KR102395969B1 - Primer set for detecting coronavirus using the loop-mediated isothermal amplification reaction and uses thereof - Google Patents

Abstract

The present invention can detect a coronavirus accurately and quickly with high sensitivity by using a primer set specific for a specific region of the Orf1a gene expressed in a coronavirus-infected person.

Description

Primer set for detecting coronavirus using the loop-mediated isothermal amplification reaction and uses thereof

The present invention relates to a primer set for a loop-mediated isothermal amplification (LAMP) capable of detecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and a kit comprising the same will be.

Coronavirus is a representative virus that causes a deadly infectious disease in modern civilization, and since December 2019, the number of infected people is increasing as the novel coronavirus disease 2019 (COVID-19), which originated in Wuhan, China, has spread around the world. According to data collected until March, it is the lowest at 5.6%, but the number of confirmed cases is increasing rapidly around the world, and there is no vaccine or antiviral drug approved for prevention or treatment yet. The currently prevalent coronavirus infection-19 (COVID-19) is a respiratory infection caused by a new type of coronavirus, Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). As can be seen from the situation, the outbreak of a new strain of virus is causing great problems for mankind. This is not only a health care and health problem, but a new strain of virus that can have a big ripple effect on the global economy.

Currently, the confirmation of coronavirus infection-19 (COVID-19) is made through general PCR, so it takes a long time to confirm the diagnosis result, so there is a problem that the medical staff is slow in judging the patient's situation. The LAMP diagnostic method of the present invention is an isothermal gene amplification method first developed by Notomi et al. in 2000. Unlike Taq DNA polymerase used in the existing PCR-based diagnostic method, it is possible to amplify a target gene in large quantities by a strand displacement method. The gene amplification efficiency is remarkably high by using the Bst DNA polymerase. In addition, unlike the existing PCR-based diagnostic method, since gene amplification is performed under isothermal conditions without temperature change, the test time is shortened and the reaction can be performed with low-cost equipment such as a constant temperature water bath. In the conventional reading method using electrophoresis or DNA staining solution, the problem of nucleic acid contamination in the laboratory may occur because the reaction tube must be opened and the amplified product must be handled. It has been pointed out as a problem because there is a possibility that an error may occur. When reading using a real time turbidometer, accurate reading is possible, but there is a disadvantage in that expensive reading equipment is required.

In order to be used as a point-of-care diagnostic method, it is necessary to accurately and easily read the reaction result in the field. A method of reading through the color change of the liquid has been developed. This method not only prevents cross-contamination because the reaction result can be checked without opening the reaction tube, but also increases the possibility of using LAMP as a point-of-care diagnostic method because the reaction result can be visually checked on the spot. Due to the nature of LAMP, which reacts under isothermal conditions, testing is possible even with constant temperature equipment that maintains a constant temperature, so it can be easily used in front-line clinical diagnosis rooms or clinical sites without expensive special equipment or specialized personnel. Because of these advantages, LAMP has recently been widely used in the diagnosis of various human and animal pathogens worldwide.

One object of the present invention is to provide a primer for loop-mediated isothermal amplification (LAMP) for the detection of coronavirus.

Another object of the present invention is to provide a composition for detecting a coronavirus comprising the primer.

Another object of the present invention is to provide a kit for detecting a coronavirus comprising the primer.

Another object of the present invention is to provide an information providing method for diagnosing a coronavirus infection or infectious disease using the primer.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those of ordinary skill in the art from the following description.

Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, various specific details are set forth, such as specific forms, compositions and processes, and the like, for a thorough understanding of the present invention. However, certain embodiments may be practiced without one or more of these specific details, or in conjunction with other known methods and forms. In other instances, well-known processes and manufacturing techniques have not been described in specific detail in order not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Thus, references to "in one embodiment" or "an embodiment" in various places throughout this specification do not necessarily refer to the same embodiment of the invention. Additionally, the particular features, forms, compositions, or properties may be combined in any suitable way in one or more embodiments.

Unless specifically defined in the present invention, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

According to one embodiment of the present invention, it relates to a primer for detecting a coronavirus.

In the present invention, the "coronavirus" has four genera (alpha, beta, gamma, delta) in the Coronavirinae of the Coronaviridae , and an RNA virus with a gene size of 27 to 32 kb. It is known to cause respiratory and digestive system infections in humans and animals. It is easily transmitted mainly through mucosal transmission and droplet transmission. Humans usually cause mild respiratory infections, but rarely fatal infections. Diarrhea in cattle and pigs, and respiratory diseases in chickens. It is divided into the classifications in Table 1 below (Centers for Disease Control, 2020). Among the four genera, alpha and beta infect humans and animals, and gamma and delta are reported to infect only animals.

genus human-coronavirus non-human coronavirus alpha coronavirus 229, NL63 porcine epidemic diarrhea virus (PEDV), (porcine) transmissible gastroenteritis virus (TGEV), canine coronavirus (CCoV), feline coronavirus (FCoV), Miniopterus bat ( bat) coronavirus1, Miniopterus bat (bat) coronavirus HKU8, Rhinolophus bat (bat) coronavirus HKU2, Scotophilus bat (bat) coronavirus 512 beta coronavirus OC43, HKU1, SARS-CoV, MERS-CoV porcine hemagglutinating encephalomyelitis virus (PHEV), bovine coronavirus (BCoV), equine coronavirus (EqCoV), murine coronavirus (MuCoV), Tylonycteris bat (bat) coronavirus HKU4, Pipistrellus bat (bat) coronavirus HKU5, Rousettus bat (bat) coronavirus HKU9 gamma coronavirus - Avian coronavirus, Beluga whale - Coronavirus SW1 delta coronavirus - Bulbul - Coronavirus HKU11, Thrush - Coronavirus HKU12, Kinbara (Munia) - Coronavirus HKU13

In particular, there are currently 7 types of human-infecting coronaviruses in Table 2 below, the types that cause colds (229E, OC43, NL63, HKU1) and the types that cause severe pneumonia (SARS-CoV, MERS-CoV, SARS-CoV2) is divided into

Virus name Genus host Symptom HCoV-229E Alpha Human mild respiratory symptoms HCoV-NL63 Alpha Human mild respiratory symptoms SARS-CoV Beta Human severe respiratory symptoms MERS-CoV Beta Human severe respiratory symptoms HCoV-OC43 Beta Human mild respiratory symptoms HCoV-HKU1 Beta Human Pneumonia symptoms SARS-CoV-2 Beta Human Mild respiratory symptoms Severe cases can cause shortness of breath

In the present invention, the "severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)" belongs to the beta-coronavirus among the four genus coronaviruses of the subfamily Coronavirus and corresponds to a zoonotic infection, Also called SARS-CoV-2. The virus occurred in December 2019 and is one of seven types of coronaviruses that infect humans. Coronavirus disease 19 (COVID-19) is reported to be transmitted when droplets (saliva) of an infected person penetrate the respiratory tract or the mucous membranes of the eyes, nose, and mouth. After the incubation period, respiratory symptoms such as fever, cough, or shortness of breath above 37.5 ℃ and pneumonia appear as the main symptoms, and there are cases of asymptomatic infection. According to the Korea Centers for Disease Control and Prevention, the gene sequence of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) shows the highest homology to the bat-derived coronavirus with about 96% homology, and about 60% homology with MERS. , and about 79% homology with SARS was reported.

The coronavirus genome in the present invention consists of a single-stranded positive-sense RNA within 30 kb with a 5' cap structure and a 3' poly A tail. The genomic RNA is used as a template for direct translation of polyprotein 1a/1ab (pp1a/pp1ab), and encodes a non-structural protein (nsp) and replicates in double-membrane vesicles (DMV) - to form a transcription-transcription complex (RTC) (J Virol. 2006; 80(12): 5927-5940.). Sets of overlapping subgenomic RNAs (sgRNAs) are synthesized by RTC in a discontinuous transcriptional manner, and these subgenomic messenger RNAs (mRNAs) possess common 5′-leader and 3′-terminal sequences. Transcription termination and subsequent acquisition of leader RNA occurs in transcriptional regulatory sequences located between open reading frames (ORFs). This negative-stranded sgRNA is used as a template for subgenomic mRNA production.

In the present invention, the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome contains ORF1a and ORF1b genes corresponding to genomic regions capable of protein production, and the ends of the four major structural proteins are spikes (S). , membrane (M), envelope (E) and nucleocapsid (N) proteins. In addition, they encode special structures and helper proteins, such as 3a, 6, 7a/b, 8 or 10 proteins.

In the present invention, the "detection" is to determine whether or not infection with a coronavirus, preferably severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and more specifically, severe acute respiratory syndrome It is a concept that includes monitoring and diagnosing whether or not coronavirus 2 (SARS-CoV-2) is infected.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence that is a nucleic acid sequence having a short free 3' hydroxyl group and is complementary to a nucleic acid strand to be copied. It can form a base pair with a complementary template and serve as a starting point for template strand copying and thus serve as a starting point for the synthesis of extension products. A primer can initiate DNA synthesis in the presence of a reagent for polymerization (DNA polymerase or reverse transcriptase) and four different nucleoside triphospates (NTPs) in an appropriate buffer solution and temperature. In addition, when performing primer design, the primer sequence must be selected very carefully in order to prevent erroneous binding to other similar nucleotide sequences in the target DNA depending on the degree of repeatability of the nucleotide sequence of the target DNA. As an example of a method commonly used for proper primer design, there is a BLAST search method, and not only the primer itself but also the nucleotide sequence may be searched by BLAST. Primer-BLAST, an NCBI web tool, is also frequently used for primer design, and other commercial software tools can also be used for primer design.

The primer set of the present invention includes primer size, Tm value, GC content of the primer, prevention of dimer formation of primers by self-complementary sequence in the primer, and repeating the same nucleotide sequence three or more times Including those that have been carefully designed to maximize the sensitivity and specificity of a specific gene of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), fully considering the prohibition.

The primers of the present invention may incorporate additional features that do not change their basic properties. That is, the nucleic acid sequence can be modified using a number of means known in the art. Examples of such modifications include methylation, encapsulation, substitution of a nucleotide with one or more homologues and uncharged linkages such as phosphonates, phosphotriesters, phosphoroamidates or carbamates or phosphorothioates or phosphorodithioates. Modification of nucleotides into charged linkages such as .

In the present invention, "nucleic acid" includes single-stranded or double-stranded oligonucleotides or polynucleotides, and may be RNA or DNA molecules containing one or more nucleotides in any form, or analogs and derivatives thereof. In addition, the nucleic acid of the novel coronavirus to which the primer set of the present invention is used may include RNA derived from the novel coronavirus, for example, all or part of a genome, or a DNA corresponding thereto.

The primers of the present invention may be used in combination with oligonucleotides and polynucleotides, and may include nucleic acids (RNA or DNA), aptamers, and the like.

In the present invention, the primer can detect the coronavirus by complementary binding to all or part of the Orf1a gene expressed in a coronavirus, preferably a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infected person. .

In the present invention, the "Orfla gene" refers to a gene encoding the Orf1a protein, and may be composed of the nucleotide sequence shown in SEQ ID NO: 7. The Orf1a protein is a non-structural protein (nsp) related to RNA synthesis of a virus and is known not to be exposed to the outside of a virion. As described above, Orf1a/1b, known as a replication/transcriptase gene, is translated into a 440-450 kDa polypeptide pp1a and a 740-810 kDa polypeptide pp1b by ribosomal frameshifting. In particular, the nsp encoded by Orf1a/1b consists of nsp1 to nsp16, and most nsp have been reported to play a role in coronavirus replication, but the entire role has not yet been elucidated.

In the present invention, the "nonstructural protein" refers to a protein that is not a structural protein as a kind of nucleic acid synthesis-related protein. Amino acids are biopolymers linked by peptide bonds, and non-structural proteins are mostly spherical and often have specific functions. Among them, the viral nonstructural protein refers to a protein encoded by a virus or a protein that does not constitute a part of a virus particle. They control the host, as well as various enzymes and transcription factors that viruses use to replicate themselves, such as viral proteases (such as 3CL/nsp5), RNA replicase or other template-directed polymerases. means for doing so.

In the present invention, the primer may be one used for a loop-mediated isothermal amplification (LAMP), preferably a reverse transcription loop-mediated isothermal amplification (RT-) LAMP) may be used.

In the present invention, the "Loop-Mediated Isothermal Amplification (LAMP)" selects 4 to 6 primers designed to specifically recognize 6 to 8 regions of DNA polymerase in the target gene and It is a molecular diagnostic method with sensitivity and specificity as a method of amplification using a chain substitution reaction using a combination. In the design of the primer, a loop structure is created at the primer binding site of the first amplification product. Since the loop portion is single-stranded, the next primer can bind. A special DNA synthetase with high chain displacement activity dissociates the double-stranded DNA in the direction of its progress and proceeds with its own elongation reaction. Finally, an amplification product having a length of about an integer multiple of the original target sequence is accumulated in a reaction at 65° C. for 1 hour. The result of LAMP can be read by electrophoresis of the amplification product to confirm the characteristic trapezoidal amplification product, or by visually checking the turbidity of the amplification product or measuring it in real time using a real time turbidometer. In addition, it is also possible to read by staining the reaction amplified product using a DNA staining solution such as SYBR green. In the present invention, the loop-mediated isothermal amplification method has to change the temperature while the existing PCR method undergoes three steps of denaturation, annealing, and extension, whereas the isothermal amplification method including LAMP is Bonding and elongation are possible at a constant temperature. In addition, for the amplification reaction, one temperature is used within the range of about 60 to 65° C. as isothermal conditions. In the conventional PCR method, one pair of primers are used, whereas the LAMP method uses two or three pairs of primers to provide specificity. is much higher, and the amount of amplification product is also about 1,000 times higher than that of the existing PCR method. The loop-mediated isothermal amplification method uses Bst DNA polymerase isolated from Geobacillus stearothermophilus instead of Taq DNA polymerase used in the conventional PCR method. It relies on auto-cycling DNA synthesis. Bst DNA polymerase large fragment has 5'-3' polymerase activity, but does not have 5'-3' exonuclease activity. In particular, since Bst DNA polymerase has very high activity, it can synthesize a large amount of DNA with a large molecular weight within a short time, and the polymerization reaction occurs best at about 60 to 65 ° C. Because it can amplify DNA, it is used as a major key element of the LAMP method. The loop-mediated isothermal amplification (LAMP) method of the present invention can be used to achieve gene replication isothermally without denaturing the template DNA.

In the present invention, the primer may be composed of a primer set for LAMP or RT-LAMP. In the present invention, among the primer sets usable for the LAMP method or the RT-LAMP method, the basic 4 types of primers may be composed of 2 types of outer primers and 2 types of internal primers. The outer primer consists of two types, a forward outer (F3) primer and a backward outer (B3) primer, and serves to unwind the DNA double strand during the non-cyclic step of the reaction. In addition, the inner primer is composed of two types of a forward inner (FIP) primer and a forward inner (BIP) primer. Alternatively, it may be composed of nucleotides corresponding to the reverse nucleotide sequence. In the present invention, the additional two types of primers are composed of two types of a forward loop (LF) primer and a backward loop (LB) primer, and are attached to a nucleotide sequence to which an internal primer does not bind to loop-mediated isothermal amplification. accelerate the reaction;

In the present invention, the primer is at least 15 nucleotides in length, at least 10 nucleotides in the case of the forward outer primer (F3) and the rear outer primer (B3), and in the case of the forward inner primer (FIP) and the rear inner primer (BIP) It is a minimum of 25 nucleotides, and may be a minimum of 10 nucleotides for the forward loop primer (LF) and the backward loop primer (LB).

The primer of the present invention is a corresponding part of the target nucleic acid, i.e. with all or part of the Orf1a gene at least 70% complementarity, in particular 80% complementarity, more 90% complementarity, even more particularly 95%, 96%, 97% complementarity , 98%, 99% or 100% complementarity, but is not limited thereto.

In the present invention, the primer may be a sequence complementary to a sequence located in the Orf1a gene, and preferably may include a primer represented by at least one of SEQ ID NOs: 1 to 6 or substantially the same. The primers of the substantially identical sequence are 70%, preferably 80%, more preferably 90%, most preferably 95%, 96%, 97%, 98% of the primers represented by each of SEQ ID NOs: 1 to 6 , it may be one having 99% or 100% complementarity.

In the present invention, the primer may include an oligonucleotide consisting of a fragment of 22 consecutive nucleotides in the sequence of SEQ ID NO: 1.

In the present invention, the primer may include an oligonucleotide consisting of a fragment of 18 consecutive nucleotides in the sequence of SEQ ID NO:2.

In the present invention, the primer may consist of a fragment of 48 nucleotides at two different sites in the sequence of SEQ ID NO: 3, and an oligonucleotide consisting of a fragment of 26 consecutive backward nucleotides in the front part and 22 consecutive forward nucleotides in the back part. can do.

In the present invention, the primer may consist of a fragment of 44 nucleotides at two different sites in the sequence of SEQ ID NO: 4, and an oligonucleotide consisting of a fragment of 24 forward consecutive nucleotides at the front and 20 consecutive forward nucleotides at the rear. can do.

In the present invention, the primer may include an oligonucleotide consisting of a fragment of 15 consecutive nucleotides in the sequence of SEQ ID NO: 5.

In the present invention, the primer may include an oligonucleotide consisting of a fragment of 16 consecutive nucleotides in the sequence of SEQ ID NO: 6.

In the present invention, the primer represented by SEQ ID NO: 1 may be an outer primer, and more preferably, a forward outer (F3) primer.

In the present invention, the primer represented by SEQ ID NO: 2 may be an external primer, more preferably a backward outer primer (B3).

In the present invention, the primer represented by SEQ ID NO: 3 may be an inner primer, more preferably a forward inner (FIP).

In the present invention, the primer represented by SEQ ID NO: 4 may be an inner primer, more preferably a forward inner (BIP).

In the present invention, the primer represented by SEQ ID NO: 5 may be a loop primer, more preferably a forward loop (LF).

In the present invention, the primer represented by SEQ ID NO: 6 may be a loop primer, more preferably a backward loop primer (LB).

In the present invention, the primers are 4 or 6 types of primers specific to all 4 to 6 sites among 6 specific sites of template DNA, and at least 4 or more of the primers represented by SEQ ID NOs: 1 to 6 It may be a primer set including It may be a primer set including all of.

The primer of the present invention can specifically and sensitively amplify the Orf1a gene that appears in a coronavirus-infected person, especially a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infected person, It is possible to quickly and quickly diagnose infection by using a loop-mediated isothermal amplification reaction (LAMP).

According to another embodiment of the present invention, it relates to a composition for detecting a coronavirus, including the primer provided in the present invention.

In the present invention, the detection composition may further include a reagent for performing the LAMP PCR amplification reaction. Examples of more specific reagents may include a reaction buffer, a polymerase, and a template RNA.

In the present invention, the composition for detection may further contain a labeling compound for detection in order to increase the convenience of detection. In this case, the labeled compound may be a compound, a biomolecule or a biomolecule analog, etc. that is included in the amplification product during the amplification process or is physically inserted into the amplification product to check the density, concentration, amount, etc. of the amplification product in a conventional manner. Fluorescent dyes such as SYBR green, FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670, TYE563 and NED may be used. In the Examples to be described later, a fluorescent dye was used as a labeling compound in consideration of easiness of operation and detection sensitivity. If applicable, it is not limited thereto. In addition, tools or reagents incidentally necessary for performing the isothermal amplification reaction or the reverse transcription isothermal amplification reaction may be further included. The above description lists only a part of the composition for detection, and the composition for detection of the present invention is not particularly limited thereto.

According to another embodiment of the present invention, it relates to a kit for detecting coronavirus, including the composition for detecting provided by the present invention.

According to another embodiment of the present invention, it relates to a method of providing information for diagnosing a coronavirus infection or infectious disease using the primer provided in the present invention.

In the present invention, the method comprises the steps of extracting RNA from a biological sample obtained from a subject; Amplifying the target sequence using the extracted RNA as a template using the primers provided in the present invention; and detecting the amplification product.

In the present invention, the "target subject" refers to mammals including humans, for example, humans, rats, mice, guinea pigs, hamsters, rabbits, monkeys, dogs, cats, cattle, horses, pigs, sheep and goats. It may be selected from the group consisting of, and preferably may be a human, but is not limited thereto.

In the present invention, the "human" is a person infected with or suspected of being infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and may mean a person who needs or is expected to receive appropriate treatment, but is limited thereto it is not going to be

In the present invention, the term "biological sample" refers to any material, biological fluid, tissue or cell obtained from or derived from an individual, and more preferably refers to any sample from which genetic information of a patient can be confirmed. there is. Specifically, whole blood, leukocytes, peripheral blood mononuclear cells, buffy coat, plasma, serum, sputum, tears ), mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, ascites (ascites), cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple suction nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cells, cell extract and cerebrospinal fluid) may be one or more selected from the group consisting of, but is not limited thereto.

In the present invention, the step of detecting the amplification product may be performed by confirming the amplified DNA using a turbidimeter, a fluorescent reagent, a precipitate by spin-down or electrophoresis, and through this, the loop-mediated isothermal of the target DNA The amplification (LOOP-mediated isothermal amplification; LAMP) response can be monitored.

In the method of the present invention, the target sequence may be all or part of the Orf1a gene.

In the method of the present invention, the infectious disease of the coronavirus is coronavirus disease 2019 (COVID-19), coronavirus enteritis, coronavirus diarrhea, severe acute respiratory syndrome coronavirus (SARS) ), Middle East respiratory syndrome (MERS), or a combination thereof, but is not limited thereto.

In the present invention, by using a primer set that specifically amplifies the Orf1a gene expressed in coronavirus-infected individuals, it is possible to detect severe acute respiratory syndrome coronavirus with high sensitivity and precision quickly.

1 is a diagram showing the results of an interference experiment on coronavirus and other viruses using a primer according to an embodiment of the present invention in Example 2;
FIG. 2 is a diagram confirming positive and negative reactions through LAMP reaction of a clinical specimen using a primer according to an embodiment of the present invention in Example 3. FIG.
3 is a diagram confirming the minimum detection limit of the Orf1a gene by analyzing an amplification plot according to an embodiment of the present invention in Example 3;

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example 1: Design of LAMP primers matching the nucleotide sequence of the target DNA

The present inventors are a primer set for RT-LAMP for the diagnosis of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection. Find the most stable region of the Orf1a gene, which has no mutation in common. For this, a primer was designed with reference to the sequences registered in Genbank. The base sequence of the Orf1a gene consists of the sequence shown in SEQ ID NO: 7. For each of the external and internal circulation primers (F3, B3, FIP, BIP, LB, LB) prepared in this Example, by combining the first letter of the Orf1a gene, OF3, OB3, OFIP, OBIP, OB-LF, It was named OB-LB.

1.1 Design of two external primers

As the forward outer primer (F3), it is combined with the name of the Orf1a gene and is hereinafter referred to as the OF3 primer. The OF3 primer was prepared with 22 nucleotides corresponding to the 144-165th forward nucleotide sequence of the Orf1a gene of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (SEQ ID NO: 1). In addition, as a rear external primer (B3), it is combined with the name of the Orf1a gene and is hereinafter referred to as an OB3 primer. The OB3 primer was prepared with 18 nucleotides corresponding to the 215-232th reverse complementary base sequence of the Orf1a gene of severe acute respiratory syndrome coronavirus 2 (SEQ ID NO: 2).

1.2 Design of two inner primers

As a forward internal primer (FIP), it is combined with the name of the Orf1a gene and is hereinafter referred to as an OFIP primer. The OFIP primer is a primer designed based on the nucleotide sequences of two different sites and consists of 48 nucleotides, and the 26 nucleotides in the front of the primer correspond to the bases complementary to the 213-238 nucleotide sequence of the Orf1a gene in the reverse direction. The rear part of the inner primer was prepared by combining 22 nucleotides corresponding to the forward nucleotide sequence of the 170-191 nucleotides of the Orf1a gene (SEQ ID NO: 3). In addition, as a backward internal primer (BIP), it is combined with the name of the Orf1a gene and is hereinafter referred to as an OBIP primer. The OBIP primer is a primer made based on the nucleotide sequences of two different sites, and consists of 44 nucleotides. The 24 nucleotides at the front of the primer are the nucleotides corresponding to the forward nucleotide sequence of bases 244 to 267 of the Orf1a gene, and the rear of the primer is Orf1a A primer was prepared by linking 20 nucleotides corresponding to the base sequence complementary to the base 300-319 of the Orf1a gene in the reverse direction (SEQ ID NO: 4).

1.3 Design of additional two-fold loop (ring) primers

As a forward loop primer (LF), it is combined with the name of the Orf1a gene and is hereinafter referred to as an OB-LF primer. The OB-LF primer was prepared with 15 nucleotides corresponding to a nucleotide sequence complementary in the reverse direction to nucleotides 192-206 of the region to which the inner and outer primers are not attached (SEQ ID NO: 5). In addition, as a rear loop primer (LB), it is combined with the name of the Orf1a gene and is hereinafter referred to as an OB-LB primer. The OB-LB primer was prepared as a primer consisting of 16 nucleotides corresponding to the forward nucleotide sequence of the 271-286 th base of the region to which the inner and outer primers are not attached, like the forward loop primer (SEQ ID NO: 6).

Finally, the primer set specific for the gene of Orf1a designed by the present inventors is shown in Table 3 below. Table 3 below shows the names and sequences of six primers for a loop-mediated isothermal amplification reaction for the diagnosis of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection.

sequence list primer Sequence information (5'-3') SEQ ID NO: 1 OF3 CGGTTGTAATTCATCAACTTGT SEQ ID NO: 2 OB3 TCTCGCAACTTCATCACT SEQ ID NO: 3 OFIP AGGACCTTCTAACACCATTAACAATATGTGTTACAAACGTAATAGAGC SEQ ID NO: 4 OBIP GTCTATGCTAATGGAGGTAAAGGCCAGCACAGAATGTATCACAA SEQ ID NO: 5 OB-LF CATTCGACTCTTGTT SEQ ID NO: 6 OB-LB TGCAAACTACACAATT

In addition, the OF3, OB3, OFIP, and OBIP primers for LAMP for rapid diagnosis were set at a melting temperature (Tm) of 60 to 60 using Primer Explorer V4 software (http://primerexplorer.jp/elamp4.0.0/). It was configured between 65 °C. The quality of Tm, GC ratio, and hairpin structure was verified after verification using Integrated DNA Technologies OligoAnalyzer version 3.1 software.

Example 2. Verification of primer sets

A loop-mediated isothermal amplification reaction for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was performed using the six primers designed above. The loop-mediated isothermal amplification reaction was carried out based on the method described in the literature (Mol Cell Probes. 2002 Jun; 16(3):223-9.).

The primer set in Table 3 is designed to amplify the Orf1a gene, which is a gene expressed during infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) with high homology. Accordingly, in order to verify whether it corresponds to the primer set consisting of the sequence with the Orf1a gene specificity of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the results of other interfering substances were compared as shown in Table 4 below. see Fig. 1).

number Interfering substance name Test result One Human coronavirus HKU1 voice(-) 2 human coronavirus OC43 voice(-) 3 human coronavirus NL63 voice(-) 4 Human Parainfluenza Virus 2 voice(-) 5 adenovirus voice(-) 6 Human metapneumovirus (MPV) voice(-) 7 Human respiratory syncytial virus B voice(-) 8 Human Rhinovirus A/B voice(-) 9 Brevibacterium casei voice(-) 10 micrococcus luteus voice(-) 11 Streptococcus pyogenes voice(-) 12 Streptococcus mytis / Oralis voice(-) 13 Serratia Marcesens voice(-) 14 Enterobacter aerogenes voice(-) 15 Klebsiella oxytoca voice(-) 16 Staphylococcus warneri voice(-) 17 Protus Mirabilis voice(-) 18 Citrobacter freundy voice(-) 19 Enterococcus pecalis voice(-) 20 group B streptococci voice(-) 21 Staphylococcus epidermis voice(-) 22 Enterobacter cloaca ssp cloaca voice(-) 23 Propionibacterium acnes voice(-) 24 Dulmabacter hominis voice(-) 25 Stenotrophomonas maltophilia voice(-) 26 Acinetobacter baumani voice(-) 27 Pseudomonas aeruginosa voice(-) 28 Hyaluronic acid producing bacteria voice(-) 29 coli voice(-) 30 Corynebacterium striatum voice(-) 31 pneumococcus pneumoniae voice(-) 32 severe acute respiratory syndrome coronavirus 2 positive (+)

Referring to FIG. 1 , as a result of checking whether detection according to a cycle (1 cycle = 45 sec), it can be seen that only the control group, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), was positively detected. Through this, it was confirmed that the primer set was not affected by the interfering substance at all.

Example 3. Evaluation of sensitivity and specificity of a primer set for LAMP for diagnosis of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection

In order to confirm the sensitivity and specificity of the primer for LAMP PCR prepared for the purpose of diagnosing novel coronavirus infection, the same amount of genomic DNA was used in clinical samples of positive and negative cases of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Tests were performed on the four sets of primers for LAMP prepared in Table 3 above using as a template, and 12.5 uL of Isothermal Master Mix (OptiGene, Japan) was used in a final 25 uL volume. LAMP PCR was performed using Thermal Cycler Dice Real Time System TP850 (Takara, Japan), and each LAMP PCR primer concentration was 0.5 uL (5 pmol) of external primers (OF3, OB3) and 1.5 uL (1.5 pmol) of internal primers. Primers (OFIP, OBIP) were used. The PCR reaction was pre-denatured at 65°C for 30 seconds, then amplified at 65°C for 60 minutes, and the obtained LAMP PCR results are shown in FIG. 2 . The Rn value used in connection with the real-time detection of the amplification reaction represents the fluorescence emission intensity of the reporter dye divided by the fluorescence emission intensity of the dye, and represents the value of the reaction including all components including the template or target for the initial PCR cycle. .

As shown in Figure 2, it was confirmed that some samples appeared in the form of a standard curve as a result of LAMP PCR with the amount of an unknown clinical sample, and some samples that appeared in the form of a standard curve showed severe acute respiratory syndrome coronavirus 2 (SARS- It was confirmed that it corresponds to the proton of CoV-2). As a result of matching the reaction between the positive and negative cases of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in the clinical sample as described above, it was matched with a probability of 100%, and high sensitivity and specificity were confirmed. When using the set, it is expected that precise diagnosis is possible (see FIG. 2 ).

Example 4. Evaluation of detection efficiency of a primer set for LAMP for diagnosing severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection

In order to compare the efficiency of LAMP PCR in detecting the Orf1a gene, LAMP PCR was performed by gradually diluting genomic DNA to 10 ⁷ , 10 ⁶ , 10 ⁵ , 10 ⁴ , 10 ³ , 10 ² , 10 ¹ and 100 ⁰ , respectively. . To evaluate the detection efficiency of the LAMP PCR method developed for a standard sample, the amounts of amplification products were compared, and after PCR was performed by varying the amount of the template to confirm the lowest limit of detection (LoD). The product was further confirmed. 3 shows the lowest level of detection by serial dilution of isolated genomic DNA and using 10 ⁷ , 10 ⁶ , 10 ⁵ , 10 ⁴ , 10 ³ , 10 ² , 10 ¹ and 100 ⁰ as a template for PCR reaction, respectively. The limit was confirmed.

As shown in FIG. 3 , as a result of LAMP PCR, the minimum detection limit (LoD) of the Orfla gene was measured to be 10 copies/uL, and amplified up to 10 ⁷ , 10 ⁶ , 10 ⁵ , 10 ⁴ , 10 ³ , 10 ² , 10 ¹ . It can be confirmed that this has been done (see FIG. 3 ).

Through this, using the loop-mediated isothermal amplification method, it is possible to effectively detect severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in a short time and without specialized equipment. In addition, since high-concentration SYBR Green I can be quickly diagnosed with the naked eye under natural light, it is expected to contribute to early prevention by diagnosing rapidly spreading infectious diseases on the spot.

Although the present invention has been described in detail above, the scope of the present invention is not limited thereto, and it is common in the art that various modifications and variations are possible without departing from the technical spirit of the present invention described in the claims. It will be self-evident to those who have the knowledge of

<110> LEE, Hyeong Woo BAE, Yoon Hee <120> Primer set for detecting coronavirus using the loop-mediated isothermal amplification reaction and uses thereof <130> PDPB204057 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OF3 <400> 1 cggttgtaat tcatcaactt gt 22 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> OB3 <400> 2 tctcgcaact tcatcact 18 <210> 3 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> OFIP <400> 3 aggaccttct aacaccatta acaatatgtg ttacaaacgt aatagagc 48 <210> 4 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> OBIP <400> 4 gtctatgcta atggaggtaa aggccagcac agaatgtatc acaa 44 <210> 5 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> OB-LF <400> 5 cattcgactc ttgtt 15 <210> 6 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> OB-LB <400> 6 tgcaaactac acaatt 16 <210> 7 <211> 565 <212> DNA <213> Unknown <220> <223> SARS-CoV-2 Orf1a gene <400> 7 gcagtacatt ttattagtaa ttcttggctt atgtggttaa taattaatct tgtacaaatg 60 gccccgattt cagctatggt tagaatgtac atcttctttg catcatttta ttatgtatgg 120 aaaagttatg tgcatgttgt agacggttgt aattcatcaa cttgtatgat gtgttacaaa 180 cgtaataagag caacaagagt cgaatgtaca actattgtta atggtgttag aaggtccttt 240 tatgtctatg ctaatggagg taaaggcttt tgcaaactac acaattggaa ttgtgttaat 300 tgtgatacat tctgtgctgg tagtacattt attagtgatg aagttgcgag agacttgtca 360 ctacagttta aaagaccaat aaatcctact gaccagtctt cttacatcgt tgatagtgtt 420 acagtgaaga atggttccat ccatctttac tttgataaag ctggtcaaaa gacttatgaa 480 agacattctc tctctcattt tgttaactta gacaacctga gagctaataa cactaaaggt 540 tcattgccta ttaatgttat agttt 565

Claims (17)

As a primer set for the detection of the coronavirus represented by SEQ ID NOs: 1 to 6,
The coronavirus is a severe acute respiratory syndrome coronavirus 2 (Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2), a primer set. delete The method of claim 1,
The primer set is specific for all or part of the Orf1a gene, the primer set. The method of claim 1,
The primer is a loop-mediated isothermal amplification reaction (Loop-Mediated Isothermal Amplification; LAMP) or reverse transcription loop-mediated isothermal amplification reaction (Reverse transcription Loop-Mediated Isothermal Amplification; RT-LAMP), the primer set. delete delete A composition for detecting a coronavirus comprising the primer set of claim 1,
wherein the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). delete 8. The method of claim 7,
The composition for detection further comprises a reaction buffer, a polymerase, a template RNA (Template RNA), and a labeling compound for detection. 10. The method of claim 9,
The detection compound is SYBR green, FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670, TYE563 and at least one selected from the group consisting of fluorescent dyes (Fluorescent Dye) added A composition comprising a. A kit for detecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) comprising the composition for detection of claim 7 . extracting RNA from a biological sample obtained from a subject of interest;
using the extracted RNA as a template and amplifying the target sequence using the primer set of claim 1; and
A method of providing information for diagnosing infection or infectious disease of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), comprising: detecting the amplification product. 13. The method of claim 12,
The biological sample includes whole blood, leukocytes, peripheral blood mononuclear cells, buffy coat, plasma, serum, sputum, tears ( tears), mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, Ascites, cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cells, cell extract and cerebrospinal fluid ( cerebrospinal fluid) at least one selected from the group consisting of, the method. 13. The method of claim 12,
The step of amplifying the target sequence is a loop-mediated isothermal amplification reaction (Loop-Mediated Isothermal Amplification; LAMP) or a reverse transcription loop-mediated isothermal amplification reaction (Reverse transcription Loop-Mediated Isothermal Amplification; RT-LAMP) is performed as, Way. 13. The method of claim 12,
The method of claim 1, wherein the step of detecting the amplification product is performed through fluorescence, turbidity, formation of a precipitate by spin-down, or electrophoresis. delete delete

Images