KR102461006B1 - Primers and probes for detecting corona virus omicron mutations and uses thereof - Google Patents

Abstract

The present invention relates to a composition comprising primer sets and probes capable of detecting the omicron variant of SARS-CoV-2. The omicron variant of SARS-CoV-2 can be quickly and accurately detected using the composition of the present invention, by distinguishing the omicron variant from a wild type, and thus the composition can be used for variant detection in medical sites where fast and accurate diagnosis is required. The composition for detecting the omicron variant of SARS-CoV-2 of the present invention comprises primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 and a probe of SEQ ID NO: 3.

Description

Primers and probes for detecting corona virus omicron mutations and uses thereof

The present invention relates to a primer set and probe for detecting a mutation in the coronavirus omicron, and more particularly, real time (rt) Reverse Transcription (RT)-Polymerase Chain Reaction (PCR) ) relates to primer sets and probes used in The present invention can detect a coronavirus micronization mutation by using a primer and a probe that specifically bind to the N gene of the coronavirus micronization mutation.

Coronavirus Infectious Disease-19 (COVID-19), which was first discovered in Wuhan, China in November 2019 and has spread to a global pandemic, is an acute respiratory infectious disease caused by a novel strain of coronavirus, SARS-CoV-2. As the gene sequence of SARS-CoV-2 was released, WHO released the molecular genetic diagnosis method for SARS-CoV-2 on its website.

SARS-CoV-2 is classified as a class 1 infectious disease novel infectious disease syndrome and is an RNA virus belonging to the coronaviridae family. Until now, it is spread through droplets (saliva drops) and contact. it is known It is usually known with an incubation period of 1 to 14 days, with an average incubation period of about 4 to 7 days. The main symptoms include fever, malaise, cough, shortness of breath and pneumonia, and various upper respiratory tract infections, including sputum, sore throat, headache, hemoptysis, nausea, and diarrhea. Although symptomatic treatment such as antipyretic and general-purpose antiviral agents are administered in clinical practice, there is no specific antiviral agent. In order to diagnose SARS-CoV-2 infection, a method of diagnosing infection through real-time gene amplification of a specific gene is selected by isolating the virus from an upper or lower respiratory tract specimen.

After SARS-CoV-2 was reported to cause the first infection in November 2019, numerous mutations have been reported starting with the alpha mutation in December 2020. Among them, the B.1.1.529 mutation of SARS-CoV-2, which was newly discovered in South Africa in November 2021, was named omicron mutation by the WHO. Omicron mutation is the first mutant with overlapping purine cleavage mutations, and 5 or more vaccine avoidance mutation sites were identified, and 2 nucleocapsid protein mutations were found.

Infections caused by omicron mutation SARS-CoV-2 have been reported to have a slightly lower fatality rate than before, but we cannot be relieved because sufficient clinical data have not yet been secured. And there is a risk that the number of seriously ill patients may increase significantly, leading to the collapse of the national medical system. As of 2022, it is known that South Africa, where the mutation was first discovered, accounted for more than 90% of mutation detection, and became the dominant species.

In order to prevent the rapid increase in the number of confirmed cases and the collapse of the medical system due to the high contagiousness and contagiousness of such micron mutations, there is an urgent need for a test method that can detect micron mutations with high reliability. Since the N, S and M genes of SARS-CoV-2 are very abundantly expressed, it is reported that they can be used as highly sensitive targets for diagnosis compared to the RdRp and E genes (Toptan et al., 2020, Int J Mol Sci). .).

Therefore, the present inventors tried to develop a primer and a probe capable of diagnosing with high sensitivity and specificity through a real-time polymerase chain reaction by targeting the N gene of the micron mutation of SARS-CoV-2.

The technical problem to be achieved by the present invention is to provide a composition capable of detecting and distinguishing SARS-CoV-2 micron mutation from wild-type, specifically, a primer set and a probe for real-time polymerase chain reaction.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

According to one embodiment of the present invention, there is provided a composition for detecting SARS-CoV-2 micron mutations, comprising the primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 and the probe of SEQ ID NO: 3.

According to one side, the probe of SEQ ID NO: 3 may include a fluorescent label at the 5' end.

According to one side, the fluorescent labeling material is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), HEX (2',4',5',7'-tetrachloro-6-carboxy -4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate), Oregon green, alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro) -Fluorescein), TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes and thiadicarbocyanine from the group consisting of It may be any one or more selected.

According to one side, the probe of SEQ ID NO: 3 may include a quencher at the 3' end.

According to one side, the quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabcyl (dabcyl) ), Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher, and Iowa black (Iowa black) may be any one or more selected from the group consisting of.

According to one aspect, the composition may further include a probe of SEQ ID NO: 4.

According to one side, the 5' end of the probe of SEQ ID NO: 4 may be labeled with a fluorescent material different from that of the probe of SEQ ID NO: 3.

According to another embodiment of the present invention, there is provided a PCR kit for detecting SARS-CoV-2 micron mutations comprising the composition.

According to another embodiment of the present invention, the method comprising: (a) collecting a sample from a subject; And (b) using the primer set of SEQ ID NO: 1 and SEQ ID NO: 2 and the probe of SEQ ID NO: 3 for the genetic material of the collected sample in real time RT Polymerase Chain Reaction (rt-RT-PCR) ); There is provided a method for detecting SARS-CoV-2 micron mutation comprising a.

According to one side, the sample may be any one or more selected from sputum, pharyngeal smear, saliva, and nasal smear of the subject.

According to one side, in the real-time reverse transcription polymerase chain reaction step of (b), the annealing temperature may be 58 °C.

According to one aspect, the real-time reverse transcription polymerase chain reaction of step (b) of the detection method may further include a probe of SEQ ID NO: 4.

The present invention can accurately and quickly detect SARS-CoV-2 micron mutation, and in particular, can detect micron mutation by distinguishing it from other respiratory disease viruses and SARS-CoV-2 wild type. In addition, by using the composition including the primer set and the probe of the present invention, it is possible to simultaneously detect SARS-CoV-2 wild-type and omicron mutations simply by using real-time polymerase chain reaction, and has high sensitivity and specificity.

1 is a diagram showing fluorescence in wild-type SARS-CoV-2 and omicron mutations by simultaneously applying HEX-labeled wild-type probe and FAM-labeled omicron probe.
2 is a chart showing the fluorescence of the primer set and probe of the present invention specifically responding to SARS-CoV-2 micron mutation compared to other viruses.
FIG. 3 is a chart of measuring fluorescence according to temperature in a primer set of an Omicron probe labeled with FAM.
FIG. 4 is a chart of measuring fluorescence according to temperature in a primer set of a wild-type probe labeled with HEX.
FIG. 5 is a chart showing fluorescence in wild-type SARS-CoV-2 and omicron mutations in the primer set of the FAM-labeled omicron probe.
6 is a chart showing fluorescence in wild-type SARS-CoV-2 and micron mutations in a primer set of a wild-type probe labeled with HEX.
7 is a diagram illustrating detection limits measured with different sample concentrations in a primer set of an Omicron probe labeled with FAM.
8 is a diagram illustrating detection limits measured with different sample concentrations in a primer set of an Omicron probe labeled with HEX.

The present invention can detect SARS-CoV-2 micron mutation by producing a primer set and probe based on the N gene of SARS-CoV-2 micron mutation to distinguish it from SARS-CoV-2 wild-type and other respiratory disease viruses. It is characterized in that In addition, the present invention can reduce the detection time compared to conventional RT-PCR by using the performed reverse transcription polymerase chain reaction (real-time RT PCR) method. The present invention reduces errors and time required for analysis of results that may be generated by conventional PCR methods, and enables detection of SARS-CoV-2 micron mutations.

Specifically, the present invention provides a primer and probe set for detecting SARS-CoV-2 micron mutation, which includes a primer and probe for the N gene of SARS-CoV-2 micron mutation. In addition, the present invention provides a composition for detecting SARS-CoV-2 micron mutations comprising the primer and probe set.

More specifically, a primer set consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2, and a probe of SEQ ID NO: 3 were constructed by targeting the N gene of SARS-CoV-2 micron mutation. The primer and probe set, and a composition including the same, may be used for detecting SARS-CoV-2 micron mutation using real-time RT-PCR.

In the present invention, the probe of SEQ ID NO: 3 is labeled with a fluorescent material and can be used to detect SARS-CoV-2 micron mutation, and SARS-CoV-2 micron mutation in the sample can be determined through the intensity of fluorescence or the wavelength of fluorescence. It is possible to distinguish between respect and dignity. According to one side, different fluorescence-labeled probes for detecting SARS-CoV-2 wild type may be used together with the probe of SEQ ID NO: 3 of the present invention, and in this case, SARS-CoV-2 micron mutation and wild type fluorescence can be identified by the label.

On the other hand, the primer sets of SEQ ID NOs: 1 and 2 of the present invention can specifically and sensitively detect SARS-CoV-2 micron mutations, unlike the primers used for conventional SARS-CoV-2 detection.

In the present invention, the term "primer" means a template under suitable conditions (for example, four different nucleoside triphosphates and a polymerization agent such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and at an appropriate temperature. - refers to single-stranded oligonucleotides that can serve as a starting point for directing DNA synthesis. The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence need not be completely complementary to the template, but must be sufficiently complementary to hybridize to the template.

The primer of the present invention can be chemically synthesized using methods known in the art, such as, for example, a phosphoramidite solid support method. In addition, it can be modified by methylation, capping, etc. by a known method. In addition, if necessary, the primer of the present invention may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (eg, horseradish peroxidase, alkaline phosphatase), radioactive isotopes (eg, 32P), fluorescent molecules, chemical groups (eg, biotin), and the like. have.

In the present invention, the term “probe” refers to a nucleic acid fragment consisting of several to hundreds of bases capable of specifically binding to a nucleotide sequence, and is labeled to confirm the presence of a specific nucleic acid. The probe may be manufactured in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, etc., and may be labeled with biotin, FITC, rhodamine, DIG, or the like, or labeled with a radioisotope.

Preferably, the probe of the present invention may be labeled with a fluorescent material at the 5'-end, and a quencher may be conjugated at the 3'-end. In the present invention, the fluorescent material is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy-4, 7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate), Oregon green ( oregon green), Alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), Tetrachloro-Fluorescein (TET) , TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes and thiadicarbocyanine, etc. TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (Deep) Dark Quencher), Blackberry Quencher, Iowa black, and the like.

The composition of the present invention may be used for PCR for detecting SARS-CoV-2 micron mutation, and the PCR may be preferably real-time reverse transcription PCR.

In the present invention, SEQ ID NO: 4 is a probe designed to be suitable for detecting SARS-CoV-2 wild-type, and preferably, the 5' end may be labeled with a different fluorescence from the probe of SEQ ID NO: 3. Therefore, when the polymerase chain reaction is performed using both probes simultaneously, the SARS-CoV-2 wild-type and omicron mutations can be distinguished and detected at the same time.

According to another embodiment of the present invention, the method comprising: (a) collecting a sample from a subject; (b) reverse transcribed the RNA of the collected sample into complementary DNA (cDNA) using a reverse transcriptase; (c) performing a real time polymerase chain reaction (rt-PCR) using the reverse transcribed cDNA as a template, primer sets of SEQ ID NOs: 1 and 2, and a probe of SEQ ID NO: 3 ; There is provided a method for detecting SARS-CoV-2 micron mutation comprising a.

In the present invention, the sample is a biological sample and contains any one or more of nasopharyngeal lavage fluid, bronchoalveolar lavage fluid, pleural fluid, nasal smear, nasal aspirate, nasopharyngeal smear, nasopharyngeal aspiration, blood, body fluid, saliva, sputum and sputum. It may be used, preferably sputum and pharyngeal smear.

The present invention can apply various transformations and can have various embodiments. Hereinafter, specific embodiments are illustrated in the drawings and described in detail in the detailed description. However, this is not intended to limit the present invention to specific embodiments, and should be understood to include all modifications, equivalents, and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of a related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

Hereinafter, embodiments will be described in detail with reference to the accompanying drawings. However, since various changes may be made to the embodiments, the scope of the patent application is not limited or limited by these embodiments. It should be understood that all modifications, equivalents and substitutes for the embodiments are included in the scope of the rights.

Terms used in the examples are used for the purpose of description only, and should not be construed as limiting. The singular expression includes the plural expression unless the context clearly dictates otherwise. In the present specification, terms such as “comprise” or “have” are intended to designate that a feature, number, step, operation, component, part, or combination thereof described in the specification exists, but one or more other features It is to be understood that this does not preclude the possibility of the presence or addition of numbers, steps, operations, components, parts, or combinations thereof.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which the embodiment belongs. Terms such as those defined in a commonly used dictionary should be interpreted as having a meaning consistent with the meaning in the context of the related art, and should not be interpreted in an ideal or excessively formal meaning unless explicitly defined in the present application. does not

In addition, in the description with reference to the accompanying drawings, the same components are assigned the same reference numerals regardless of the reference numerals, and the overlapping description thereof will be omitted. In the description of the embodiment, if it is determined that a detailed description of a related known technology may unnecessarily obscure the gist of the embodiment, the detailed description thereof will be omitted.

Example 1. Primer set and probe design and PCR

Based on the nucleotide sequence of the published SARS-CoV-2 micron mutation, the target gene was set as the N gene, and primers and probes were designed. Specific information on the prepared primers and probes is shown in Table 1 below. The following Omicron probe is labeled with FAM at the 5' end and includes a BHQ1 quencher at the 3' end. The following wild-type probe was labeled with HEX at the 5' end and includes a BHQ1 quencher at the 3' end.

SEQ ID NO: target gene primer sequence (5' -> 3') position (length) One N gene Primer F TCTGATAATGGACCCCAAAA 4-23(20) 2 Primer R GTGTTAATTGGAACGCCTTG 199-218(20) 3 Omicron probe CCAGAATGGTGGGGCGCGAT 81-100(20) 4 wild type probe GAATGGAGAACGCAGTGGG 84-102(19)

Then, a primer mix including the primer set of SEQ ID NOs: 1 and 2 and the probe of SEQ ID NO: 3 was subjected to a real time reverse transcription polymerase chain reaction (RT PCR) with the composition shown in Table 2 below. PCR conditions are shown in Table 3 below. The sequence of the following wild-type probe is as attached as SEQ ID NO: 4 in the sequence listing, and the 5' end was labeled with HEX.

division volume 2XMastermix 10 μl Primer F (10 pmol) 1 μl Primer R (10 pmol) 1 μl Wild-type probe (HEX) (10 pmol) 0.5 μl Omicron probe (FAM) (4 pmol) 0.5 μl template DNA 5 μl Distilled water 2 μl total volume 20 μl

step-by-step temperature hour 50℃ 30 min 95℃ 15 min 95℃ 40 sec 40 cycles 58℃ 60 sec

Example 2. Sensitivity and Specificity Testing of Omicron Variation Detection

Under the conditions of Tables 2 and 3, RT-PCR was performed using SARS-CoV-2 wild-type and SARS-CoV-2 micron mutant samples as templates to measure Ct values to determine the sensitivity and specificity of primer sets and probes. was confirmed, and the results are shown in FIGS. 1 and 4, respectively. As shown in Table 4 below, only the FAM fluorescence of the Omicron probe was detected in the sample of the Omicron mutation template, and only the HEX fluorescence of the wild-type probe was detected in the sample of the wild-type template.

sample Ct[FAM] Ct[HEX] Omicron RNA 14.73 N/A Omicron RNA 15.06 N/A Omicron RNA 14.70 N/A Omicron RNA 14.52 N/A Covid19 RNA N/A 17.44 Covid19 RNA N/A 17.47 Covid19 RNA N/A 17.77 Covid19 RNA N/A 17.59 DW N/A N/A

In addition, in order to confirm the specificity of the primer set, RT-PCR was performed on samples of dengue virus, chikunguniya virus, Zika virus, Japanese encephalitis virus, SARS-CoV-2 wild-type and omicron mutation. This is shown in FIG. 2 and Table 6, and it was confirmed that it did not respond to other viruses, and reacted specifically only to SARS-CoV-2 micron mutation. The sale information of each specimen is shown in Table 5.

Accordingly, it was confirmed that the primer set of the present invention has high sensitivity and specificity to micron mutation.

sample number Specimen name sale agency NCCP: 41501 Dengue virus1 (RNA) National Pathogen Resource Bank KBPV-VR-29D Dengue virus2 (RNA) pathogenic virus bank KBPV-VR-30D Dengue virus3 (RNA) pathogenic virus bank KBPV-VR-31D Dengue virus4 (RNA) pathogenic virus bank KBPV-VR-27D Japanese encephalitis virus (RNA) pathogenic virus bank NCCP: 43245 Zika virus (RNA) National Pathogen Resource Bank NCCP: 43132 Chikungunya virus (RNA) National Pathogen Resource Bank NCCP: 43329 SARS-CoV-2 National Pathogen Resource Bank

SAMPLE Ct[FAM] Dengue 1 N/A Dengue 2 N/A Dengue 3 N/A Dengue 4 N/A Chikungunya N/A Zika N/A JEV N/A wildtype N/A Omicron 19.98 DW N/A

Example 3. Optimal temperature setting

RT-PCR was performed using the SARS-CoV-2 wild-type and SARS-CoV-2 micron mutated samples as templates to set the optimum annealing temperature. Experimental results are shown in FIGS. 3 and 7 for the omicron mutated sample, and FIGS. 4 and 8 for the wild type.

Temperature (℃) sample Ct[FAM] 64.0 Omicron
RNA 19.13 63.7 18.99 63.0 18.19 61.8 17.60 60.4 18.27 59.2 17.40 58.4 18.03 58.0 18.02

Temperature (℃) sample Ct[FAM] 64.0 wildtype
(Covid-19)
RNA 21.74 63.7 21.31 63.0 20.40 61.8 19.83 60.4 19.30 59.2 19.39 58.4 19.11 58.0 19.08

Based on the above results, the optimum annealing temperature was set to 58°C.

Example 4. Specificity Analysis

While performing RT-PCR using the SARS-CoV-2 wild-type and SARS-CoV-2 micron mutant samples as templates, either one of the FAM-labeled omicron probe and the HEX-labeled wild-type probe was applied, We tested whether mutations and wild-types could be detected. The results using the FAM-labeled omicron probe are shown in FIGS. 5 and 9, and the results using the HEX-labeled wild-type probe are shown in FIGS. 6 and 10.

sample Ct[FAM] Ct[HEX] Omicron RNA 22.92 N/A Omicron RNA 22.76 N/A Covid19 RNA N/A N/A Covid19 RNA N/A N/A DW N/A N/A

sample Ct[FAM] Ct[HEX] Covid19 RNA N/A 26.35 Covid19 RNA N/A 26.68 Omicron RNA N/A N/A Omicron RNA N/A N/A DW N/A N/A

As shown in Table 9 and FIG. 5, the primer set using the FAM-labeled omicron probe did not show fluorescence in the wild-type sample, but only showed fluorescence in the omicron-mutated sample, showing high specificity.

Similarly, as shown in Table 10 and FIG. 6, the primer set using the HEX-labeled wild-type probe did not show fluorescence in the micron mutant sample, but only showed fluorescence in the wild-type sample, thus showing high specificity.

Example 5. Limit of detection test

In order to confirm the detection limit concentration, the Ct value was measured while varying the sample concentration. First, the results of detecting the omicron mutation sample with a primer set including the FAM-labeled omicron probe are shown in FIG. 7 and Table 11.

Concentration (copy/ul) sample Ct[FAM] 3X10 ⁶ Omicron
RNA 14.21 3X10 ⁵ 16.30 3X10 ⁴ 19.99 3X10 ³ 23.03 3X10 ² 25.53 3X10 ¹ 27.88 3X10 ⁰ 30.72

As a result of the detection limit test, it was confirmed that the FAM-labeled Omicron probe was detected up to 3x10 ⁰ copy/ul within 35 cycles.

Next, the detection limit of the HEX-labeled Omicron probe was confirmed in the same manner as above, and the results are shown in FIG. 8 and Table 12.

Concentration (copy/ul) sample Ct[FAM] 3X10 ⁷ Omicron
RNA 19.39 3X10 ⁶ 23.01 3X10 ⁵ 25.69 3X10 ⁴ 30.18 3X10 ³ 33.03 3X10 ² 37.18 3X10 ¹ N/A 3X10 ⁰ N/A 3X10 ⁰ DW N/A

As a result of the detection limit test, it was confirmed that the HEX-labeled Omicron probe was detected up to 3x10 ² copy/ul within 40 cycles. As described above, the primer set and probe of the present invention exhibited excellent detection limits.

As described above, although the embodiments have been described with reference to the limited drawings, those skilled in the art may apply various technical modifications and variations based on the above. For example, the described techniques are performed in an order different from the described method, and/or the described components of the system, structure, apparatus, circuit, etc. are combined or combined in a different form than the described method, or other components Or substituted or substituted by equivalents may achieve an appropriate result.

Therefore, other implementations, other embodiments, and equivalents to the claims are also within the scope of the following claims.

<110> BIONICS Co., Ltd. <120> Primers and probes for detecting corona virus omicron mutations and uses it <130> APC-2021-1049 <150> KR 10-2021-0176024 <151> 2021-12-09 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SARS-CoV-2 omicron N gene <400> 1 tctgataatg gaccccaaaa 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SARS-CoV-2 omicron N gene <400> 2 gtgttaattg gaacgccttg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe for SARS-CoV-2 omicron N gene <400> 3 ccagaatggt ggggcgcgat 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Probe for SARS-CoV-2 wildtype N gene <400> 4 gaatggagaa cgcagtggg 19

Claims (12)

A composition for detecting SARS-CoV-2 micron mutation, comprising a primer set of SEQ ID NO: 1 and SEQ ID NO: 2 and a probe of SEQ ID NO: 3.
According to claim 1, wherein the probe of SEQ ID NO: 3 comprises a fluorescent label at the 5' end, SARS-CoV-2 micron mutation detection composition.
The method of claim 2, wherein the fluorescent labeling material is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), HEX (2',4',5',7'-tetrachloro-6- carboxy-4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate) , oregon green, alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), TET ( Tetrachloro-Fluorescein), TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine Any one or more selected from, SARS-CoV-2 micron mutation detection composition.
According to claim 1, wherein the probe of SEQ ID NO: 3 comprises a quencher (quencher) at the 3' end, SARS-CoV-2 micron mutation detection composition.
According to claim 4, wherein the quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dapsyl ( dabcyl), Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher, and any one or more selected from the group consisting of Iowa black (Iowa black), SARS-CoV-2 Omicron mutation detection composition.
The composition for detecting SARS-CoV-2 micron mutation according to claim 2, further comprising a probe of SEQ ID NO: 4.
The composition for detecting SARS-CoV-2 micron mutation according to claim 6, wherein the probe of SEQ ID NO: 4 comprises a different fluorescent labeling material from the fluorescent labeling material of the probe of SEQ ID NO: 3 at the 5' end of the probe. .
A PCR kit for detecting SARS-CoV-2 micron mutations comprising the composition of any one of claims 1 to 7.
Using the primer set of SEQ ID NO: 1 and SEQ ID NO: 2 and the probe of SEQ ID NO: 3 for the genetic material of the sample obtained from the subject, real time RT Polymerase Chain Reaction (rt-RT-PCR) is performed. step;
A method for detecting SARS-CoV-2 micron mutations comprising a.
The method of claim 9, wherein the sample is at least one selected from sputum, pharyngeal smear, saliva, and nasal smear of a subject.
10. The method of claim 9,
In the real-time reverse transcription polymerase chain reaction step, the annealing temperature is 58 ℃, the detection method of SARS-CoV-2 micron mutation.
The method of claim 9, wherein the real-time reverse transcription polymerase chain reaction further comprises a probe of SEQ ID NO: 4, SARS-CoV-2 micron mutation detection method.

Images