAA AKC GTC TAC G 2 Influenza A probe
(FAM, MGBNFQ) TGC AGT CCT CGC TCA C 3 Newcastle disease virus NDV F1 AGTGATGTGCTCGGACCYTC matrix
gene 4 NDV F2 AGYGATGTACTTGGGCCATC 5 NDV R1 CCTGRGGAGAGGCATTTGCTA 6 NDV R2 CCTGAGGGGATGCATTGGCAA 7 NDV 1 probe
(VIC, MGBNFQ) TTCTCTAGCAGTGGGACAG 8 NDV 2 probe
(VIC, MGBNFQ) TTCTCAAGCAGCGGAAC 9 Chicken infectious bronchitis virus IBV F1 AAT TAA GCA AGA CTT TTG AAT GTG G spike
Glycoprotein 1 (spike glycoprotein 1) gene 10 IBV R1 CCT ACT CTG CCA TAT ATA TTA TAG TCA ACA C 11 IBV probe
(Cy5, BHQ) GRT TTA TGT TAC TAA GAG YGA TGG CTC TCG T 12

Experimental Example 1. Identification of the type A avian influenza, Newcastle disease and chicken infectious bronchitis virus differentiation ability using the primer and probe set of the present invention

Using the primers and probe set prepared in Example 1, multi-real-time RT-PCR was performed to determine whether or not it was possible to distinguish and detect type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus.

Specifically, each RNA sample of type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus was obtained from Konkuk University Industry-Academic Cooperation Foundation (Korea). Using the RNA samples, according to the primer and probe concentrations shown in Table 2, reaction composition shown in Table 3 and reaction conditions shown in Table 4, real-time PCR instrument (ABI7500; Applied Biosystems 7500 Real-Time PCR Instrument System, Applied Biosystems, RT) using RT-PCR and analyzed using detection software (ABI Version 2.3, USA).

virus Primer or probe Concentration (nM) Avian influenza virus Influenza A F 250 Influenza A R 250 Influenza A probe 100 Newcastle disease virus NDV F1 250 NDV F2 250 NDV R1 250 NDV R2 250 NDV 1 probe 100 NDV 2 probe 100 Chicken infectious bronchitis virus IBV F 250 IBV R 250 IBV probe 200

Reaction composition Usage (μl) 4 × RT buffer ^a 5 Primer and probe mix 4 Sterile distilled water 6 Template RNA sample 5 Sum 20

^a 4 × RT buffer: Kozen Biotech (Korea)

Temperature (℃) time Number of cycles 50 30 minutes One 95 10 minutes One 95 15 seconds 40 60 1 minute

As a result, it was confirmed that when performing multiple real-time RT-PCR using the primer and probe set of the present invention, it is possible to discriminate and detect type A avian influenza, Newcastle disease and chicken infectious bronchitis virus (FIG. 1).

Experimental Example 2. Confirmation of analytical specificity of multiple real-time RT-PCR using the primer and probe set of the present invention

Analytical specificity of multiple real-time RT-PCRs using the primers and probe sets of the present invention were analyzed for RNA samples of type A avian influenza, Newcastle disease and chicken infectious bronchitis virus (Table 5), RNA samples of 5 viruses, 15 bacteria and 6 It was confirmed by detection of a gDNA (genomic DNA) sample (Table 6) of a species healthy animal.

Specifically, a multi-real-time RT-PCR was performed in the same manner as described in Experimental Example 1, except that the samples described in Tables 5 and 6 below were used as a template.

number Classification name number Classification name One Avian influenza virus H1N3 19 Chicken contagious
bronchitis
virus Avian infectious bronchitis virus (No. 1) 2 H2N1 20 Avian infectious bronchitis virus (No. 2) 3 H2N5 21 Avian infectious bronchitis virus (No. 3) 4 H3N2 22 Avian infectious bronchitis virus (No. 4) 5 H3N8 23 Avian infectious bronchitis virus (No. 5) 6 H4N6 24 Avian infectious bronchitis virus (No. 6) 7 H5N1 25 Avian infectious bronchitis virus (No. 7) 8 H5N2 26 Avian infectious bronchitis virus (No. 8) 9 H5N3 27 Avian infectious bronchitis virus (No. 9) 10 H5N9 28 Avian infectious bronchitis virus (No. 10) 11 H6N2 29 Avian infectious bronchitis virus (No. 11) 12 H9N2 30 Avian infectious bronchitis virus (No. 12) 13 H12N5 31 Avian infectious bronchitis virus (No. 13) 14 Newcastle disease virus Newcastle disease virus (No. 1) 32 Avian infectious bronchitis virus (No. 14) 15 Newcastle disease virus (No. 2) 33 Avian infectious bronchitis virus (No. 15) 16 Newcastle disease virus (No. 3) 34 Avian infectious bronchitis virus (No. 16) 17 Newcastle disease virus (No. 4) 18 Newcastle disease virus (No. 5)

All of the RNA samples were obtained from Konkuk University Industry-Academic Cooperation Foundation (Korea).

number name Where to get virus One Parainfluenza virus-1 Vircell M037 2 Parainfluenza virus-2 Vircell M038 3 Parainfluenza virus-3 Vircell M039 4 Respiratory syncytial virus A Vircell M041 5 Respiratory syncytial virus B Vircell M083 bacteria One Bacillus cereus ^a ATCC 9634 2 Campylobacter jejuni ATCC 33250 3 Escherichia coli ATCC 25922 4 Listeria monocytogenes ATCC 19113 5 Salmonella enteritidis ATCC 19214 6 Salmonella typhi ATCC 19214 7 Salmonella typhimurium ATCC 29629 8 Shigella sonnei ATCC 9290 9 Staphylococcus aureus ATCC 23235 10 Vibrio vulnificus ATCC 27562 11 Yersinia enterocolitica ATCC 9610 12 Legionella pneumophila ATCC 33152 13 Mycoplasma pneumoniae ATCC 15531 14 Mycoplasma gallisepticum ATCC® qCRM-19610D 15 Mycoplasma synoviae ATCC® qCRM-25204D Animal species One Human Konkuk University Industry-Academic Cooperation Foundation
(Republic of Korea) 2 Cow 3 Porcine 4 Chicken 5 Duck 6 Turkey

^a ATCC: American Type Culture Collection

As a result, all of the type A avian influenza A, Newcastle disease and chicken infectious bronchitis virus of Table 5 were detected by the primer and probe set of the present invention, but no amplification reaction was detected in the virus, bacteria and healthy animal samples of Table 6. This suggests that the primer and probe set of the present invention can specifically detect only type A avian influenza, Newcastle disease and chicken infectious bronchitis virus.

Experimental Example 3. Confirmation of analytical sensitivity of multiple real-time RT-PCR using the primer and probe set of the present invention

The analytical sensitivity of multiple real-time RT-PCR using the primer and probe set of the present invention was confirmed using a type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus RNA samples.

3-1. Preparation of avian influenza A, Newcastle disease and chicken infectious bronchitis virus samples

Oligomers were synthesized by collecting information on each virus nucleotide sequence at a site containing the sequences of the primers and probe sets of the present invention described in Table 1 above from NCBI and requesting the oligomer synthesis company. Using the synthesized oligomer as a template, a single real-time RT-PCR was performed for each virus in the same manner as described in Experimental Example 1 above. Each PCR product was purified using a PCR purification kit (QIAquick PCR Purification Kit, Qiagen, Germany). After the plasmid prepared by ligating the purified PCR product of each virus to pGEM T vector (pGEM T Vector System I, Promega, USA), transformed into soluble cells (MAX Efficiency DH5a Competent Cell, Invitrogen, USA) ). Then, each plasmid DNA was isolated using a kit (QIAprep Spin Miniprep kit, Qiagen). Synthetic RNA was obtained by performing in vitro transcription using the plasmid DNA and transcription kit (MAXIscipt ^TM T7 Transcription Kit, Thermo Fisher Scientific, USA). Each RNA sample was quantified using a spectrophotometer, and the number of RNA copies was calculated using the following equations 1 and 2:

[Equation 1]

Number of moles of ssRNA (mol) = weight of ssRNA (g) / {(length of ssRNA (nt) × 321.47 g / mol) + 18.02 g / mol}

[Equation 2]

Number of RNA copies = number of moles of ssRNA × 6.022 × 10 ²³ pieces / mol.

3-2. Confirmation of analytical sensitivity of multiple real-time RT-PCR using the primer and probe set of the present invention

RNA samples of each type A avian influenza, Newcastle disease and chicken infectious bronchitis virus obtained in Experimental Example 3-1 were 13 × 10 ⁵ copies / reaction, 18 × 10 ⁵ copies / reaction and 19 × 10 ⁴ copies / reaction, respectively. Quantitatively, diluted 10-fold step by step, respectively, the A-type avian influenza and Newcastle disease virus samples were used in the same manner as described in Experimental Example 1, except that 6 samples were used, and 6 cases of chicken infectious bronchitis virus samples were used. Real-time RT-PCR was performed.

As a result, the primer and probe set of the present invention detected type A avian influenza, Newcastle disease and chicken infectious bronchitis virus up to 13 copies / reaction, 18 copies / reaction and 19 copies / reaction, respectively (FIGS. 2 to 4).

Experimental Example 4. Confirmation of excellent detection efficiency of RT-PCR using primers and probe sets of the present invention compared to known primer sets (1)

In order to confirm the superiority of the analytical sensitivity of real-time RT-PCR using the primer and probe set of the present invention, the primer and probe set of the present invention, a commercially available primer set for detecting avian influenza A virus, and known Newcastle disease virus and chicken infectivity RT-PCR was performed using a primer set for detection of bronchitis virus (Standard Diagnostics for Homogenous Diseases, Vol.2.

4-1. Comparison with primer set for detecting type A avian influenza virus

Multiple real-time RT-PCR was performed in the same manner as described in Experimental Example 1, except that the type A avian influenza virus-positive RNA sample 1 of Table 5 was diluted 10-fold stepwise and used at 5 concentrations. In addition, except for using the same RNA sample and a commercialized primer set (PowerChek ^TM Avian Influenza Real-time PCR Kit series M gene, Cat.No.VR2101, KOGENEBIOTECH CO. LTD., Korea) described in Experimental Example 1 Real-time RT-PCR was performed in the same manner.

As a result, it was confirmed that the primer and probe set of the present invention detected the A-type avian influenza virus sample up to the 5-step diluted concentration, while the commercialized primer set detected up to the 4-step diluted concentration (FIG. 5). This suggests that the real-time RT-PCR using the primer and probe set of the present invention has better analytical sensitivity than the real-time RT-PCR using the commercialized primer set.

4-2. Comparison with primer set for detection of Newcastle disease virus

Multiple real-time RT-PCR was performed in the same manner as described in Experimental Example 1, except that the Newcastle disease virus-positive RNA sample No. 14 of Table 5 was diluted 10-fold stepwise and used at 5 concentrations. In addition, RT-PCR using the same RNA sample and a known primer set was performed under the reaction conditions of Table 8 using the primers of Table 7. The reaction composition was mixed with 5 µl of 4 × RT buffer (Kogen Biotech), 1 µl of each primer pair (250 nM) in Table 7, 8 µl of sterile distilled water, and 5 µl of the template RNA sample to make a total volume of 20 µl, SimpliAmp ^TM Thermal Cycler (Applied Biosystems, USA) was used as a PCR instrument. The PCR amplification product was applied to a 2% agarose gel containing nucleic acid staining reagent (RedSafe ^™ Nucleic Acid Staining Solution), Tris-acetate buffer and standard-DNA markers. The band was detected by electrophoresis at 100 V for 30 minutes.

Primer name Sequence (5 '→ 3') Target gene Amplification product size (bp) Sequence number NDCom-F ATACACCTCRTCYCAGACAG F protein 379 13 NDCom-R TGCCACTGMTAGTTGYGATA 14

Classification Temperature (℃) time Number of cycles RT cDNA synthesis 45 30 minutes One Pre-denaturation 94 5 minutes One PCR Denaturation 94 20 seconds 40 Annealing 50 30 seconds Height 72 30 seconds Final height 72 5 minutes One

As a result, it was confirmed that the primer and probe set of the present invention detected the Newcastle disease virus sample to a concentration diluted in 4 steps, while the known primer set detected to a concentration diluted in 2 steps (FIG. 6). This suggests that the real-time RT-PCR using the primer and probe set of the present invention has better analytical sensitivity than the real-time RT-PCR using the known primer set.

4-3. Comparison with primer set for detection of chicken infectious bronchitis virus

Multiple real-time RT-PCR was performed in the same manner as described in Experimental Example 1, except that the chicken infectious bronchitis virus-positive RNA sample No. 18 in Table 5 was diluted 10-fold stepwise and used at 5 concentrations. In addition, RT-PCR using the same RNA sample and a known primer set was performed in the same manner as described in Experimental Example 4-2, except that the reaction conditions of Table 10 were applied using the primers of Table 9 below.

Primer name Sequence (5 '→ 3') Target gene Amplification products
Size (bp) Sequence number IBV F AGC AAC GCC AGT TGT TAA TTT G ORF1b and Spike genes 750 ~ 790 15 IBV R CWG TAC CAT TAA CAA ART AAG CMA G 16

Classification Temperature (℃) time Number of cycles RT cDNA synthesis 50 30 minutes One Pre-denaturation 95 15 minutes One PCR denaturalization 94 1 minute 35 Annealing 52 1 minute kidney 72 1 minute 30 seconds Final height 72 10 minutes One

As a result, it was confirmed that the primer and probe set of the present invention detected the chicken infectious bronchitis virus sample up to the 5-step diluted concentration, while the known primer set detected up to the 4-step diluted concentration (FIG. 7). This suggests that the real-time RT-PCR using the primer and probe set of the present invention has better analytical sensitivity than the real-time RT-PCR using the known primer set.

Experimental Example 5. Confirmation of excellent detection efficiency of RT-PCR using primers and probe sets of the present invention compared to known primer sets (2)

To confirm the superiority of multiple real-time RT-PCR detection efficiency using the primer and probe set of the present invention, the primer and probe set of the present invention and a known primer set (Thanh Trung Nguyen et al. , Journal of Virological Methods, 188: 41-46, 2013) was compared and analyzed for theoretical detectability and RT-PCR detection efficiency for type A avian influenza, Newcastle disease and chicken infectious bronchitis virus.

5-1. Comparison of the theoretical detectability of the primers and probe sets of the present invention and known primer sets against type A avian influenza, Newcastle disease and chicken infectious bronchitis virus

By analyzing the ratio of the base sequence of the primer and probe set of the present invention and the known primer set to the base sequence of the target site for each virus, the theoretical detectability of the virus was compared and analyzed.

5-1-1. Comparison of theoretical detectability for type A avian influenza virus

Select one representative base sequence from the matrix genes of the A type influenza virus (accession No. KX297769), select one representative base sequence from the nucleoprotein gene (accession No. KX297801), and then The representative base sequence was blasted by NCBI to collect the base sequence of 60 related genes. The base sequence of 60 types of matrix genes of type A avian influenza virus collected using Genius® 10.0.7 software (Geneious® 10.0.7 software) and the primer and probe set of the present invention (Table 1, SEQ ID NOS: 1 to 3) Concordance rates between sequences were investigated, and the concordance rates between the base sequences of 60 nuclear protein genes of the collected type A avian influenza virus and known primer sets (Table 11, SEQ ID NOs: 17 and 18) were investigated.

Primer name Sequence (5 '→ 3') Target gene Amplification products
Size (bp) Sequence number AIV F1 (GTCTACCAGGCATTCGCTT) ^* CAATGGTTGGTGGAATTGGAA Nuclear protein gene 665 17 AIV R1 (TGGGTGACTCAATTCTGCTG) ^* TTTCAGCATTCCCAGGATTC 18 NDV F1 (GTCTACCAGGCATTCGCTT) ^* CTTCTACCAGGATCCCAGCAC Fusion protein gene 386 19 NDV R1 (TGGGTGACTCAATTCTGCTG) ^* ATGCCTCTAATGGGGCTTTT 20 IBV F1 (GTCTACCAGGCATTCGCTT) ^* CCAGGAYCAGCARAAGAAGG Nucleocapsid protein gene 236 21 IBV R1 (TGGGTGACTCAATTCTGCTG) ^* TTGGACGTGTVCCTACACCA 22 Common-F (GTCTACCAGGCATTCGCTTC) ^* 23 Common-R (TGGGTGACTCAATTCTGCTG) ^* 24

^* This is a common sequence for secondary PCR, not a virus-specific sequence, and is excluded from theoretical detection potential analysis.

As a result, the primers and probe sets (SEQ ID NOS: 1 to 3) for detecting A type influenza virus of the present invention showed 100% nucleotide sequence matching with the target gene, while known primer sets (SEQ ID NOs: 17 and 18) The nucleotide sequence matching rate with the target gene was 90 to 100% (Fig. 8, Fig. 9 and Table 12). This suggests that the primer and probe set of the present invention have a higher theoretical detectability for the detection of avian influenza A virus than the known primer set.

5-1-2. Comparison of theoretical detectability for Newcastle disease virus

One of the representative sequences of the entire gene of the Newcastle disease virus was selected (accession No. DQ485229) and blasted by NCBI to collect the base sequence of 50 related genes. The base sequence of 50 Newcastle disease virus genes collected using Genius 10.0.7 software and the base sequence of the primers and probe sets (Table 1, SEQ ID NOs: 4, 6 and 8) of the present invention were investigated, and the collected Newcastle disease The agreement rate between the base sequences of 50 viral genes and the base sequences of known primer sets (Table 11, SEQ ID NOs: 19 and 20) was investigated.

As a result, the primer and probe set (SEQ ID NOs: 4, 6, and 8) for detecting Newcastle disease virus of the present invention showed a 100% sequencing rate with the target gene, while a known primer set (SEQ ID NOs: 19 and 20) The nucleotide sequence matching rate with the target gene was 85 to 100% (FIG. 10 and Table 13). This suggests that the primer and probe set of the present invention have a higher theoretical detectability for detection of Newcastle disease virus than the known primer set.

5-1-3. Comparison of theoretical detectability for chicken infectious bronchitis virus

Select one representative base sequence from Spike glycoprotein 1 gene of chicken infectious bronchitis virus (accession No. KY421672), and select one representative base sequence from the nucleocapsid protein gene ( accession No. KY421672), each representative base sequence was blasted by NCBI to collect the base sequence of 60 related genes. The nucleotide sequence of 60 kinds of chicken infectious bronchitis virus genes collected using Genius 10.0.7 software and the base sequence of the primers and probe sets (Table 1, SEQ ID NOs: 9 to 12) of the present invention were investigated and collected. The concordance rate between the base sequence of 60 infectious bronchitis virus genes and the base sequence of a known primer set (Table 11, SEQ ID NOs: 21 and 22) was investigated.

As a result, the primer and probe set for detecting chicken infectious bronchitis virus of the present invention (SEQ ID NOs: 9 to 12) showed a nucleotide sequence matching rate with the target gene of 94 to 100%, while a known primer set (SEQ ID NOs: 21 and 22) ), The nucleotide sequence matching rate with the target gene was 84 to 100% (Fig. 11, Fig. 12 and Table 14). This suggests that the primers and probe sets of the present invention have a higher theoretical detectability for chicken infectious bronchitis virus detection than known primer sets.

5-2. Comparison of RT-PCR detection efficiency for the A and Avian influenza, Newcastle disease and chicken infectious bronchitis virus of the primer and probe set of the present invention and known primer sets

By analyzing and analyzing the analytical sensitivity of RT-PCR using the primer and probe set of the present invention, and a known primer set, the detection efficiency of A type avian influenza, Newcastle disease and chicken infectious bronchitis virus was compared.

5-2-1. Multiple real-time RT-PCR results using the primer and probe set of the present invention

Multiple real-time RT-PCR using the primer and probe set of the present invention was performed in the same manner as described in Experimental Example 1, except that the sample of Table 15 below was used as the template RNA sample.

As a result, the primers and probes of the present invention were classified into a type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus to detect all target samples without non-specific amplification (FIG. 13 and Table 16).

5-2-2. Nested RT-PCR results using a known primer set

First, cDNA was synthesized by reverse transcription of RNA samples in Table 15 using RT- & GO ^TM kit (Qbiogene, Korea). 1 μl of the cDNA, 4 μl of 2 × magnesium chloride-free PCR buffer (2 × MgCl ₂ -free PCR buffer), 2 μl of 2.5 mM magnesium chloride, 1.6 μl of 0.8 mM / μl dNTP, 500 nM of each primer (Table 11, SEQ ID NOs: 17 to 22) 0.5 µl and 2.5 U tack DNA polymerase (Taq DNA polymerase, iNtRON Biotechnology, Korea) were mixed and added to distilled water to make a total of 20 µl. The first PCR was performed using the reaction mixture and PCR instrument (C1000 Touch ^TM Thermal Cycler, Bio-Rad, USA) under the reaction conditions in Table 17.

Temperature (℃) time Number of cycles 94 5 minutes One 94 30 seconds 35 53 30 seconds 72 1 minute 72 8 minutes One 4 holding

0.5 µl of the PCR product and 1 µl of each primer (Table 11, SEQ ID NOs: 23 and 24) of 500 nM were mixed, and the PCR kit (Maxime ^TM PCR PreMix Kit, iNtRON Biotechnology) was used to prepare the mixture in Table 18. Secondary PCR was performed under the reaction conditions.

Temperature (℃) time Number of cycles 94 5 minutes One 94 30 seconds 30 55 30 seconds 72 40 seconds 72 8 minutes One 4 holding

The final PCR product was added to a 1.5% agarose gel containing nucleic acid staining reagent (RedSafe ^™ Nucleic Acid Staining Solution), Tris-acetate buffer and standard-DNA markers. Electrophoresis was performed for 30 minutes at 100 V and photographed (Gel Doc XR, Gel Documentation System, Bio-Rad).

As a result, the known primer set was amplified in both primary and secondary PCR out of 20 samples of type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus, and only 6 samples were detected (FIG. 14 and Table 19). . In addition, the known primer set showed a large number of non-specific amplification bands in addition to the target virus (FIG. 15).

It can be seen from the above Experimental Examples 5-2-1 and 5-2-2 that the primers and probe sets of the present invention exhibit better detection efficiency than known primer sets in detecting type A avian influenza, Newcastle disease and chicken infectious bronchitis virus. have.

<110> KoGene BioTech Co., LTD. <120> Primers and probes for detection of avian influenza, newcastle          disease and avian infectious bronchitis viruses, and detecting          method of avian influenza, newcastle disease and avian infectious          bronchitis viruses using the same <130> 2018P-12-020 <150> KR 10-2018-0145082 <151> 2018-11-22 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Influenza A F <400> 1 aatcctgtca cctctgacta agg 23 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Influenza A R <400> 2 cattytggac aaakcgtcta cg 22 <210> 3 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Influenza A probe <400> 3 tgcagtcctc gctcac 16 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDV F1 <400> 4 agtgatgtgc tcggaccytc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDV F2 <400> 5 agygatgtac ttgggccatc 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NDV R1 <400> 6 cctgrggaga ggcatttgct a 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NDV R2 <400> 7 cctgagggga tgcattggca a 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NDV 1 probe <400> 8 ttctctagca gtgggacag 19 <210> 9 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> NDV 2 probe <400> 9 ttctcaagca gcggaac 17 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IBV F1 <400> 10 aattaagcaa gacttttgaa tgtgg 25 <210> 11 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> IBV R1 <400> 11 cctactctgc catatatatt atagtcaaca c 31 <210> 12 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> IBV probe <400> 12 grtttatgtt actaagagyg atggctctcg t 31 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDCom-F <400> 13 atacacctcr tcycagacag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDCom-R <400> 14 tgccactgmt agttgygata 20 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IBV F <400> 15 agcaacgcca gttgttaatt tg 22 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IBV R <400> 16 cwgtaccatt aacaaartaa gcmag 25 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> AIV F1 <400> 17 gtctaccagg cattcgcttc aatggttggt ggaattggaa 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> AIV R1 <400> 18 tgggtgactc aattctgctg tttcagcatt cccaggattc 40 <210> 19 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> NDV F1 <400> 19 gtctaccagg cattcgcttc ttctaccagg atcccagcac 40 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> NDV R1 <400> 20 tgggtgactc aattctgctg atgcctctaa tggggctttt 40 <210> 21 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> IBV F1 <400> 21 gtctaccagg cattcgcttc caggaycagc araagaagg 39 <210> 22 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IBV R1 <400> 22 tgggtgactc aattctgctg ttggacgtgt vcctacacca 40 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Common-F <400> 23 gtctaccagg cattcgcttc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Common-R <400> 24 tgggtgactc aattctgctg 20

Claims (6)

A first forward primer described by the nucleotide sequence of SEQ ID NO: 1;
A second forward primer described by the nucleotide sequence of SEQ ID NO: 4;
A third forward primer described by the nucleotide sequence of SEQ ID NO: 5;
A fourth forward primer described in SEQ ID NO: 10;
A first reverse primer described as the nucleotide sequence of SEQ ID NO: 2;
A second reverse primer described as the nucleotide sequence of SEQ ID NO: 6;
A third reverse primer described as the nucleotide sequence of SEQ ID NO: 7; And
A set of primers for detecting type A avian influenza, Newcastle disease and chicken infectious bronchitis virus consisting of a fourth reverse primer described by the base sequence of SEQ ID NO: 11.
Composition for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus comprising the primer set of claim 1.
According to claim 2, The composition SEQ ID NO: 3, 8, 9 and 12, further comprising a probe described in each of the nucleotide sequence, type A avian influenza, Newcastle disease and chicken infectious bronchitis virus detection composition.
A kit for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus comprising the composition of claim 2.
A type of avian influenza comprising the step of performing a real-time reverse transcription polymerase chain reaction (RT-PCR) using the primer set of claim 1 as a template for nucleic acids isolated from a sample, Newcastle disease and chicken infectious bronchitis virus detection method.
The method according to claim 5, wherein the sample is obtained from a clinical sample or an environmental sample, a type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus detection method.

Images