KR102435209B1 - Composition for simultaneously distinguishing and detecting influenza type A and type B viruses and type 2 severe acute respiratory syndrome coronavirus and detection method using the same - Google Patents

Abstract

The present invention relates to a composition for simultaneously distinguishing and detecting influenza type A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2), and a detection method using the same and, more specifically, to a method for rapidly and accurately detecting the three types of viruses at the same time by combining primer and probe sets capable of detecting each of the three types of viruses using real-time polymerase chain reaction technology.

Description

Composition for simultaneously distinguishing and detecting influenza type A and B viruses and type 2 severe acute respiratory syndrome coronavirus and a detection method using the same syndrome coronavirus and detection method using the same}

The present invention provides a composition for simultaneously detecting and distinguishing influenza A and B viruses from type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) and a detection method using the same, specifically relates to a method for rapidly and accurately detecting the three types of viruses at the same time by combining primers and probe sets capable of detecting each of the three types of viruses using real-time polymerase chain reaction technology.

Influenza refers to an infectious disease caused by an influenza virus of the orthomyxoviridae family. Specifically, influenza is an acute febrile respiratory disease caused by influenza virus infection worldwide, which infects 5 to 10% of the adult population and 20 to 30% of children each year, and 3 to 5 million people become severely exacerbated 29 It is an infectious disease that kills ~650,000 people.

Most people infected with influenza heal naturally within 5 to 9 days, but the elderly, chronically ill, children, pregnant women, etc. may develop complications such as pneumonia, or the treatment period may be prolonged due to worsening of the underlying disease, and some may even die.

In Korea, in 2000, influenza was designated as a group 3 legal infectious disease in the 「Act on the Prevention and Management of Infectious Diseases」, a clinical monitoring system in which public health centers and private medical institutions across the country participate, and an experiment involving the Institute of Health and Environment and private medical institutions. It was expanded to an influenza sample monitoring system consisting of a monitoring system.

In recent seasons in Korea, it has risen rapidly beyond the epidemic standard in early December, peaking at the end of December, and then decreasing. In spring, influenza type B showed a typical pattern of double-peaked epidemics. In the 2018-2019 season, the proportion of influenza-like illness (ILI) by age was relatively high for 7-12 years old (please check), and the age of 13-18 years old was 51 weeks, one week earlier than weekly monitoring. (12.16~12.22), 1~6 years old, 19 years old or older (please confirm.) appeared at 52 weeks (12.23~12.29) same as the weekly monitoring.

The influenza pseudo-patient fraction (ILI) refers to the number of pseudo-influenza patients per 1000 inpatients. Here, an influenza doctor patient refers to a patient who shows a cough or sore throat along with a sudden fever of 38°C or higher (Infectious Diseases General Division, Infectious Disease Control Center, Korea Centers for Disease Control and Prevention, Park Kwang-sook, Park Soo-jin, Kwon Dong-hyuk, Lee Dong-han, 2018-2019 season influenza sample monitoring results, Weekly Health and Illness 2019 Vol 12 No. 49 p.2224 ~ 2232).

Influenza virus (influenza virus) belongs to the family of orthomyxoviridae and is a virus having 8 negative single-stranded RNA segments as a genome, and is a major causative agent of viral respiratory diseases. From the eight RNA fragments, hemagglutinin (HA), neuraminidase (NA), nucleocapsid protein (NP), matrix proteins 1 and 2 (matrix, M1, M2), polymerization Polymerase subunits A, B1 and B2 (PA, PB1, PB2, respectively) and nonstructural proteins 1 and 2 (NS1, NS2, respectively) are made.

Influenza viruses are largely classified into type A, type B and type C viruses according to the antigenicity of NP and M proteins among five genera included in the orthomyxovirus family, which is an RNA virus.

Influenza virus type A hosts mammals and birds, and although most cases are non-pathogenic, some subspecies cause influenza in hosts. Influenza virus type A does not usually spread as a major disease, but certain mutations can cause serious illness in humans and domestic poultry such as chickens and ducks. Sometimes viruses are transmitted from wild aquatic birds to poultry, which can cause influenza epidemics ( Animal viruses: molecular biology . Norfolk, UK: Caister Academic Press. 2008. ISBN 978-1-904455-22-6, Influenza virology: current topics (Wymondham: Caister Academic Press. 2006. ISBN 978-1-904455-06-6)

Viruses belonging to influenza virus type A are classified into various serotypes according to the structures of hemagglutinin (H) and neuraminidase (N), which are glycoproteins in the envelope. Hemagglutinin is classified as H1 ~ H18, and neuraminidase is classified as N1 ~ N11 depending on the response to a specific antibody. Subspecies of viruses that cause influenza in humans are mainly composed of combinations of H1, H2, and H3 with N1 and N2.

Influenza virus type B hosts only humans and seals and causes influenza in hosts. Because of the narrow range of hosts, there are very few cases of outbreaks compared to influenza virus type A, which can have a variety of hosts.

Viruses belonging to influenza virus type B have a very small mutation rate compared to viruses belonging to influenza virus type A. That is, mutations occur less frequently, and mutational evolution is also slower. It mutates at a rate about 2-3 times slower (Nobusawa, Eri; Sato, Katsuhiko (April 2006). “Comparison of the mutation rates of human influenza A and B viruses”. Journal of Virology 80 (7): 3675) -3678).

However, influenza virus type B mutates more rapidly than influenza virus type C. Since the human immune system cannot respond quickly enough to keep up with the rate of mutation of this virus, it can spread into a global pandemic and cause many infections (Yamashita, M.; Krystal, M.; Fitch, WM; Palese). , P. (March 1988). “Influenza B virus evolution: co-circulating lineages and comparison of evolutionary pattern with those of influenza A and C viruses”. Virology 163 (1): 112-122).

Therefore, influenza B is indistinguishable from influenza A from the viral form and clinical symptoms, but is important as a pathogen of human influenza like type A.

The M segment of influenza B virus encodes two different genes, M1 and BM2, from which a constituent protein is synthesized. These proteins correspond to M1 and M2 of influenza A virus, but the structure of BM2 of type B is significantly different from M2 of type A. Therefore, the diagnosis or treatment targeting the protein is different.

Influenza virus type C is known to host exclusively humans and pigs, and infection causes influenza in the host (Guo Y.; et al. (27 Aug 1983)). “Isolation of Influenza C Virus from Pigs and Experimental Infection of Pigs with Influenza C Virus”. Journal of General Virology 64 (1): 170-182). Although the incidence is less than that of influenza virus type A or B, once infected, it can cause a serious condition and cause a local epidemic. However, it does not cause a pandemic because it mutates at a slower rate than other influenza viruses.

Unlike influenza virus type A or B, which has 8 RNA segments and consists of more than 10 proteins, type C contains a total of 9 proteins divided into 7 RNA strands. Influenza virus types C and D are 59% similar in amino acid composition, and it is estimated that they diverged about 1,500 years ago. Influenza virus type C does not readily transfer from the current host to the host of other species, and thus the incidence is low, so the study results are small. There are currently six strains, and it is estimated that they developed around AD 1896 (Su, Shuo; Fu, Xinliang; Li, Gairu; Kerlin, Fiona; Veit, Michael (11 17, 2017). “Novel Influenza D virus: Epidemiology, pathology, evolution and biological characteristics”. Virulence 8 (8): 1580-1591).

Coronavirus (Coronavirus) is a generic term for RNA viruses belonging to the coronavirus subfamily (Coronavirinae) of the coronavirus family (Coronaviridae), and causes respiratory and digestive system infections in humans and animals. It is mainly transmitted through mucosal infection and droplet transmission. It usually causes mild respiratory infections in humans, but it can also cause fatal infections. Diarrhea in cattle and pigs, and respiratory diseases in chickens. (de Groot RJ, Baker SC, Baric R, Enjuanes L, Gorbalenya AE, Holmes KV, Perlman S, Poon L, Rottier PJM, Talbot PJ, Woo PCY, Ziebuhr J (2011). “Family Coronaviridae”. AMQ King, E Lefkowitz, MJ Adams, and EB Carstens (Eds), Ninth Report of the International Committee on Taxonomy of Viruses . Elsevier, Oxford).

Coronaviruses are positive-sense single-stranded RNA viruses with a size of 80-220 nm. It is surrounded by an envelope containing lipids, and there are 20 nm crown-like spikes on the envelope. Coronaviruses are composed of four main proteins. These are spike (S), matrix (M), envelope (E) and nucleocapsid (N) proteins. The spike (S) protein of coronavirus consists of S1 and S2 subunits. Among them, the S1 subunit is the head of the spike and has a receptor binding domain (RBD). The S2 subunit is the pillar part of the spike. Matrix (M) and envelope (E) proteins play an important role in forming and maintaining the shape of the virus envelope. Inside the envelope is the nucleocapsid (N) protein (Fehr, Anthony; Perlman, Stanley (2015). Coronaviruses. Methods in Molecular Biology . Springer). Some coronaviruses (particularly members of the beta-coronavirus subfamily) also have short spike-like proteins called antibody esterases.

Coronaviruses are known to be responsible for a significant proportion of the common cold in humans. In addition, it can cause direct viral pneumonia or secondary bacterial pneumonia, and can also cause direct viral bronchitis or secondary bacterial bronchitis.

Coronaviruses have the genetic information of RNA, which mutates easily, resulting in numerous coronavirus strains.

To date, there are seven strains of human coronavirus: human coronavirus HKU1, human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), human coronavirus NL63 (HCoV-NL63, New Haven coronavirus); Severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV) are known.

In addition, recently, severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2) caused a pandemic, a state in which an infectious disease is prevalent around the world. This is the highest risk level among the epidemic alert levels of the World Health Organization (WHO).

Coronavirus Disease 2019 (COVID-19), an acute respiratory disease caused by the type 2 severe acute respiratory syndrome coronavirus (SARS-COV-2), was discovered in Wuhan City, Hubei Province, China in 2019. It was first reported on the 12th of May. It is a disease caused by infection by a novel virus of the coronavirus family, and the main transmission route is by respiratory droplets (droplets) of an infected person.

The main symptoms include fever, cough, shortness of breath, chills, muscle pain, headache, sore throat, and loss of smell and taste. Clinical symptoms vary from asymptomatic, mild to severe. There is no specific treatment, and public treatment such as antipyretics, fluids, and antitussives is provided according to symptoms. Global mortality rates vary from 0.1 to 25% depending on region, population age structure, infection status and other factors. The World Health Organization declared an international public health emergency on January 31, 2020, raised the global risk of COVID-19 to 'very high' as of January 18, and declared a pandemic on March 11. did.

Since the outbreak of Coronavirus Infectious Disease-19 (COVID-19) in Wuhan City, Hubei Province, China in December 2019, it has spread from Wuhan to all of China and at the same time to neighboring Asian countries such as Thailand, Japan, South Korea, Singapore and Hong Kong. In addition, it has rapidly spread to Europe and the world through Italy, which has many economic exchanges with China, and the number of confirmed cases is increasing across the world.

As of July 13, 2021, the number of confirmed cases of COVID-19 worldwide was 187,243,513, and the death toll was 4,038,932 (COVID-19 Dashboard by the Center for Systems Science and Engineering (CSSE) at Johns Hopkins University ( JHU)).

In Korea, large-scale community transmission occurred centered on a specific region beyond the initial sporadic outbreaks due to inflows from China and other countries. Currently, the number of confirmed cases continues to increase nationwide (Seung-Hwa Lee and Jong-Myung Kim, Response and Treatment of the Novel Coronavirus Infectious Disease (COVID-19) Pandemic, Korean J Fam Pract. 2020;10(2):87-95. and Information Analysis Team, Epidemiological Investigation and Analysis Team, Central Quarantine Countermeasures Headquarters Jinhwa Jang, Younghwa Kim, Yuyeon Kim, Hansol Yeom, Inseop Hwang, Kwangsuk Park, Youngjun Park, Sangwon Lee, Donghyuk Kwon, Characteristics of the 1st year of major domestic outbreaks of Coronavirus Infectious Disease-19 (from January 20, 2020 to January 2021. Until 19.), Weekly Health and Illness Vol. 14, No. 9 (February 25, 2021)).

Acute respiratory infections caused by respiratory viruses such as influenza virus and coronavirus show high morbidity and mortality in the elderly, immunocompromised patients, newborns and premature infants. Since the respiratory virus is highly contagious and can be spread explosively in a short period of time, early diagnosis of respiratory virus infection is a very important problem.

As a diagnostic method for the respiratory virus, conventional virus culture method, immunofluorescence staining method, rapid antigen detection method, nucleic acid amplification method, etc. are known. The virus culture method does not have high sensitivity and specificity, and it takes a long time to obtain test results (eg, virus culture takes 2-14 days). In addition, the immunofluorescence method has the advantage that the result can be confirmed within a few hours and multiple viruses can be identified at the same time. The rapid antigen detection method developed for the identification of influenza virus has the advantage of being able to know the test result within a short time (about 15-30 minutes), but the sensitivity (about 40-95%) and the negative predictive value (about 70-90%) ) is low, so it has the disadvantage of requiring additional examination.

On the other hand, the nucleic acid amplification test method has recently been mainly used in hospital laboratories because of the advantage of rapidly detecting various respiratory viruses. In particular, it has superior sensitivity and specificity compared to the virus culture method and antigen detection method. As a nucleic acid amplification test, the polymerase chain reaction (PCR) method is the most used.

Recently, since electrophoresis is not required after the amplification reaction, a real-time PCR method with a low possibility of contamination and a small burden on performance is preferred. However, there is an urgent need in the art for a primer set and/or a probe for more accurately and efficiently detecting a respiratory virus, and a rapid and accurate method for simultaneously detecting a respiratory virus using the same.

Republic of Korea Patent No. 10-1380414 relates to a method for simultaneously specifically detecting multiple respiratory viruses by amplifying target genes using various primers and probes and a kit using the same, and multiplex real-time polymerase chain reaction (PCR). ) through which it is possible to selectively detect multiple respiratory viruses with very high efficiency.

In addition, Chinese Patent Laid-Open Patent (CN 104059997 A) relates to a detection kit for influenza viruses A, B, human metapneumovirus, human coronavirus NL63, HKU1, and OC43. RT using specially designed pathogen primers and pathogen gene probes - Used to perform PCR. By using multi-fluorescent real-time PCR and Tem-PCR technology, the amplification efficiency can be greatly increased, so that the result detected using a general TaqDNA polymerase still has very high detection sensitivity. Here, the influenza A virus probe is the same sequence as SEQ ID NO: 10 disclosed in the present invention A probe comprising a 'TGCAGTCCTCGCTCAC' moiety is disclosed.

The present invention provides a composition for distinguishing and simultaneously detecting influenza type A and type B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2). At the same time, a set of primers and probes that can be specifically detected were prepared after confirming a sequence with high homology through an in silico method. Rapid diagnosis capable of specifically discriminating and simultaneously detecting the three viruses by real-time polymerase chain reaction technology and Taqman probe method using a composition including the primer and probe set By building a system, we want to block the transmission route of influenza and coronavirus infection-19 with similar symptoms.

An object of the present invention is to prepare a primer and probe set capable of simultaneously detecting and distinguishing influenza type A and type B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) and including the same to provide a kit.

In order to achieve the above object, the present invention provides (a) a first forward primer nucleotide sequence represented by SEQ ID NO: 1, (b) a first reverse primer nucleotide sequence represented by SEQ ID NO: 2, (c) SEQ ID NO: 3 A first probe base sequence, (d) a second forward primer base sequence represented by SEQ ID NO: 4, (e) a second reverse primer base sequence represented by SEQ ID NO: 5, (f) a second probe represented by SEQ ID NO: 6 nucleotide sequence, (g) the third forward primer nucleotide sequence represented by SEQ ID NO: 7, (h) the 3-1 reverse primer nucleotide sequence represented by SEQ ID NO: 8, (i) the third 3-2 represented by SEQ ID NO: 9 a reverse primer base sequence, (j) a third probe base sequence represented by SEQ ID NO: 10, (k) a fourth forward primer base sequence represented by SEQ ID NO: 11, (l) a fourth reverse primer base sequence represented by SEQ ID NO: 12 For simultaneous detection of influenza type A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) comprising the sequence and (m) the fourth probe base sequence represented by SEQ ID NO: 13 Primer and probe sets are provided.

In addition, the present invention provides a composition for simultaneous detection of influenza type A and type B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) comprising the primer and probe set.

In addition, there is provided a kit for simultaneous detection of influenza A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) comprising the composition.

In addition, an object of the present invention is 1) performing multiple real-time polymerase chain reaction using the composition or kit; and 2) detecting and analyzing the amplification product obtained from step 1) by distinguishing between influenza A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) It is to provide a method for simultaneous detection.

The composition or kit comprising the primer and probe set of the present invention has good specificity enough to simultaneously detect influenza virus types A and B and SARS-CoV-2, respectively or by distinguishing them from other viruses and pathogens, and the composition Alternatively, high sensitivity was shown when the real-time polymerase chain reaction technique and the Taqman probe method were performed using the kit.

Therefore, through the present invention, it can be used to infer and block the propagation route by establishing a rapid and accurate diagnostic system for influenza and coronavirus infection-19 with similar symptoms.

1 is a kit containing the primer and probe set of the present invention by using a kit containing influenza (influenza) type A and B virus and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) was detected at the same time. It is a graph showing multiple real-time PCR results as an amplification plot.
2 is a graph showing multiple real-time PCR results for detecting influenza A virus as an amplification plot in order to confirm the analytical sensitivity of the kit including the primer and probe set of the present invention.
3 is a graph showing a standard curve for detecting influenza A virus in order to confirm the analytical sensitivity of the kit including the primer and probe set of the present invention.
4 is a graph showing multiple real-time PCR results for detecting influenza B virus as an amplification plot in order to confirm the analytical sensitivity of the kit including the primer and probe set of the present invention.
5 is a graph showing a standard curve for detecting influenza B virus in order to confirm the analytical sensitivity of the kit including the primer and probe set of the present invention.
6 is an amplification plot of multiple real-time PCR results for detecting type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) in order to confirm the analytical sensitivity of the kit including the primer and probe set of the present invention. ) is the graph shown.
7 is a standard curve for detecting ORF1ab of type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) in order to confirm the analytical sensitivity of the kit including the primer and probe set of the present invention. It is a graph.
8 is a standard curve for detecting the E gene of type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) in order to confirm the analytical sensitivity of the kit including the primer and probe set of the present invention. is the graph shown.

Hereinafter, the present invention will be described in detail.

The present invention provides (a) a first forward primer base sequence represented by SEQ ID NO: 1, (b) a first reverse primer base sequence represented by SEQ ID NO: 2, (c) a first probe base sequence represented by SEQ ID NO: 3, (d) a second forward primer base sequence represented by SEQ ID NO: 4, (e) a second reverse primer sequence represented by SEQ ID NO: 5, (f) a second probe base sequence represented by SEQ ID NO: 6, (g) A third forward primer base sequence represented by SEQ ID NO: 7, (h) a 3-1 reverse primer base sequence represented by SEQ ID NO: 8, (i) a 3-2 reverse primer base sequence represented by SEQ ID NO: 9, ( j) a third probe base sequence represented by SEQ ID NO: 10, (k) a fourth forward primer base sequence represented by SEQ ID NO: 11, (l) a fourth reverse primer base sequence represented by SEQ ID NO: 12, and (m) sequence Provides a primer and probe set for simultaneous detection of influenza A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) containing the fourth probe sequence represented by number 13 (Table 1).

The primer set is used to specifically amplify the ORF1ab and E gene regions of SARS-CoV-2, the M gene region of influenza A virus, and the NP gene region of influenza B virus.

In one embodiment of the present invention, the primer set is a primer set described by the nucleotide sequences of SEQ ID NOs: 1, 2, 4, 5, 7-9, 11 and 12, respectively. Here, SEQ ID NOs: 1, 4, 7 and 11 are forward primers, and SEQ ID NOs: 2, 5, 8, 9 and 12 are reverse primers (Table 1).

As used herein, the term “primer” refers to an oligonucleotide, and conditions in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, a nucleotide and a polymerization agent such as a DNA polymerase. In the presence and conditions of suitable temperature and pH, it can serve as a starting point for synthesis. Specifically, the primer is a deoxyribonucleotide and is single-stranded. The primer used in the present invention may include naturally occurring dNMP (ie, dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides. In addition, the primer may also include ribonucleotides.

The primers of the present invention should be long enough to prime the synthesis of extension products in the presence of a polymerizer. A suitable length of a primer depends on a number of factors, such as temperature, application, and source of primer. As used herein, the term "annealing" or "priming" refers to the apposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, wherein the apposition is complementary to the template nucleic acid or a portion thereof by a polymerase polymerizing the nucleotides. to form nucleic acid molecules.

The primers of the present invention may be chemically synthesized using the phosphoramidite solid support method or other well-known methods. These primers can be modified using many means known in the art as long as they exhibit an effect capable of detecting influenza virus types A, B and SARS-CoV-2. Examples of such modifications include methylation, encapsulation, substitution with one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg, methyl phosphonates, phosphotriesters, phosphoroamidates). , carbamates, etc.) or charged linkages (or phosphorothioates, phosphorodithioates, etc.). Nucleic acids may contain one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (eg, acridine, proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

In addition, if necessary, the primer of the present invention may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (eg, horseradish peroxidase, alkaline phosphatase), radioactive isotopes (eg, 32P), fluorescent molecules and chemical groups (eg, biotin), and the like. have.

The probe set is used to specifically amplify the ORF1ab and E gene regions of SARS-CoV-2, the M gene region of influenza A virus, and the NP gene region of influenza B virus. In an experimental example of the present invention, the probe set is a probe set described by the nucleotide sequences of SEQ ID NOs: 3, 6, 10 and 13, respectively (Table 1).

As used herein, the term "probe" refers to a nucleic acid fragment corresponding to several to several hundred bases capable of specifically binding to DNA or RNA, and includes an oligonucleotide probe, single stranded DNA (single stranded) DNA) probe, double-stranded DNA probe, or RNA probe.

A fluorescent dye is conjugated (attached) to the 5' end of the probe set. The fluorescent dye is 6-carboxyfluorescein (FAM), Texas red, fluorescein, fluorescein chlorotriazi nyl, HEX (2', 4', 5', 7'). -tetrachloro-6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green , Alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dime thoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), Tetrachloro-Fluorescein (TET) , TRITC(tertramethylrodamine isothiocyanate), TAMRA(6-carboxytetramethyl-rhoda mine), NED(N-(1-Naphthyl) ethylenediamine), VIC(2′-chloro-7′phenyl-1,4-dich loro-6-carboxy -fluorescein), cyanine-based dyes, and thiadicarbocyanine may be at least one selected from the group consisting of, but any known material that can be used as a fluorescent dye in the art may be used.

The probe set may be further conjugated (attached) with a quencher at its 3' end. The quencher is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher (Blackberry Quencher), Iowa black (Iowa black) ) may be any one or more selected from the group consisting of, but any known material that can be used as a quencher in the art may be used.

As used herein, the term "ORF1ab (or ORF1a/b)" refers to two open reading frames (ORFs), ORF1a and ORF1b, conserved in the genome of nidoviruses, a group of viruses that include coronaviruses. are collectively referred to as The OFR1ab genes form several nonstructural proteins having various functions in the viral life cycle, including proteases and components of the replicase-transcriptase complex (RTC). to express large polyproteins that undergo proteaolysis to The two ORFs are related by a programmed ribosomal frameshift that allows translation to continue past the stop codon at the ORF1a end of the -1 reading frame.

The primer and probe set of the present invention is for influenza virus type A, B and SARS-CoV-2, respectively, from the National Center for Biological Information (NCBI, https://www.ncbi.nlm.nih.gov/), GISAID. After searching for a gene sequence, each sequence was aligned to secure a nucleotide sequence database and produced.

For the SARS-CoV-2 sequence, after collecting information registered in the GISAID (Global Initiative on Sharing All Influenza Data) and NCBI databases, primers and probes were designed using the conserved regions in the sequence.

The nucleotide sequence of the M gene (Matrix protein gene) of influenza A virus and the NP gene (Nucleocapsid protein gene) of influenza B virus is collected after collecting information registered in the NCBI (National Center for Biotechnology Information) database, Primers and probes were designed using conserved regions.

The nucleotide sequences obtained from each virus were analyzed by a multi-alignment method in which several nucleotide sequences are bundled and aligned. prepared (Table 1).

The detection rates of the designed primer and probe sets were confirmed in silico with respect to the entire nucleotide sequence database collected for each virus target gene.

As a result, in the case of SARS-CoV-2, the first forward primer (ORF1ab_qF, SEQ ID NO: 1), the first reverse primer (ORF1ab_qR, SEQ ID NO: 2) based on nucleotide sequence homology (100% and >90%) , a first probe (ORF1ab_FAM, SEQ ID NO: 3), a second forward primer (E gene_qF, SEQ ID NO: 4), a second reverse primer (E gene_qR, SEQ ID NO: 5) and a second probe (E gene_ROX, SEQ ID NO: 5) : 6) showed a detection rate of 100% (Tables 2 and 3).

In the case of influenza virus type A, in terms of nucleotide sequence homology (100%), the third forward primer (INF_A_qF, SEQ ID NO: 7), the 3-1 reverse primer (INF_A_qR1, SEQ ID NO: 8) and the third probe (INF_A_FAM) , SEQ ID NO: 10) showed a detection rate of 100%, but the 3-2 reverse primer (INF_A_qR2, SEQ ID NO: 9) showed a detection rate of 0%. On the other hand, based on the sequence homology (>90%), all the primers and probes showed a detection rate of 100% (Table 4).

In the case of influenza virus type B, based on nucleotide sequence homology (100%), 98.41% in the fourth forward primer (INF_B_qF, SEQ ID NO: 11), 99.54% in the fourth reverse primer (INF_B_qR, SEQ ID NO: 12), and the second 4 probes (INF_B_VIC, SEQ ID NO: 13) showed a detection rate of 100%. On the other hand, based on the nucleotide sequence homology (>90%), all the primers and probes showed a detection rate of 100% (Table 5).

Using the prepared primer and probe set, multiplex real-time PCR was performed to determine whether influenza virus type A, type B, and SARS-CoV-2 could be distinguished and detected.

Using the influenza virus type A, B and SARS-CoV-2 RNA samples purchased from ATCC, the reaction compositions described in Table 7 were prepared under the primer and probe concentration conditions described in Table 6 below, and the reaction conditions described in Table 8 were used. Accordingly, real-time PCR was performed using a real-time PCR instrument (ABI7500; Applied Biosystems 7500 Real-time PCR Instrument System, Applied Biosystems, USA), and analysis was performed using detection software (ABI Version 2.3, USA).

As a result, it was confirmed that when performing multiplex real-time PCR using the primer and probe set of the present invention, influenza virus type A, type B and SARS-CoV-2 can be distinguished and detected simultaneously (FIG. 1).

In addition, the present invention provides a composition for simultaneous detection of influenza type A and type B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) comprising the primer and probe set.

The composition may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg ²⁺ , dATP, dCTP, dGTP, and dTTP in addition to the primer and probe sets. In order to amplify the reverse transcribed cDNA, various DNA polymerases may be used in the amplification step of the present invention, and examples of the DNA polymerase include Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase or bacteriophage T7 DNA polymerization. There are enzymes. Polymerases can be isolated from the bacterium itself, purchased commercially, or obtained from cells expressing high levels of the cloned gene encoding the polymerase.

In addition, there is provided a kit for simultaneous detection of influenza A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) comprising the composition.

The kit may further include one or more types of compositions, solutions or devices suitable for the detection method. The kit includes a tube or other suitable container in addition to a set of primers and probes specific for the ORF1ab and E gene regions of SARS-CoV-2, the M gene region of influenza A virus, and the NP gene region of influenza B virus, Reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase, DNase inhibitors, DEPC-water and sterile water, etc. may be included.

On the other hand, the components included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve the stability of the product by lowering the degree of freedom of the included components. In order to produce such a dried form, it is necessary to apply a drying step, and in this case, heating drying, natural drying, reduced pressure drying, freeze drying, or a combination process thereof may be used.

In addition, the present invention comprises the steps of 1) performing multiple real-time polymerase chain reactions using the composition or kit; and 2) detecting and analyzing the amplification product obtained from step 1) by distinguishing between influenza A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) A method for simultaneous detection is provided.

As used herein, the term “real-time polymerase chain reaction (PCR)” is a technique for monitoring and analyzing the increase in PCR amplification products in real time (Levak KJ, et al., PCRMethods Appl., 4(6): 357- 62 (1995)). The PCR reaction can be monitored by recording the amount of fluorescence emission at each cycle during the exponential phase, in which the increase in PCR product is proportional to the initial amount of the target template. The higher the starting copy number of the nucleic acid target, the faster the fluorescence increase is observed and the lower the Ct value (cycle threshold). A marked increase in fluorescence above the reference value measured between 3-15 cycles indicates detection of accumulated PCR product.

Compared to conventional PCR methods, real-time PCR has the following advantages: (a) conventional PCR is measured in a plateau, whereas real-time PCR can obtain data during the exponential growth phase have; (b) the increase in the reporter fluorescence signal is directly proportional to the number of amplicons generated; (c) the digested probe provides permanent record amplification of the amplicon; (d) increase the detection range; (e) requires at least 1,000-fold fewer nucleic acids than conventional PCR methods; (f) detection of amplified DNA without separation via electrophoresis is possible; (g) increased amplification efficiency can be achieved using small amplicon sizes; and (h) a low risk of contamination.

When the amount of PCR amplification product reaches an amount detectable by fluorescence, an amplification curve begins to occur, the signal rises exponentially, and then reaches a stagnant state. As the initial amount of DNA increases, the number of cycles at which the amount of amplification product reaches a detectable amount decreases, so the amplification curve appears faster. Therefore, when a real-time PCR reaction is performed using a stepwise diluted standard sample, amplification curves arranged at equal intervals in the order of increasing the initial DNA amount are obtained. Here, if a threshold is set at an appropriate point, a Ct value at the intersection of the threshold and the amplification curve is calculated.

The cycle threshold (Ct) value means the number of cycles in which fluorescence generated in the reaction exceeds the threshold, which is inversely proportional to the logarithm of the initial copy number. Therefore, the Ct value assigned to a particular well reflects the number of cycles in which a sufficient number of amplicons in the reaction have accumulated. The Ct value is the cycle in which an increase in ΔRn was first detected. Rn denotes the magnitude of the fluorescence signal generated during PCR at each time point, and ΔRn denotes the fluorescence emission intensity of the reporter die (normalized reporter signal) divided by the fluorescence emission intensity of the reference die. The Ct value is also called Cp (crossing point) in LightCycler.

The Ct value represents the point at which the system begins to detect an increase in fluorescence signal associated with exponential growth of the PCR product in the log-linear phase. This period provides the most useful information about the reaction. The slope of the log-linear step represents the amplification efficiency (Eff) (http://www.appliedbiosystems.co.kr/).

In real-time PCR, PCR amplification products are detected through fluorescence. The detection method is largely divided into an interchelating method (SYBR Green I method), a method using a fluorescently labeled probe (TaqMan probe method), and the like. Since the interchelating method detects all double-stranded DNA, there is no need to prepare a probe for each gene, so a reaction system can be constructed at a low cost. The method using a fluorescently-labeled probe is expensive, but has high detection specificity so that even similar sequences can be discriminated and detected.

According to an experimental example of the present invention, the kit and detection method of the present invention use the TaqMan probe method. TaqMan probes are typically conjugated to a fluorophore at the 5'-end and a quencher (eg, otide) at the 3'-end. The excited fluorophore transfers energy to a nearby quencher rather than fluorescing it (FRET = Frster or fluorescence resonance energy transfer; Chen, X., et al., Proc Natl Acad Sci USA, 94(20): 10756-61) (1997)). Therefore, when the probe is normal, no fluorescence is generated.

The TaqMan probe of the present invention is designed to anneal to the internal site of the PCR product. Specifically, the TaqMan probe is a target gene segment or viral genome segment of the present invention (eg, ORF1ab and envelope (E) gene of SARS-CoV-2, matrix (M) gene of influenza virus type A, influenza virus B It can be designed as an internal sequence of the nucleocapsid (NP) gene).

The TaqMan probe specifically hybridizes to the template DNA in the annealing step, but fluorescence is suppressed by the quencher on the probe. During the extension reaction, the TaqMan probe hybridized to the template is decomposed by the 5' to 3' nuclease activity of Taq DNA polymerase, and the fluorescent dye is released from the probe, the quencher suppresses the inhibition and displays fluorescence. In this case, the 5'-end of the TaqMan probe should be located downstream of the 3'-end of the extension primer. That is, when the 3'-end of the extension primer is extended by a template-dependent nucleic acid polymerase, the 5'-end of the TaqMan probe is cleaved by the 5' to 3' nuclease activity of this polymerase, thereby forming a reporter molecule. A fluorescence signal is generated.

The method is processed in one tube and one step, so there is little cross contamination.

The simultaneous detection method can distinguish i) influenza and other pathogens, ii) SARS-CoV-2 and other pathogens, iii) influenza and SARS-CoV-2 or other viruses and pathogens with similar symptoms.

In an experimental example of the present invention, multiple real-time polymerase chain reactions were performed using an influenza virus type A, B type and SARS-CoV-2 detection kit comprising the primer and probe set of the present invention, and various types of viruses, Specificity and sensitivity to bacteria and the like were measured.

As a result of the specificity measurement, influenza virus type A, type B and SARS-CoV-2 (No. 1, No. 7, No. 8, No. 9 in Table 9) were all detected by the kit including the primer and probe set of the present invention. However, the amplification reaction was not detected in other viruses, bacteria, etc., confirming that the specificity was good (Table 9).

For sensitivity, SARS-CoV-2 was diluted to 5.0 X 10 ⁵ ~ 5.0 X 10 ¹ copies/mL using a nasopharyngeal smear negative sample. As a result, ORF1ab and E genes were tested up to 5.0 X 10 ² copies/mL. detection was possible. When this was converted into the following formula, ORF1ab, E gene could be detected up to 1.0 X10 ⁰ copies/μL ( FIGS. 6 to 8 ).

On the other hand, influenza virus types A and B were prepared by synthesizing the same nucleotide sequence as each target site through in vitro transcription, and then tested by diluting 5.0 X 10 ⁷ ~ 5.0 X 10 ² copies/mL using a negative nasopharyngeal smear sample. As a result, influenza virus type A was detectable up to 5.0 X 10 ³ copies/mL (FIGS. 2 and 3), and influenza virus type B was detectable up to 5.0 X 10 ² copies/mL (FIGS. 4 and 5) . When this was converted into the following formula, it was possible to detect up to 1.0 X10 ¹ copies/μL of influenza virus type A and 1.0 X10 ⁰ copies/μL of influenza virus type B.

Concentration in specimen prior to extraction (copies/mL) = Concentration in extracted RNA sample (copies/μL) x unit conversion (1000 μL/mL) / 2x concentration ratio*

* Concentration ratio = 140 μL specimen/ 60 μL elution buffer ≒2

In addition, the method for simultaneously detecting and distinguishing influenza A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) of the present invention is to use a nucleic acid isolated from a sample as a template. performing multiplex real-time PCR.

The sample may be obtained from a clinical sample or an environmental sample. For example, it may be a sample obtained from blood, saliva, sweat, urine, feces, mucus, sputum, bronchial lavage, culture colony or nasopharyngeal smear, but is not limited thereto.

Hereinafter, the present invention will be described in more detail by way of Examples and Experimental Examples. However, the present invention is not limited by the Examples and Experimental Examples below.

Example 1. Preparation of primers and probes to distinguish and simultaneously detect influenza type A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2)

After searching the gene sequences for each of influenza virus type A, B and SARS-CoV-2 in the National Center for Biological Information (NCBI, https://www.ncbi.nlm.nih.gov/) and GISAID, By aligning each sequence, a nucleotide sequence database was obtained.

After collecting the nucleotide sequence information of the M gene (Matrix protein gene) of the influenza A virus and the NP gene (Nucleocapsid protein gene) of the influenza B virus registered in the database of the National Center for Biotechnology Information (NCBI), the nucleotide sequence is preserved in the nucleotide sequence Primers and probes were designed using enemy regions.

After collecting SARS-CoV-2 sequence information registered in the GISAID (Global Initiative on Sharing All Influenza Data) and NCBI databases, primers and probes were designed using the conserved regions in the sequence.

The nucleotide sequences obtained from each virus were analyzed by a multi-alignment method in which several nucleotide sequences are bundled and aligned, and as a result of the multi-alignment, a conserved region in which the nucleotide sequence does not change was secured. Primers and probes were designed and constructed within the conserved region (Table 1).

Primer and probe sequences specific for type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2), influenza A and B viruses pathogen primer and
probe sequence (5'-3') Accession No. target
gene
(area) SEQ ID NO: SARS-CoV-2 ORF1ab_qF ATG ATT ACC AAG GTA AAC CTT TGG AA NC_045512 3,123-3,148 One ORF1ab_qR GAC CAA CAG TTT GTT GAC TAT CAT CA NC_045512 3,208-3,233 2 ORF1ab_FAM CCA CTT CTG CTG CTC TTC AAC CTG AAG AA NC_045512 3,156-3,184 3 E gene_qF GCTTTCGTGGTWTTCTTGCTAGT NC_045512 26,308-26,330 4 E gene_qR AACAATATTGCAGCAGTACGCACCACA NC_045512 26,360-26,385 5 E gene_ROX ACA CTA GCC ATC CTT ACT GCG CTT CG NC_045512 26,332-26,357 6 influenza A virus INF_A_qF CAT TYT GGA CAA AKC GTC TAC G MN819683 239-260 7 INF_A_qR1 CAATCCTGTCACCTCTGACTAAGGG MN819683 162-186 8 INF_A_qR2 AATCTTGTCACCTTTGACTAAGG MN819683 163-185 9 INF_A_FAM TGC AGT CCT CGC TCA C MN819683 222-237 10 influenza B virus INF_B_qF GAA TGC TGT CAA TGA ATA TTG AGG G MK676295 1,494-1,518 11 INF_B_qR CAT TGA RTC ATT CAT CAT CTT GAG TAG AT MK676295 1,542-1,570 12 INF_B_VIC TCC TTT GAC ATC TGC AT MK676295 1,524-1,540 13

The detection rate of the probe designed in this study was confirmed in silico with respect to the entire nucleotide sequence database collected for each virus target gene.

In the case of SARS-CoV-2, the first forward primer (ORF1ab_qF, SEQ ID NO: 1), the first reverse primer (ORF1ab_qR, SEQ ID NO: 2), the first on the basis of sequence homology (100% and >90%) Probe (ORF1ab_FAM, SEQ ID NO: 3), a second forward primer (E gene_qF, SEQ ID NO: 4), a second reverse primer (E gene_qR, SEQ ID NO: 5) and a second probe (E gene_ROX, SEQ ID NO: 6) showed a detection rate of 100% (Tables 2 and 3).

In the case of influenza virus type A, in terms of nucleotide sequence homology (100%), the third forward primer (INF_A_qF, SEQ ID NO: 7), the 3-1 reverse primer (INF_A_qR1, SEQ ID NO: 8) and the third probe (INF_A_FAM) , SEQ ID NO: 10) showed a detection rate of 100%, but the 3-2 reverse primer (INF_A_qR2, SEQ ID NO: 9) showed a detection rate of 0%. On the other hand, based on the sequence homology (>90%), all the primers and probes showed a detection rate of 100% (Table 4).

In the case of influenza virus type B, based on the nucleotide sequence homology (100%), 98.41% in the fourth forward primer (INF_B_qF, SEQ ID NO: 11), 99.54% in the fourth reverse primer (INF_B_qR, SEQ ID NO: 12), and the second 4 probes (INF_B_VIC, SEQ ID NO: 13) showed a detection rate of 100%. On the other hand, based on the nucleotide sequence homology (>90%), all the primers and probes showed a detection rate of 100% (Table 5).

Confirmation result of sequence homology with ORF1ab of SARS-CoV-2, primer and probe target gene Primers and probes Sequence homology (100%) Sequence homology (>90%) ORF1ab ORF1ab_qF 100% (1113 sequences) 100% (1113 sequences) ORF1ab_qR 100% (1113 sequences) 100% (1113 sequences) ORF1ab_FAM 100% (1113 sequences) 100% (1113 sequences)

Confirmation result of homology with the E gene, primer, and probe sequences of SARS-CoV-2 target gene Primers and probes Sequence homology (100%) Sequence homology (>90%) E gene E gene_qF 100% (1206 sequences) 100% (1206 sequences) E gene_qR 100% (1206 sequences) 100% (1206 sequences) E gene_ROX 100% (1206 sequences) 100% (1206 sequences)

Confirmation result of homology with influenza virus type A and primer and probe sequences target gene Primers and probes Sequence homology (100%) Sequence homology (>90%) Matrix protein gene INF_A_qF 100% (200 sequences) 100% (200 sequences) INF_A_qR1 100% (200 sequences) 100% (200 sequences) INF_A_qR2 0% (0 sequences) 100% (200 sequences) INF_A_FAM 100% (200 sequences) 100% (200 sequences)

Confirmation result of homology with influenza virus type B and primer and probe sequences target gene Primers and probes Sequence homology (100%) Sequence homology (>90%) Nucleocapsid protein gene INF_B_qF 98.41% (432 sequences) 100% (439 sequences) INF_B_qR 99.54% (437 sequences) 100% (439 sequences) INF_B_VIC 100% (439 sequences) 100% (439 sequences)

Experimental Example 1. Confirmation of detection of influenza virus type A, type B and SARS-CoV-2 using the primer and probe set of the present invention

Multiple real-time PCR was performed using the primer and probe set prepared in Example 1 to determine whether influenza virus type A, type B and SARS-CoV-2 could be distinguished and detected.

Using the influenza virus type A, B, and SARS-CoV-2 RNA samples purchased from ATCC, the reaction compositions described in Table 7 were prepared under the primer and probe concentration conditions described in Table 6 below, and the reaction conditions described in Table 8 were used. Accordingly, real-time PCR was performed using a real-time PCR instrument (ABI7500; Applied Biosystems 7500 Real-time PCR Instrument System, Applied Biosystems, USA), and analysis was performed using detection software (ABI Version 2.3, USA).

As a result, it was confirmed that, when performing multiplex real-time PCR using the primer and probe set of the present invention, influenza virus type A, type B and SARS-CoV-2 can be distinguished and simultaneously detected (FIG. 1).

pathogen primer and
probe Final concentration (nM) SARS-CoV-2 ORF1ab_qF 500 ORF1ab_qR 500 ORF1ab_Cy5 250 E gene_qF 250 E gene_qR 250 E gene_ROX 75 influenza virus type A INF_A_qF 250 INF_A_qR1 250 INF_A_qR2 250 INF_A_FAM 100 influenza virus type B INF_B_qF 250 INF_B_qR 250 INF_B_VIC 100

reaction composition Volume (μL) master mix 10 Primer and Probe Mix 5 template RNA sample 5 Sum 20

Temperature (℃) hour number of cycles 50 30 minutes One 95 10 minutes One 95 15 seconds 40 60* 1 minute

* Fluorescence detection step

Experimental Example 2. Confirmation of Analytical Specificity of Multiple Real-Time PCR Using the Primer and Probe Set of the Present Invention

Multiple real-time polymerase chain reactions were performed using the influenza virus type A, B type and SARS-CoV-2 detection kit including the primer and probe set of the present invention, and specificity was measured for various types of viruses, bacteria, etc. did.

As a result, influenza virus type A, type B and SARS-CoV-2 (No. 1, No. 7, No. 8, No. 9 in Table 9) were all detected by the kit including the primer and probe set of the present invention, In other viruses, bacteria, etc., no amplification reaction was detected (Table 9).

This indicates that the primer and probe set of the present invention can specifically detect influenza virus types A, B and SARS-CoV-2.

number pathogen source detection
(+/-) Coronaviridae One human coronavirus
(BetaCoV/Korea/KCDC03/2020) ^a NCCP 43326 ⁺ 2 HCoV-HKU1 ^b ATCC VR-3262SD ^- 3 HCoV-229E ^c KBPV-VR-9 ^- 4 HCoV-OC43 KBPV-VR-8 - 5 HCoV-NL63 KBPV-VR-88D - 6 MERS-CoV ^e Vircell (MBC132) ^- other virus 7 Influenza A (H1N1) KBPV-VR-76 + 8 Influenza A (H3N2) KBPV-VR-85 + 9 Influenza B KBPV-VR-72 + 10 Human adenovirus type 1 (HAdV-C) KBPV-VR-1 - 11 Parainfluenza virus 1 KBPV-VR-64 - 12 Parainfluenza virus 2 KBPV-VR-66 - 13 Parainfluenza virus 3 KBPV-VR-68 - 14 Parainfluenza virus 4 KBPV VR-70 - 15 Respiratory syncytial virus subtype A KBPV-VR-73 - 16 Respiratory syncytial virus subtype B KBPV-VR-48 - 17 Enterovirus D68 Vircell (MBC125) - 18 Enterovirus 71 KBPV-VR-56 - 19 Human Rhinovirus KBPV-VR-81 - 20 Human Bocavirus 1 ATCC VR-3251SD - 21 Metapneumovirus KBPV-VR-87 - bacteria 22 Streptococcus pneumoniae ATCC 53592 - 23 Haemophilus Influenzae NCCP 14676 - 24 Mycoplasma pneumoniae ATCC 15531 - 25 Legionella pneumophila ATCC 33152 - Etc 26 Human genomic DNA G304A (Promega) -

^a NCCP: National Culture Collection for Pathogens

^b ATCC: American Type Culture Collection

^c KBPV: Korea Bank for Pathogenic Viruses

^d EVAg: European Virus Archive Glabal

^e Vircell: Vircell SL

Experimental Example 3. Confirmation of Analytical Sensitivity of Multiple Real-Time PCR Using the Primer and Probe Set of the Present Invention

The analytical sensitivity of influenza virus type A, type B and SARS-CoV-2 detection kits using multiple real-time polymerase chain reaction technology was confirmed. Each standard was diluted using a nasopharyngeal smear negative sample. The formula used to convert the concentration in the sample before nucleic acid extraction is as follows.

Concentration in specimen prior to extraction (copies/mL) = Concentration in extracted RNA sample (copies/μL) x unit conversion (1000 μL/mL) / 2x concentration ratio*

* Concentration ratio = 140 μL specimen/ 60 μL elution buffer ≒2

In the case of SARS-CoV-2, it was tested by diluting a negative nasopharyngeal smear to 5.0 X 10 ⁵ ~ 5.0 X 10 ¹ copies/mL, and as a result, ORF1ab, E gene could be detected up to 5.0 X 10 ² copies/mL . When this was converted into the above formula, ORF1ab, E genes were detectable up to 1.0 X10 ⁰ copies/μL ( FIGS. 6 to 8 ).

In the case of influenza virus types A and B, the same nucleotide sequence as each target site was synthesized through in vitro transcription and tested by diluting 5.0 X 10 ⁷ ~ 5.0 X 10 ² copies/mL using a negative nasopharyngeal smear. .

As a result, influenza virus type A was detectable up to 5.0 X 10 ³ copies/mL (FIGS. 2 and 3), and influenza virus type B was detectable up to 5.0 X 10 ² copies/mL (FIGS. 4 and 5) . When this was converted into the above formula, it was possible to detect up to 1.0 X10 ¹ copies/μL of influenza virus type A and 1.0 X10 ⁰ copies/μL of influenza virus type B.

<110> KoGene BioTech Co., LTD. <120> Composition for simultaneously distinguishing and detecting influenza type A and type B viruses and type 2 severe acute respiratory syndrome coronavirus and detection method using the same <130> 2021P-11-001 <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ORF1ab_qF <400> 1 atgattacca aggtaaacct ttggaa 26 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ORF1ab_qR <400> 2 gaccaacagt ttgttgacta tcatca 26 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ORF1ab_FAM <400> 3 ccacttctgc tgctcttcaa cctgaagaa 29 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> E gene_qF <400> 4 gctttcgtgg twttcttgct agt 23 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> E gene_qR <400> 5 aacaatattg cagcagtacg cacaca 26 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> E gene_ROX <400> 6 acactagcca tccttactgc gcttcg 26 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> INF_A_qF <400> 7 cattytggac aaakcgtcta cg 22 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> INF_A_qR1 <400> 8 caatcctgtc acctctgact aaggg 25 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> INF_A_qR2 <400> 9 aatcttgtca cctttgacta agg 23 <210> 10 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> INF_A_FAM <400> 10 tgcagtcctc gctcac 16 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> INF_B_qF <400> 11 gaatgctgtc aatgaatatt gaggg 25 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> INF_B_qR <400> 12 cattgartca ttcatcatct tgagtagat 29 <210> 13 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> INF_B_VIC <400> 13 tcctttgaca tctgcat 17

Claims (18)

Primer and probe set for simultaneous detection of influenza type A and B virus and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2), characterized in that it contains the following nucleotide sequence:
(a) a first forward primer base sequence represented by SEQ ID NO: 1;
(b) a first reverse primer base sequence represented by SEQ ID NO: 2;
(c) a first probe base sequence represented by SEQ ID NO: 3;
(d) a second forward primer base sequence represented by SEQ ID NO: 4;
(e) a second reverse primer base sequence represented by SEQ ID NO: 5;
(f) a second probe base sequence represented by SEQ ID NO: 6;
(g) a third forward primer base sequence represented by SEQ ID NO: 7;
(h) the 3-1 reverse primer base sequence represented by SEQ ID NO: 8;
(i) the 3-2 reverse primer base sequence represented by SEQ ID NO: 9;
(j) a third probe base sequence represented by SEQ ID NO: 10;
(k) a fourth forward primer base sequence represented by SEQ ID NO: 11;
(l) a fourth reverse primer base sequence represented by SEQ ID NO: 12; and
(m) the fourth probe base sequence represented by SEQ ID NO: 13.
According to claim 1,
The nucleotide sequences (a), (b) and (c) are the ORF1ab gene region of SARS-CoV-2; (d), (e) and (f) are the E gene region of SARS-CoV-2; (g), (h), (i) and (j) are the M gene region of influenza A virus; and (k), (l) and (m) are the NP gene region of the influenza B virus; Primer and probe set for simultaneous detection of syndrome coronavirus (SARS-CoV-2).
According to claim 1,
The nucleotide sequences (c), (f), (j) and (m) are TaqMan probe technology applied, and influenza ( influenza) A primer and probe set for simultaneous detection of type A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2).
4. The method of claim 3,
The fluorescent dye is 6-carboxyfluorescein (FAM), Texas red, fluorescein, fluorescein chlorotriazi nyl, HEX (2', 4', 5', 7'). -tetrachloro-6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green , Alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), Tetrachloro-Fluorescein (TET), TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhoda mine), NED (N-(1-Naphthyl) ethylenediamine), VIC (2′-chloro-7′phenyl-1,4-dichloro-6-carboxy-fluorescein) ), cyanine-based dyes and thiadicarbocyanine, characterized in that at least one selected from the group consisting of influenza A and B viruses and type 2 severe acute respiratory syndrome coronavirus A primer and probe set for simultaneous detection of (SARS-CoV-2).
4. The method of claim 3,
The quencher is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher (Blackberry Quencher), Iowa black (Iowa black) ) A primer and probe set for simultaneous detection of influenza A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2), characterized in that at least one selected from the group consisting of.
According to claim 1,
The simultaneous detection is characterized in that the influenza virus and SARS-CoV-2 are distinguished from the pathogens of the following a) to c). Influenza type A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS) -CoV-2) primer and probe set for simultaneous detection:
a) HCoV-HKU1, HCoV-229E, HCoV-OC43, HCoV-NL63, MERS-CoV;
b) Human adenovirus, Parainfluenza virus, Respiratory syncytial virus, Enterovirus, Human Rhinovirus, Human Bocavirus, Metapneumovirus (Metapneumovirus); and
c) Streptococcus pneumoniae, Haemophilus influenzae, Mycoplasma pneumoniae, Legionella pneumophila.
delete delete According to claim 1,
The influenza A and B viruses are detected through a primer and probe set comprising an influenza-specific nucleotide sequence selected from the M gene and NP gene gene regions, respectively. Influenza A and B viruses and Primer and probe set for simultaneous detection of type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2).
According to claim 1,
The SARS-CoV-2 is an influenza (influenza) type A and B virus, characterized in that it is detected through a primer and a probe set containing a SARS-CoV-2 specific nucleotide sequence selected from the ORF1ab and E gene regions and Primer and probe set for simultaneous detection of type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2).
According to claim 1,
The primer and probe set are used for multiplex real-time polymerase chain reaction (PCR), influenza A and B viruses and type 2 severe acute Primer and probe set for simultaneous detection of respiratory syndrome coronavirus (SARS-CoV-2).
According to claim 1,
The primer and probe set has a minimum detection limit of 1.0X10 ¹ copies/μL for influenza A and B viruses, respectively, and 1.0X10 ⁰ copies/μL for SARS-CoV-2 Influenza (influenza) A primer and probe set for simultaneous detection of type A and B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2).
A composition for simultaneous detection of influenza type A and type B viruses and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2), comprising the primer and probe set of claim 1.
delete For simultaneous detection of influenza type A and B virus and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2) comprising the primer and probe set of claim 1 or the composition of claim 13 kit.
1) performing multiple real-time polymerase chain reactions using the composition of claim 13; and
2) Influenza type A and B virus and type 2 severe acute respiratory syndrome coronavirus (SARS-CoV-2), characterized in that it includes the step of detecting and analyzing the amplification product obtained from step 1) Simultaneous detection method of
17. The method of claim 16,
The primer and probe sets of step 1) are treated in a single tube and one step, so that there is little cross-contamination. Influenza type A and B viruses and type 2 severe acute respiratory tract Simultaneous detection method of syndrome coronavirus (SARS-CoV-2).
delete

Images