KR102231338B1 - Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same - Google Patents

Abstract

The present invention relates to a primer and a probe for discriminating avian influenza, Newcastle disease and chicken infectious bronchitis viruses, and a method for discriminating avian influenza, Newcastle disease and chicken infectious bronchitis viruses using the same. Specifically, the primer and probe set of the present invention can specifically detect and simultaneously detect type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus, and has superior detection efficiency, such as analytical sensitivity, compared to known primer sets. It can be usefully used for detection of avian influenza type, Newcastle disease and chicken infectious bronchitis virus, and can be helpful in preparing effective quarantine measures against the virus.

Description

Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same}

The present invention relates to primers and probes for detecting avian influenza, Newcastle disease and chicken infectious bronchitis viruses, and a method for detecting avian influenza, Newcastle disease and chicken infectious bronchitis viruses using the same.

Influenza virus is an RNA virus belonging to the Orthomyxoviridae family, and is classified into types A, B and C. Influenza A virus is primarily a natural host of wild aquatic birds, which spreads rapidly through species-to-species transmission and is highly virulent, whereas influenza B and C viruses are less frequent and less virulent than influenza A virus.

The avian influenza virus, which belongs to the type A influenza virus, mainly induces interspecies transmission through the respiratory tract, and is a virus that causes acute respiratory diseases such as high fever, headache, cough, and runny nose. Type A avian influenza virus has 8 single-stranded segmented RNA genes, depending on the types of hemagglutinin (HA) and neuraminidase (NA), glycoproteins present on the virus surface. They are classified into several subtypes.

The development of various subtypes is antigenic drift in which antigenic mutation occurs due to a point mutation in the HA or NA gene during the viral replication mechanism, and antigenic shift that becomes a completely different subtype from the existing subtype by acquiring new HA or NA. It is achieved by this (antigenic shift). While antigenic mutations can predict mutations, antigenic mutations are difficult to predict because influenza viruses composed of eight RNA segments can produce mutant influenza by genetic recombination between different subtypes.

Currently, the emergence of various subtypes of avian influenza A virus and cases of human infection have been continuously reported. Since the outbreak of such avian influenza virus causes enormous economic losses to the bird farming business and damages due to human infection, prevention and treatment through rapid diagnosis of infection is very important.

On the other hand, avian influenza A virus has very similar clinical symptoms to the newcastle disease virus and the avian infectious bronchitis virus. For example, respiratory symptoms such as coughing, sneezing, and runny nose, and clinical symptoms such as rapid decrease in spawning in spawning chickens or ducks, deformed eggs, soft eggs, and depigmented eggs are common symptoms caused by the above three viruses. Corresponds. Therefore, in the diagnosis of type A avian influenza virus, differential diagnosis between Newcastle disease virus and chicken infectious bronchitis virus with similar clinical symptoms is essential.

Diagnosis of avian influenza A virus is being tested and diagnosed according to the standards set by the Organization Mondiale de la Sante Animale (OIE), and diagnostic methods include the causative agent isolation test, antibody test, and molecular diagnosis. The causative agent isolation test has the disadvantage that it takes a long time to be diagnosed, and the antibody test has the disadvantage that the sensitivity is low, so the results can be quickly read, large-scale analysis is possible, and the use of molecular diagnostic methods with high analytical sensitivity and specificity is increasing. I'm doing it.

Korean Patent Registration No. 10-1566156

It is an object of the present invention to provide a primer set for detecting Avian influenza, Newcastle disease and chicken infectious bronchitis viruses.

Another object of the present invention is to provide a composition and kit for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus, including the primer set.

Another object of the present invention is to provide a method for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus using the above primer set.

In order to achieve the above object, the present invention is a first forward primer described in the nucleotide sequence of SEQ ID NO: 1; A second forward primer represented by the nucleotide sequence of SEQ ID NO: 4; A third forward primer represented by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer represented by the nucleotide sequence of SEQ ID NO: 10; A first reverse primer described by the nucleotide sequence of SEQ ID NO: 2; A second reverse primer represented by the nucleotide sequence of SEQ ID NO: 6; A third reverse primer represented by the nucleotide sequence of SEQ ID NO: 7; And it provides a primer set for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus, consisting of a fourth reverse primer represented by the nucleotide sequence of SEQ ID NO: 11.

In addition, the present invention provides a composition for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus comprising the primer set.

In addition, the present invention provides a kit for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus comprising the composition.

In addition, the present invention is a type A comprising the step of performing a real-time reverse transcription polymerase chain reaction (RT-PCR) using the primer set as a template using the nucleic acid isolated from the specimen as a template. Avian influenza, Newcastle disease and chicken infectious bronchitis virus detection method is provided.

The primer and probe set of the present invention can specifically and simultaneously detect and detect type A avian influenza, Newcastle disease, and chicken infectious bronchitis viruses, and has superior detection efficiency such as analytical sensitivity compared to known primer sets, and thus, type A avian influenza , Newcastle disease and chicken infectious bronchitis virus can be detected usefully, it can be helpful in preparing effective quarantine measures against the virus.

1 is a graph of the results of multiple real-time RT-PCR using the primer and probe set of the present invention.
2 is a graph (A) and a standard curve graph (B) of a result of confirming the analytical sensitivity to a type A avian influenza virus of multiple real-time RT-PCR using the primer and probe set of the present invention.
FIG. 3 is a graph (A) and a standard curve graph (B) of confirming the analytical sensitivity to Newcastle disease virus of multiple real-time RT-PCR using the primer and probe set of the present invention.
4 is a graph (A) and a standard curve graph (B) confirming the analytical sensitivity to chicken infectious bronchitis virus of multiple real-time RT-PCR using the primer and probe set of the present invention.
5 is a graph (A) of multiple real-time RT-PCR results using a primer and probe set of the present invention for type A avian influenza virus and a graph (B) of real-time PCR results using a commercially available primer set (D1 to D5: A A sample of avian influenza virus-positive RNA sample diluted in steps of 10 times, with D1 being the highest concentration).
6 is a graph (A) of multiple real-time RT-PCR results using a primer and probe set of the present invention for Newcastle disease virus and a diagram (B) showing PCR results using a known primer set (D1 to D5: Newcastle disease virus positive This is a sample obtained by diluting the RNA sample in steps of 10 times, and D1 is the highest concentration).
7 is a graph (A) of multiple real-time RT-PCR results using the primers and probe sets of the present invention for chicken infectious bronchitis virus (B) showing the PCR results using a known primer set (D1 to D5: chicken Infectious bronchitis virus-positive RNA sample was diluted in steps of 10 times, with D1 being the highest concentration).
8 is a view showing the result of examining the matching rate of the sequence of 60 kinds of matrix genes of the type A avian influenza virus with the primer and probe set for detecting a type A avian influenza virus of the present invention.
9 is a view showing the result of investigation of the matching rate of the sequence of 60 kinds of nucleoprotein genes of a known primer set and type A avian influenza virus.
10 is a diagram showing the results of examining the sequence of the primer and probe set for detecting Newcastle disease virus of the present invention and the sequence of the known primer set for 50 Newcastle disease virus genes.
11 is a view showing the result of investigating the matching rate of the sequence of 60 species of chicken infectious bronchitis virus genes with a set of primers and probes for detecting chicken infectious bronchitis virus of the present invention.
12 is a diagram showing the results of examining the matching rate of the sequence of 60 species of chicken infectious bronchitis virus genes with a known primer set.
13 is a graph of multiple real-time RT-PCR results using the primers and probes of the present invention (AIV: Avian influenza virus, NDV: Newcastle disease virus, and IBV: chicken infectious bronchitis virus).
14 is a diagram showing the results of nested RT-PCR using a known primer set (AIV: Avian influenza virus type A, NDV: Newcastle disease virus, IBV: chicken infectious bronchitis virus, and red box: target band) .
15 is a diagram showing the results of nested RT-PCR using a known primer set (AIV: Avian influenza virus type A, NDV: Newcastle disease virus, IBV: chicken infectious bronchitis virus, and red arrow: non-specific band).

Hereinafter, the present invention will be described in detail.

The present invention is a first forward primer described in the nucleotide sequence of SEQ ID NO: 1; A second forward primer represented by the nucleotide sequence of SEQ ID NO: 4; A third forward primer represented by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer represented by the nucleotide sequence of SEQ ID NO: 10; A first reverse primer described by the nucleotide sequence of SEQ ID NO: 2; A second reverse primer represented by the nucleotide sequence of SEQ ID NO: 6; A third reverse primer represented by the nucleotide sequence of SEQ ID NO: 7; And it provides a primer set for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus, consisting of a fourth reverse primer represented by the nucleotide sequence of SEQ ID NO: 11.

The primer set may specifically amplify a matrix gene region of a type A avian influenza virus, a matrix gene region of a Newcastle disease virus, and a spike glycoprotein 1 region of a chicken infectious bronchitis virus. In addition, the primer set may be 10 to 40 complementarily bindable to genes in the matrix gene region of the Avian influenza virus, the matrix gene region of the Newcastle disease virus, or the spike glycoprotein 1 region of the chicken infectious bronchitis virus, specifically 15. It may be a pair of forward and reverse primers consisting of to 30 base sequences. In an embodiment of the present invention, the primer set includes a first forward primer described in the nucleotide sequence of SEQ ID NO: 1; A second forward primer represented by the nucleotide sequence of SEQ ID NO: 4; A third forward primer represented by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer represented by the nucleotide sequence of SEQ ID NO: 10; A first reverse primer described by the nucleotide sequence of SEQ ID NO: 2; A second reverse primer represented by the nucleotide sequence of SEQ ID NO: 6; A third reverse primer represented by the nucleotide sequence of SEQ ID NO: 7; And a fourth reverse primer described in the nucleotide sequence of SEQ ID NO: 11.

The primer can be chemically synthesized using a phosphoramidite solid support method, or other well known methods. Such primers can be modified using a number of means known in the art as long as they exhibit an effect capable of detecting avian influenza A virus, Newcastle disease virus or chicken infectious bronchitis virus. Examples of such modifications are methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, the primer of the present invention may contain a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means, if necessary. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., ³² P), fluorescent molecules and chemical groups (e.g., biotin), etc. There is this.

In addition, the present invention provides a composition for detecting A type avian influenza, Newcastle disease and chicken infectious bronchitis virus, including a primer set for detecting A type avian influenza, Newcastle disease and chicken infectious bronchitis virus of the present invention.

The primer set may have the characteristics as described above. For example, the primer set may specifically amplify the matrix gene region of the Avian influenza virus type A, the matrix gene region of the Newcastle disease virus, and the spike glycoprotein 1 region of the chicken infectious bronchitis virus. In addition, the primer set may be 10 to 40 complementarily bindable to genes in the matrix gene region of the Avian influenza virus, the matrix gene region of the Newcastle disease virus, or the spike glycoprotein 1 region of the chicken infectious bronchitis virus, specifically 15. It may be a pair of forward and reverse primers consisting of to 30 base sequences. In an embodiment of the present invention, the primer set includes a first forward primer described in the nucleotide sequence of SEQ ID NO: 1; A second forward primer represented by the nucleotide sequence of SEQ ID NO: 4; A third forward primer represented by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer represented by the nucleotide sequence of SEQ ID NO: 10; A first reverse primer described by the nucleotide sequence of SEQ ID NO: 2; A second reverse primer represented by the nucleotide sequence of SEQ ID NO: 6; A third reverse primer represented by the nucleotide sequence of SEQ ID NO: 7; And a fourth reverse primer described in the nucleotide sequence of SEQ ID NO: 11.

The composition may further include probes each described with the base sequences of SEQ ID NOs: 3, 8, 9, and 12.

The term "probe" as used herein refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and an oligonucleotide probe, a single stranded DNA probe , Double stranded DNA (DNA) probe or RNA probe can be produced in the form of.

The probe can be chemically synthesized using a phosphoramidite solid support method, or other well known method. These probes can be modified using a number of means known in the art as long as they exhibit an effect capable of detecting avian influenza A virus, Newcastle disease virus or chicken infectious bronchitis virus. Examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

The probe may further have a reporter attached to its 5'end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2',4',5',7'-tetrachloro) -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green, Alexa Fluoro (alexa fluor), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), VIC (2′-chloro-7′phenyl-1,4-dichloro-6-carboxy-fluorescein), cyanine (Cyanine) series dye and thiadicarbocyanine (thiadicarbocyanine) may be any one or more selected from the group consisting of, in addition, any one known as a material that can be used as a reporter in the art can be used. In one embodiment of the present invention, the reporter may be FAM, VIC or Cy5.

The probe may be further conjugated to a quencher at its 3'end. The quencher is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (non-fluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher, Iowa Black ( Iowa black) may be any one or more selected from the group consisting of, but any other material known as a material that can be used as a quencher in the art may be used. In an embodiment of the present invention, the quencher may be a minor groove binder non-fluorescent quencher (MGBNFQ) or BHQ.

In addition to the primer set and probe, the composition may include reverse transcription polymerase, DNA polymerase, ^{cofactors such as Mg 2+} , dATP, dCTP, dGTP, and dTTP. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E.coli DNA polymerase I, thermostable DNA polymerase, or bacteriophage T7 DNA polymerization. There are enzymes. The polymerase can be isolated from the bacterium itself, purchased commercially, or obtained from cells expressing high levels of the cloning gene encoding the polymerase.

In a specific embodiment of the present invention, the present inventors have a first forward primer described in the nucleotide sequence of SEQ ID NO: 1, a second forward primer described in the nucleotide sequence of SEQ ID NO: 4, and a third forward primer described in the nucleotide sequence of SEQ ID NO: 5 Forward primer, the fourth forward primer described by the nucleotide sequence of SEQ ID NO: 10, the first reverse primer described by the nucleotide sequence of SEQ ID NO: 2, the second reverse primer described by the nucleotide sequence of SEQ ID NO: 6, the base of SEQ ID NO: 7 A third reverse primer described by the sequence, a fourth reverse primer described by the nucleotide sequence of SEQ ID NO: 11, and a probe each described by the nucleotide sequences of SEQ ID NO: 3, 8, 9, and 12 were prepared (see Table 1). .

In addition, as a result of performing multiplex real-time RT-PCR using the primer and probe set, the present inventors confirmed that only type A avian influenza, Newcastle disease and chicken infectious bronchitis viruses were specifically distinguished and detected (Table 2 to 6, and FIG. 1), it was confirmed that the minimum detection limits for each virus were 13, 18 and 19 copies/reaction, respectively (see FIGS. 2 to 4).

In addition, the present inventors confirmed that the primer and probe set has excellent analytical sensitivity compared to the known primer set (see Tables 7 to 10, and Figs. 5 to 7), and the theoretical detectability compared to another known primer set and It was confirmed that the actual RT-PCR detection efficiency was excellent (see Tables 11 to 19, and FIGS. 8 to 15).

Accordingly, the primer and probe set may be usefully used for detection and diagnosis of avian influenza A, Newcastle disease, and chicken infectious bronchitis viruses.

In addition, the present invention provides a kit for detection of avian influenza A, Newcastle disease and chicken infectious bronchitis virus, including the composition for detecting A-type avian influenza, Newcastle disease and chicken infectious bronchitis virus of the present invention.

The composition may have the characteristics as described above. In one example, the composition comprises a first forward primer described in the nucleotide sequence of SEQ ID NO: 1; A second forward primer represented by the nucleotide sequence of SEQ ID NO: 4; A third forward primer represented by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer represented by the nucleotide sequence of SEQ ID NO: 10; A first reverse primer described by the nucleotide sequence of SEQ ID NO: 2; A second reverse primer represented by the nucleotide sequence of SEQ ID NO: 6; A third reverse primer represented by the nucleotide sequence of SEQ ID NO: 7; And a primer set for detecting avian influenza type A, Newcastle disease and chicken infectious bronchitis virus consisting of a fourth reverse primer described in the nucleotide sequence of SEQ ID NO: 11. In addition, the composition may further include a probe each described in the nucleotide sequence of SEQ ID NO: 3, 8, 9, and 12, and the probe further includes a reporter at its 5'end and a quencher at its 3'end. It may be bonded.

The kit may further include one or more other component compositions, solutions or devices suitable for the assay method. In addition to the specific primer pairs for the matrix gene region of the Avian influenza virus type A, the matrix gene region of the Newcastle disease virus, and the spike glycoprotein 1 region of the chicken infectious bronchitis virus, the kit includes a tube or other suitable container, a reaction buffer (pH and magnesium concentration). Are various), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water and sterile water, and the like. Meanwhile, the ingredients included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve product stability by lowering the degree of freedom of the included ingredients. In order to manufacture such a dried form, it is necessary to apply a drying step, and at this time, heated drying, natural drying, vacuum drying, freeze drying, or a complex process thereof may be used.

In addition, the present invention is a type A avian influenza comprising the step of performing real-time RT-PCR using the nucleic acid isolated from the specimen as a template, using the primer set for detecting A type avian influenza, Newcastle disease and chicken infectious bronchitis virus of the present invention, It provides a method for detecting Newcastle disease and chicken infectious bronchitis virus.

The specimen may be obtained from a clinical sample or an environmental sample. For example, the clinical sample may be a sample obtained from tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.

The primer set may have the characteristics as described above. For example, the primer set may specifically amplify the matrix gene region of the Avian influenza virus type A, the matrix gene region of the Newcastle disease virus, and the spike glycoprotein 1 region of the chicken infectious bronchitis virus. In addition, the primer set may be 10 to 40 complementarily bindable to genes in the matrix gene region of the Avian influenza virus, the matrix gene region of the Newcastle disease virus, or the spike glycoprotein 1 region of the chicken infectious bronchitis virus, specifically 15. It may be a pair of forward and reverse primers consisting of to 30 base sequences. In an embodiment of the present invention, the primer set includes a first forward primer described in the nucleotide sequence of SEQ ID NO: 1; A second forward primer represented by the nucleotide sequence of SEQ ID NO: 4; A third forward primer represented by the nucleotide sequence of SEQ ID NO: 5; A fourth forward primer represented by the nucleotide sequence of SEQ ID NO: 10; A first reverse primer described by the nucleotide sequence of SEQ ID NO: 2; A second reverse primer represented by the nucleotide sequence of SEQ ID NO: 6; A third reverse primer represented by the nucleotide sequence of SEQ ID NO: 7; And a fourth reverse primer described in the nucleotide sequence of SEQ ID NO: 11.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Manufacture of primers and probes for detection of type A avian influenza, Newcastle disease and chicken infectious bronchitis virus

After searching the gene sequences for each of the avian influenza A, Newcastle disease and chicken infectious bronchitis viruses at the National Center for Biological Information (NCBI, https://www.ncbi.nlm.nih.gov/), the sequences were aligned. Thus, a database of 1500, 390 and 480 nucleotide sequences was obtained for each virus. By performing multi-alignment using the nucleotide sequence for each virus, primers and probes were designed and manufactured in a conserved region (Table 1). The prepared probes (SEQ ID NOs: 3, 8, 9, and 12) were 97.7%, 96%, and 96% for each of type A avian influenza, Newcastle disease and chicken infectious bronchitis viruses when sequence alignment was performed on the collected entire database. The detection rate was shown.

virus Primer or
Probe Sequence (5'→3') Target Sequence number Avian influenza virus type A Influenza A F AAT CCT GTC ACC TCT GAC TAA GG matrix
(matrix)
gene One Influenza A R CAT TYT GGA CAA AKC GTC TAC G 2 Influenza A probe
(FAM, MGBNFQ) TGC AGT CCT CGC TCA C 3 Newcastle disease virus NDV F1 AGTGATGTGCTCGGACCYTC matrix
gene 4 NDV F2 AGYGATGTACTTGGGCCATC 5 NDV R1 CCTGRGGAGAGGCATTTGCTA 6 NDV R2 CCTGAGGGGATGCATTGGCAA 7 NDV 1 probe
(VIC, MGBNFQ) TTCTCTAGCAGTGGGACAG 8 NDV 2 probe
(VIC, MGBNFQ) TTCTCAAGCAGCGGAAC 9 Chicken Infectious Bronchitis Virus IBV F1 AAT TAA GCA AGA CTT TTG AAT GTG G spike
Spike glycoprotein 1 gene 10 IBV R1 CCT ACT CTG CCA TAT ATA TTA TAG TCA ACA C 11 IBV probe
(Cy5, BHQ) GRT TTA TGT TAC TAA GAG YGA TGG CTC TCG T 12

Experimental Example 1. Identification of Avian Influenza Avian Influenza, Newcastle Disease and Chicken Infectious Bronchitis Virus Differentiation Ability Using the Primer and Probe Set of the Present Invention

Multiple real-time RT-PCR was performed using the primer and probe set prepared in Example 1 to determine whether or not it was possible to differentiate and detect type A avian influenza, Newcastle disease, and chicken infectious bronchitis viruses.

Specifically, each RNA sample of type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus was obtained from Konkuk University's Industry-Academic Cooperation Foundation (Korea). Using the RNA samples, a real-time PCR instrument (ABI7500; Applied Biosystems 7500 Real-Time PCR Instrument System, Applied Biosystems, according to the primer and probe concentrations shown in Table 2, the reaction composition shown in Table 3, and the reaction conditions shown in Table 4). USA) was used to perform RT-PCR and analyzed using detection software (ABI Version 2.3, USA).

virus Primer or probe Concentration used (nM) Avian influenza virus type A Influenza A F 250 Influenza A R 250 Influenza A probe 100 Newcastle disease virus NDV F1 250 NDV F2 250 NDV R1 250 NDV R2 250 NDV 1 probe 100 NDV 2 probe 100 Chicken Infectious Bronchitis Virus IBV F 250 IBV R 250 IBV probe 200

Reaction composition Usage amount (µl) 4× RT buffer ^a 5 Primer and Probe Mix 4 Sterile distilled water 6 Template RNA sample 5 Sum 20

^a 4× RT buffer: Kogen Biotech (Korea)

Temperature(℃) time Number of cycles 50 30 minutes One 95 10 minutes One 95 15 seconds 40 60 1 min

As a result, when performing multiple real-time RT-PCR using the primer and probe set of the present invention, it was confirmed that type A avian influenza, Newcastle disease, and chicken infectious bronchitis virus can be discriminated and detected (FIG. 1).

Experimental Example 2. Identification of the analytical specificity of multiple real-time RT-PCR using the primer and probe set of the present invention

The analytical specificity of the multiple real-time RT-PCR using the primers and probe sets of the present invention was determined by RNA samples from Avian influenza, Newcastle disease and chicken infectious bronchitis viruses (Table 5), RNA samples from 5 viruses, 15 bacteria and 6 It was confirmed by the detection of a gDNA (genomic DNA) sample (Table 6) of a species healthy animal.

Specifically, multiple real-time RT-PCR was performed in the same manner as described in Experimental Example 1, except that the samples shown in Tables 5 and 6 were used as a template.

number Classification name number Classification name One Avian influenza virus type A H1N3 19 Chicken infectious
bronchitis
virus Avian infectious bronchitis virus (No. 1) 2 H2N1 20 Avian infectious bronchitis virus (No. 2) 3 H2N5 21 Avian infectious bronchitis virus (No. 3) 4 H3N2 22 Avian infectious bronchitis virus (No. 4) 5 H3N8 23 Avian infectious bronchitis virus (No. 5) 6 H4N6 24 Avian infectious bronchitis virus (No. 6) 7 H5N1 25 Avian infectious bronchitis virus (No. 7) 8 H5N2 26 Avian infectious bronchitis virus (No. 8) 9 H5N3 27 Avian infectious bronchitis virus (No. 9) 10 H5N9 28 Avian infectious bronchitis virus (No. 10) 11 H6N2 29 Avian infectious bronchitis virus (No. 11) 12 H9N2 30 Avian infectious bronchitis virus (No. 12) 13 H12N5 31 Avian infectious bronchitis virus (No. 13) 14 Newcastle disease virus Newcastle disease virus (No. 1) 32 Avian infectious bronchitis virus (No. 14) 15 Newcastle disease virus (No. 2) 33 Avian infectious bronchitis virus (No. 15) 16 Newcastle disease virus (No. 3) 34 Avian infectious bronchitis virus (No. 16) 17 Newcastle disease virus (No. 4) 18 Newcastle disease virus (No. 5)

All of the above RNA samples were obtained from Konkuk University's Industry-Academic Cooperation Foundation (Korea).

number name Where to get it virus One Parainfluenza virus-1 Vircell M037 2 Parainfluenza virus-2 Vircell M038 3 Parainfluenza virus-3 Vircell M039 4 Respiratory syncytial virus A Vircell M041 5 Respiratory syncytial virus B Vircell M083 bacteria One Bacillus cereus ^a ATCC 9634 2 Campylobacter jejuni ATCC 33250 3 Escherichia coli ATCC 25922 4 Listeria monocytogenes ATCC 19113 5 Salmonella enteritidis ATCC 19214 6 Salmonella typhi ATCC 19214 7 Salmonella typhimurium ATCC 29629 8 Shigella sonnei ATCC 9290 9 Staphylococcus aureus ATCC 23235 10 Vibrio vulnificus ATCC 27562 11 Yersinia enterocolitica ATCC 9610 12 Legionella pneumophila ATCC 33152 13 Mycoplasma pneumoniae ATCC 15531 14 Mycoplasma gallisepticum ATCC® qCRM-19610D 15 Mycoplasma synoviae ATCC® qCRM-25204D Animal species One Human Konkuk University Industry-Academic Cooperation Foundation
(Republic of Korea) 2 Cow 3 Porcine 4 Chicken 5 Duck 6 Turkey

^a ATCC: American Type Culture Collection

As a result, all of the Avian influenza A, Newcastle disease and chicken infectious bronchitis viruses in Table 5 were detected by the primer and probe set of the present invention, but no amplification reactions were detected in the virus, bacteria and healthy animal samples in Table 6. This suggests that the primer and probe set of the present invention can specifically detect only type A avian influenza, Newcastle disease and chicken infectious bronchitis viruses.

Experimental Example 3. Confirmation of the analytical sensitivity of multiple real-time RT-PCR using the primer and probe set of the present invention

The analytical sensitivity of multiple real-time RT-PCR using the primers and probe sets of the present invention was confirmed using RNA samples of type A avian influenza, Newcastle disease and chicken infectious bronchitis virus diluted by concentration.

3-1. Preparation of Avian Influenza, Newcastle Disease and Chicken Infectious Bronchitis Virus Samples

Each viral nucleotide sequence information of the site containing the sequence of the primer and probe set of the present invention described in Table 1 was collected from NCBI, and an oligomer was synthesized by requesting an oligomer synthesis company. Using the synthesized oligomers as a template, a single real-time RT-PCR was performed for each virus in the same manner as described in Experimental Example 1 above. Each PCR product was purified using a PCR purification kit (QIAquick PCR Purification Kit, Qiagen, Germany). After preparing a plasmid in which the PCR product of each purified virus was ligated to a pGEM T vector (pGEM T Vector System I, Promega, USA), it was transformed into a soluble cell (MAX Efficiency DH5a Competent Cell, Invitrogen, USA). ). Then, each plasmid DNA was isolated using a kit (QIAprep Spin Miniprep kit, Qiagen). The plasmid DNA and transcription kit (MAXIscipt ^TM T7 Transcription Kit, Thermo Fisher Scientific, USA) were used to perform in vitro transcription to obtain synthesized RNA. Each RNA sample was quantified using a spectrophotometer, and the number of RNA copies was calculated using Equations 1 and 2:

[Equation 1]

Number of moles of ssRNA (mol) = weight of ssRNA (g) / {(length of ssRNA (nt) × 321.47 g/mol) + 18.02 g/mol}

[Equation 2]

RNA copy number = number of moles of ssRNA × 6.022 × 10 ²³ pieces/mol.

3-2. Confirmation of the analytical sensitivity of multiple real-time RT-PCR using the primer and probe set of the present invention

The RNA samples of each Avian influenza, Newcastle disease and chicken infectious bronchitis virus obtained in Experimental Example 3-1 were respectively 13 × 10 ⁵ copies/reaction, 18 × 10 ⁵ copies/reaction, and 19 × 10 ⁴ copies/reaction. It was quantified and diluted in stages by 10 times each, and multiplexed by the same method as described in Experimental Example 1, except that the Avian influenza A and Newcastle disease virus samples were used at 7 concentrations, and the chicken infectious bronchitis virus samples were used at 6 concentrations. Real-time RT-PCR was performed.

As a result, the primer and probe set of the present invention detected avian influenza A, Newcastle disease, and chicken infectious bronchitis viruses up to 13 copies/reaction, 18 copies/reaction, and 19 copies/reaction, respectively (FIGS. 2 to 4).

Experimental Example 4. Excellent detection efficiency of RT-PCR using the primer and probe set of the present invention compared to the known primer set (1)

In order to confirm the excellence of the analytical sensitivity of real-time RT-PCR using the primer and probe set of the present invention, the primer and probe set of the present invention, the commercially available Avian influenza virus detection primer set, and the known Newcastle disease virus and chicken infectiousness RT-PCR was performed using a primer set for detecting bronchitis virus (Standard Diagnosis of Animal Disease, Vol.2. Ministry of Agriculture, Forestry and Livestock Quarantine, 2017).

4-1. Comparison with primer set for detection of avian influenza A virus

Multiple real-time RT-PCR was performed in the same manner as described in Experimental Example 1, except that the avian influenza Avian influenza virus-positive RNA sample No. 1 in Table 5 was diluted in steps of 10 and used at 5 concentrations. In addition, except for using the same RNA sample and a commercialized primer set (PowerChek ^TM Avian Influenza Real-time PCR Kit series M gene, Cat. No. VR2101, KOGENEBIOTECH CO. LTD., Korea) described in Experimental Example 1 Real-time RT-PCR was performed in the same way as that.

As a result, it was confirmed that the primer and probe set of the present invention detects a type A avian influenza virus sample up to the concentration diluted by 5 steps, while the commercially available primer set detects up to the concentration diluted by 4 steps (Fig. This suggests that the real-time RT-PCR using the primer and probe set of the present invention has superior analytical sensitivity compared to the real-time RT-PCR using a commercially available primer set.

4-2. Comparison with primer set for detection of Newcastle disease virus

Multiple real-time RT-PCR was performed in the same manner as described in Experimental Example 1, except that the No. 14 Newcastle disease virus-positive RNA sample of Table 5 was diluted in steps of 10 times and used at 5 concentrations. In addition, RT-PCR using the same RNA sample and a known primer set was performed under the reaction conditions shown in Table 8 using the primers shown in Table 7 below. The reaction composition was 4 × RT buffer (Kogen Biotech) 5 µl, 1 µl (250 nM) each of the primer pairs shown in Table 7 below, 8 µl of sterile distilled water, and 5 µl of a template RNA sample were mixed to make a total volume of 20 µl, ^{SimpliAmp TM} Thermal Cycler (Applied Biosystems, USA) was used as a PCR instrument. The PCR amplification product was prepared on ^{a 2% agarose gel containing nucleic acid staining reagent (RedSafe TM} Nucleic Acid Staining Solution), Tris-acetate buffer, and standard-DNA markers. The band was detected by electrophoresis at 100 V for 30 minutes.

Primer name Sequence (5'→3') Target gene Amplification product size (bp) Sequence number NDCom-F ATACACCTCRTCYCAGACAG F protein 379 13 NDCom-R TGCCACTGMTAGTTGYGATA 14

Classification Temperature(℃) time Number of cycles RT cDNA synthesis 45 30 minutes One Pre-denaturation 94 5 minutes One PCR Denaturation 94 20 seconds 40 Annealing 50 30 seconds Extension 72 30 seconds Final height 72 5 minutes One

As a result, it was confirmed that the primer and probe set of the present invention detects a Newcastle disease virus sample to a concentration diluted by 4 steps, while a known primer set detects a concentration diluted by a 2 step (FIG. 6). This suggests that the real-time RT-PCR using the primer and probe set of the present invention has better analytical sensitivity than the real-time RT-PCR using a known primer set.

4-3. Comparison with primer set for detection of chicken infectious bronchitis virus

Multiple real-time RT-PCR was performed in the same manner as described in Experimental Example 1, except that the chicken infectious bronchitis virus-positive RNA sample of Table 5 was diluted 10 times and used at 5 concentrations. In addition, RT-PCR using the same RNA sample and a known primer set was performed in the same manner as described in Experimental Example 4-2, except that the reaction conditions of Table 10 were applied using the primers of Table 9 below.

Primer name Sequence (5'→3') Target gene Amplification products
Size (bp) Sequence number IBV F AGC AAC GCC AGT TGT TAA TTT G ORF1b and Spike genes 750 ~ 790 15 IBV R CWG TAC CAT TAA CAA ART AAG CMA G 16

Classification Temperature(℃) time Number of cycles RT cDNA synthesis 50 30 minutes One Pre-denaturation 95 15 minutes One PCR denaturalization 94 1 min 35 Annealing 52 1 min kidney 72 1 minute 30 seconds Final height 72 10 minutes One

As a result, it was confirmed that the primer and probe set of the present invention detects chicken infectious bronchitis virus samples up to a concentration diluted by 5 steps, while a known primer set detects up to a concentration diluted by 4 steps (FIG. 7). This suggests that the real-time RT-PCR using the primer and probe set of the present invention has better analytical sensitivity than the real-time RT-PCR using a known primer set.

Experimental Example 5. Excellent detection efficiency of RT-PCR using the primer and probe set of the present invention compared to the known primer set (2)

To confirm the excellence of multiple real-time RT-PCR detection efficiency using the primer and probe set of the present invention, the primer and probe set of the present invention, and a known primer set (Thanh Trung Nguyen et al. , Journal of Virological Methods, 188: 41-46, 2013) of Avian influenza, Newcastle disease, and chicken infectious bronchitis viruses were compared and analyzed for the theoretical detectability and RT-PCR detection efficiency.

5-1. Comparison of the theoretical detectability of the primers and probe sets of the present invention, and known primer sets for avian influenza A, Newcastle disease and chicken infectious bronchitis viruses

By investigating the ratio of the nucleotide sequence of the primer and probe set of the present invention and the nucleotide sequence of the known primer set to the nucleotide sequence of the target site for each virus, the theoretical detectability of the virus was compared and analyzed.

5-1-1. Comparison of theoretical detectability for avian influenza A virus

After selecting one representative nucleotide sequence among the matrix genes of the Avian influenza virus type (accession No. KX297769), and selecting one representative nucleotide sequence among the nucleoprotein genes (accession No. KX297801), each Representative nucleotide sequences were blasted in NCBI to collect nucleotide sequences of 60 related genes. The base sequence of 60 kinds of matrix genes of avian influenza A virus collected using Genius 10.0.7 software and the primers and probe sets of the present invention (Table 1, SEQ ID NOs: 1 to 3) The match rate between the base sequences was investigated, and the match rate between the base sequences of 60 kinds of the nuclear protein genes of the collected Avian influenza virus and the base sequences of the known primer sets (Table 11, SEQ ID NOs: 17 and 18) was investigated.

Primer name Sequence (5'→3') Target gene Amplification products
Size (bp) Sequence number AIV F1 (GTCTACCAGGCATTCGCTT) ^* CAATGGTTGGTGGAATTGGAA Nuclear protein gene 665 17 AIV R1 (TGGGTGACTCAATTCTGCTG) ^* TTTCAGCATTCCCAGGATTC 18 NDV F1 (GTCTACCAGGCATTCGCTT) ^* CTTCTACCAGGATCCCAGCAC Fusion protein gene 386 19 NDV R1 (TGGGTGACTCAATTCTGCTG) ^* ATGCCTCTAATGGGGCTTTT 20 IBV F1 (GTCTACCAGGCATTCGCTT) ^* CCAGGAYCAGCARAAGAAGG Nucleocapsid protein gene 236 21 IBV R1 (TGGGTGACTCAATTCTGCTG) ^* TTGGACGTGTVCCTACACCA 22 Common-F (GTCTACCAGGCATTCGCTTC) ^* 23 Common-R (TGGGTGACTCAATTCTGCTG) ^* 24

^* This is a common sequence for secondary PCR that is not a virus-specific sequence, and is excluded from the subject of theoretical detectability analysis.

As a result, the primer and probe sets for detecting avian influenza A virus of the present invention (SEQ ID NOs: 1 to 3) showed 100% nucleotide sequence matching with the target gene, whereas known primer sets (SEQ ID NOs: 17 and 18) Showed that the nucleotide sequence matching rate with the target gene was 90 to 100% (FIGS. 8, 9, and 12). This suggests that the primer and probe set of the present invention has a higher theoretical detectability for the detection of avian influenza A virus compared to the known primer set.

5-1-2. Comparison of theoretical detectability for Newcastle disease virus

One representative nucleotide sequence was selected from the complete genome of the Newcastle disease virus (accession No. DQ485229), and the nucleotide sequences of 50 related genes were collected by blasting it in NCBI. The nucleotide sequence of 50 Newcastle disease virus genes collected using Genius 10.0.7 software and the nucleotide sequence of the primer and probe set of the present invention (Table 1, SEQ ID NOs: 4, 6 and 8) were investigated, and the collected Newcastle disease The match rate between the nucleotide sequences of 50 viral genes and the nucleotide sequences of the known primer sets (Table 11, SEQ ID NOs: 19 and 20) was investigated.

As a result, the primer and probe sets for detecting Newcastle disease virus of the present invention (SEQ ID NOs: 4, 6 and 8) showed 100% nucleotide sequence matching with the target gene, whereas known primer sets (SEQ ID NOs: 19 and 20) The nucleotide sequence matching rate with the target gene was found to be 85 to 100% (FIG. 10 and Table 13). This suggests that the primer and probe set of the present invention has a higher theoretical detectability for Newcastle disease virus detection compared to the known primer set.

5-1-3. Comparison of theoretical detectability of chicken infectious bronchitis virus

After selecting one representative nucleotide sequence among the spike glycoprotein 1 genes of chicken infectious bronchitis virus (accession No. KY421672), and selecting one representative nucleotide sequence among the nucleocapsid protein genes ( accession No. KY421672), each representative nucleotide sequence was blasted in NCBI to collect nucleotide sequences of 60 related genes. The nucleotide sequence of 60 kinds of chicken infectious bronchitis virus genes collected using Genius 10.0.7 software and the nucleotide sequence of the primer and probe set of the present invention (Table 1, SEQ ID NOs: 9 to 12) were investigated, and the collected chickens The match rate between the base sequences of 60 kinds of infectious bronchitis virus genes and the base sequences of the known primer sets (Table 11, SEQ ID NOs: 21 and 22) was investigated.

As a result, the primer and probe sets for detecting chicken infectious bronchitis virus of the present invention (SEQ ID NOs: 9 to 12) showed a nucleotide sequence matching rate of 94 to 100% with the target gene, whereas known primer sets (SEQ ID NOs: 21 and 22 ) Showed that the nucleotide sequence matching rate with the target gene was 84 to 100% (Fig. 11, Fig. 12 and Table 14). This suggests that the primer and probe set of the present invention has a higher theoretical detectability for chicken infectious bronchitis virus detection compared to the known primer set.

5-2. Comparison of RT-PCR detection efficiency for avian influenza A, Newcastle disease and chicken infectious bronchitis virus of the primer and probe set of the present invention, and the known primer set

By comparing and analyzing the analytical sensitivity of RT-PCR using the primer and probe set of the present invention, and the known primer set, the detection efficiency of Avian influenza type A, Newcastle disease and chicken infectious bronchitis virus was compared.

5-2-1. Multiple real-time RT-PCR results using the primer and probe set of the present invention

Multiple real-time RT-PCR using the primer and probe set of the present invention was performed in the same manner as described in Experimental Example 1, except that the sample of Table 15 below was used as a template RNA sample.

As a result, the primers and probes of the present invention classified A-type avian influenza, Newcastle disease, and chicken infectious bronchitis viruses to detect all of the target samples without non-specific amplification (FIG. 13 and Table 16).

5-2-2. Nested RT-PCR results using known primer sets

First, cDNA was synthesized by reverse transcription of the RNA samples in Table 15 using an RT-&GO ^{TM kit (Qbiogene, Korea).} 1 µl of the cDNA, 4 µl of 2 x magnesium chloride-free PCR buffer (2 x MgCl ₂ -free PCR buffer), 2 µl of 2.5 mM magnesium chloride, 1.6 µl of 0.8 mM/µl dNTP, 500 nM primers (Table 11, SEQ ID NO: 17 to 22) 0.5 µl and 0.5 µl of 2.5 U-tag DNA polymerase (Taq DNA polymerase, iNtRON Biotechnology, Korea) were mixed, and distilled water was further added to make a total of 20 µl. Using the reaction mixture and a PCR device (C1000 Touch ^TM Thermal Cycler, Bio-Rad, USA), the first PCR was performed under the reaction conditions shown in Table 17.

Temperature(℃) time Number of cycles 94 5 minutes One 94 30 seconds 35 53 30 seconds 72 1 min 72 8 minutes One 4 holding

0.5 µl of the PCR product and 1 µl of each primer (Table 11, SEQ ID NO: 23 and 24) of 500 nM were mixed, and a PCR kit (Maxime ^TM PCR PreMix Kit, iNtRON Biotechnology) was used in Table 18 according to the manufacturer's instructions. Secondary PCR was performed as reaction conditions.

Temperature(℃) time Number of cycles 94 5 minutes One 94 30 seconds 30 55 30 seconds 72 40 seconds 72 8 minutes One 4 holding

The final PCR product was placed on a 1.5% agarose gel containing nucleic acid staining reagent (RedSafe ^TM Nucleic Acid Staining Solution), Tris-acetate buffer, and standard-DNA markers. Electrophoresis was performed at 100 V for 30 minutes and pictures were taken (Gel Doc XR, Gel Documentation System, Bio-Rad).

As a result, the known primer set was amplified in both primary and secondary PCR among a total of 20 samples of avian influenza A, Newcastle disease, and chicken infectious bronchitis virus, and only 6 samples were detected (Fig. 14 and Table 19). . In addition, the known primer set showed a number of non-specific amplification bands in addition to the target virus (Fig. 15).

From the above Experimental Examples 5-2-1 and 5-2-2, it can be seen that the primer and probe set of the present invention exhibits better detection efficiency than the known primer sets in the detection of type A avian influenza, Newcastle disease and chicken infectious bronchitis viruses. have.

<110> KoGene BioTech Co., LTD. <120> Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same <130> 2018P-12-020 <150> KR 10-2018-0145082 <151> 2018-11-22 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Influenza A F <400> 1 aatcctgtca cctctgacta agg 23 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Influenza A R <400> 2 cattytggac aaakcgtcta cg 22 <210> 3 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Influenza A probe <400> 3 tgcagtcctc gctcac 16 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDV F1 <400> 4 agtgatgtgc tcggaccytc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDV F2 <400> 5 agygatgtac ttgggccatc 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NDV R1 <400> 6 cctgrggaga ggcatttgct a 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NDV R2 <400> 7 cctgagggga tgcattggca a 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NDV 1 probe <400> 8 ttctctagca gtgggacag 19 <210> 9 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> NDV 2 probe <400> 9 ttctcaagca gcggaac 17 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IBV F1 <400> 10 aattaagcaa gacttttgaa tgtgg 25 <210> 11 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> IBV R1 <400> 11 cctactctgc catatatatt atagtcaaca c 31 <210> 12 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> IBV probe <400> 12 grtttatgtt actaagagyg atggctctcg t 31 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDCom-F <400> 13 atacacctcr tcycagacag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDCom-R <400> 14 tgccactgmt agttgygata 20 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IBV F <400> 15 agcaacgcca gttgttaatt tg 22 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IBV R <400> 16 cwgtaccatt aacaaartaa gcmag 25 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> AIV F1 <400> 17 gtctaccagg cattcgcttc aatggttggt ggaattggaa 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> AIV R1 <400> 18 tgggtgactc aattctgctg tttcagcatt cccaggattc 40 <210> 19 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> NDV F1 <400> 19 gtctaccagg cattcgcttc ttctaccagg atcccagcac 40 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> NDV R1 <400> 20 tgggtgactc aattctgctg atgcctctaa tggggctttt 40 <210> 21 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> IBV F1 <400> 21 gtctaccagg cattcgcttc caggaycagc araagaagg 39 <210> 22 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IBV R1 <400> 22 tgggtgactc aattctgctg ttggacgtgt vcctacacca 40 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Common-F <400> 23 gtctaccagg cattcgcttc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Common-R <400> 24 tgggtgactc aattctgctg 20

Claims (6)

A first forward primer described by the nucleotide sequence of SEQ ID NO: 1;
A second forward primer represented by the nucleotide sequence of SEQ ID NO: 4;
A third forward primer represented by the nucleotide sequence of SEQ ID NO: 5;
A fourth forward primer represented by the nucleotide sequence of SEQ ID NO: 10;
A first reverse primer described by the nucleotide sequence of SEQ ID NO: 2;
A second reverse primer represented by the nucleotide sequence of SEQ ID NO: 6;
A third reverse primer represented by the nucleotide sequence of SEQ ID NO: 7;
A fourth reverse primer described by the nucleotide sequence of SEQ ID NO: 11; And
A composition for detecting avian influenza Avian influenza, Newcastle disease and chicken infectious bronchitis virus consisting of probes respectively described with the base sequences of SEQ ID NOs: 3, 8, 9 and 12.
delete delete A kit for detecting avian influenza A, Newcastle disease and chicken infectious bronchitis virus comprising the composition of claim 1.
A type comprising the step of performing a multiplex real-time reverse transcription polymerase chain reaction (RT-PCR) using the composition of claim 1 using the nucleic acid isolated from the sample as a template Avian influenza, Newcastle disease and chicken infectious bronchitis virus detection method.
The method of claim 5, wherein the specimen is obtained from clinical or environmental samples, Avian influenza type A, Newcastle disease and chicken infectious bronchitis virus detection method.

Images