CN108411013A

CN108411013A - Probe combinations for the detection of mastitis for milk cows pathogen fast typing

Info

Publication number: CN108411013A
Application number: CN201810326054.5A
Authority: CN
Inventors: 张菁华; 黄超杰; 唐爱发; 吴诚龙; 王翰; 杨刚; 钟远堂
Original assignee: Shenzhen Second Peoples Hospital
Current assignee: Shenzhen Second Peoples Hospital
Priority date: 2018-04-12
Filing date: 2018-04-12
Publication date: 2018-08-17

Abstract

The invention discloses a kind of probe combinations for the detection of mastitis for milk cows pathogen fast typing, including：Oligonucleotide probe for detecting pathogenic bacteria, sequence such as SEQ ID NO:Shown in 3；Oligonucleotide probe for detecting pathogenic fungus, sequence such as SEQ ID NO:Shown in 6；Oligonucleotide probe for detecting pathogenic mycoplasma, sequence such as SEQ ID NO:Shown in 9.The present invention can use multiple real time fluorescence round pcr, it is directed to bacillary pathogenic bacteria, fungoid pathogenic bacteria, Mycoplasma pathogenic bacteria and separately designs universal primer and probe, it includes and causes all relevant pathogenic bacteria types of mastitis for milk cows, it may be implemented to carry out quick type parting to mastitis for milk cows pathogenic microorganism, it is precisely detected for the later stage and data supporting is provided, can be used for early screening and molecule epidemic disease-ology research, relevant disease prevention of mastitis for milk cows etc..

Description

Probe combinations for the detection of mastitis for milk cows pathogen fast typing

Technical field

The invention belongs to beyond body nucleic acid detection fields, are examined based on multiple fluorescence PCR method fast typing more particularly, to one kind Survey the probe combinations and kit of mastitis for milk cows pathogen.

Background technology

China is a large agricultural country while being also an Animal husbandry production big country, however, China milk industry it is horizontal and other Compared to also very backward, in modernization of livestock farming country, the ratio that the milk industry output value accounts for the animal husbandry output value is relatively high, beautiful for developed country State is 23%, and Japan is 25%, and France, Britain and Germany are all 30%~40%, and the current milk industry output value in China only accounts for poultry The 5% of the animal husbandry output value illustrates China milk industry still in a developing stage.Amount of livestock on hand reaches 1460 at the end of China milk cows in 2014 Ten thousand.

Mastitis for milk cows is to endanger one of the principal disease of world's milk cow production, and cause the maximum disease of economic loss Disease, while being also a global problem, according to the statistics of international milk cow federation, the incidence of milk cow clinic mastitis It is 2%, recessive mastitis illness rate is 50%, shows that the incidence of the milk cow clinic mastitis in China is up to 5% according to investigations, Recessive mastitis illness rate is 50%-70%.

Mastitis for milk cows has many harm, and first, cause the loss of milk yield, it includes that i.e. Ankang milk cow exists to have investigation display Interior is the 7.65% of total output of milk through producing average loss of the cows caused by recessive mastitis, every recessive mastitis milk cow Average daily production reduces 3.7kg；The second, influence fresh milk composition and quality of dairy products, after mammitis occurs for milk cow, fresh milk at Significant changes occur for branch, and nutrition and edible value are remarkably decreased, lactose, butterfat and calcium etc. in the fresh milk of mammitis milk cow Nutritional ingredient declines up to 50% or more；Third increases cows replacement cost, because mammitis causes milk cow to be eliminated in advance, increasing Add the cultivation cycle of milk cow；4th, increase veterinary treatment and management cost；5th, the health of the mankind, cow breast are threatened Inflammation mainly occurred by cause pathogeny imcrobe infection, if milk sterilize in process it is unqualified, will be to people's Body causes prodigious injury, such as staphylococcus aureus that can generate toxin, which can resist high gently dried, and one It is excessive containing staphylococcus aureus in denier milk, diarrhea, vomiting of people etc. will be caused.

The reason of causing mastitis for milk cows has very much, but mainly caused by cause pathogeny imcrobe infection, while also with milk Ox oneself factor is related with environmental factor.Oneself has found that the pathogenic microorganism of mastitis for milk cows can be caused to include mainly thin at present Bacterium, mycoplasma, fungi, virus etc..Mastitis for milk cows pathogenic microorganism can be divided into contact by infection and microbial profile feature and pass The two major classes types such as metachromia pathogenic microorganism, environment pathogenic microorganism, wherein contagiousness pathogenic microorganism includes mainly golden yellow Color staphylococcus, Streptococcusagalactiae, Mycoplasma bovis, Corynebacterium bovis etc., they can be diffused into from infected area and be uninfected by area, and pass Other milk cows are contaminated, by milking machine, milker, the approach such as rag of breast can be cleaned between milk cow in milking operation Spreading and diffusion；Environmental pathogenic microorganism includes mainly Escherichia coli, Klebsiella, enterococcus spp, Prototheca, cement Serratieae, Arcanobacterium pyogenes, Proteus, candida albicans etc. are mainly derived from milk cow living environment, as bedding and padding, excrement, Dust, soil and feed etc., during milking interval, when nipple contacts the dirt on sludge, excrement and ox bed, this kind of cause of disease Bacterium is put into mammary gland, leads to breast infection.

Although most of cow breast infection is caused by a few bacterium, such as staphylococcus, streptococcus, large intestine Bacillus, Klebsiella and candida albicans etc. probably have more than 20 to plant, and recall rate accounts for 95%, but can cause mastitis for milk cows Microorganism about more than 220 is planted, and detection kit on the market cannot cover all pathogenic bacteria types well at present, make At the missing inspection of the clinical type and recessive mastitis milk cow of a part, such as Conventional bacteria medium therapy, not only the period is long, simultaneously will Nearly 40% pathogen can not grow on culture medium；Thormo fisher provide a kind of Pathproof mastadenitis of cow PCR Analysis system Complete-16 can detect the milk cow pathogen of 16 kinds of bacteriums simultaneously, and there are 5%~10% leakages Inspection rate, such testing result can not meet actually detected demand；Rich Austria's biology applied Publication No. CN107541567A, Entitled " LAMP primer composition for detecting 8 kinds of environment pathogens of mastitis for milk cows and its application " and Publication No. CN107541509A, entitled " LAMP primer composition for detecting 6 kinds of infectious agents of mastitis for milk cows and its application " Application for a patent for invention, common garget pathogenic bacteria are detected by the way of genetic chip, may be implemented it is live quickly Detection, but 14 kinds of pathogenic bacteria can only be covered, equally exist the risk of missing inspection, the Publication No. of Ningxia University CN104328167A, entitled the genetic chip and detection method of " can ten kinds of main pathogenic bacterias of parallel detection mastitis for milk cows " Application for a patent for invention uses rich chip technology difficult to understand that can detect 10 kinds of common pathogenic bacteria simultaneously, but the patented product is deposited The missing inspection the case where, the treatment that the later stage suffers from mammitis milk cow is influenced.

Invention content

The present invention provides a kind of new kit for the detection of mastitis for milk cows pathogen fast typing.

The present invention provides a kind of probe combinations for the detection of mastitis for milk cows pathogen fast typing, including：For examining Survey the oligonucleotide probe of pathogenic bacteria, sequence such as SEQ ID NO:Shown in 3；Few nucleosides for detecting pathogenic fungus Acid probe, sequence such as SEQ ID NO:Shown in 6；Oligonucleotide probe for detecting pathogenic mycoplasma, sequence such as SEQ ID NO:Shown in 9.

A kind of primer combination of probe for the detection of mastitis for milk cows pathogen fast typing, including：

Sequence such as SEQ ID NO for the forward primer for detecting pathogenic bacteria:1 shown, reverse primer sequence is such as SEQ ID NO:2 shown, oligonucleotide probe sequence such as SEQ ID NO:Shown in 3；

Sequence such as SEQ ID NO for the forward primer for detecting pathogenic fungus:4 shown, reverse primer sequences are such as SEQ ID NO:5 shown, oligonucleotide probe sequence such as SEQ ID NO:Shown in 6；

Sequence such as SEQ ID NO for the forward primer for detecting pathogenic mycoplasma:7 shown, reverse primer sequences Such as SEQ ID NO:8 shown, oligonucleotide probe sequence such as SEQ ID NO:Shown in 9.

The derived sequence of above-mentioned primer and probe is also protection scope of the present invention, and the derived sequence includes primer sequence Complementary strand sequence, while one to ten base can also be extended to the ends 5' and 3' extreme directions or delete one to ten base and obtained Sequence.

The primer combination of probe further includes the sequence such as SEQ ID as interior target milk cow specific forward primer NO:10 shown, reverse primer sequence such as SEQ ID NO:11 shown, oligonucleotide probe sequence such as SEQ ID NO:12 institutes Show.

A kind of kit for the detection of mastitis for milk cows pathogen fast typing, including：

Oligonucleotide probe for detecting pathogenic bacteria, sequence such as SEQ ID NO:Shown in 3；

Oligonucleotide probe for detecting pathogenic fungus, sequence such as SEQ ID NO:Shown in 6；

Oligonucleotide probe for detecting pathogenic mycoplasma, sequence such as SEQ ID NO:Shown in 9.

The kit further includes：As interior target milk cow specific oligonucleotide probe, sequence such as SEQID NO: Shown in 12.

Above-mentioned oligonucleotide probe is fluorescence probe, and 5 ' ends are marked with fluorescent reporter group, and 3 ' ends are marked with fluorescence and quench Go out group.

Fluorescent reporter group can be selected from FAM, NEX, ROX, TET, TAMRA, JOE, VIC, CY3, CY5 or Texas Red； Fluorescent quenching group can be selected from BHQ, TAMRA, MGB, Eclipse, Dabcyl, Lowa Black^TMRQ or Lowa Black^TM FQ。

A kind of kit for the detection of mastitis for milk cows pathogen fast typing, including the mixing of Q-PCR reaction solutions, enzyme Liquid, positive quality control product and negative quality-control product, the Q-PCR reaction solutions contain the oligonucleotide probe.The enzyme mixation For thermal starting Taq archaeal dna polymerases and UDG enzyme mixations.The positive quality control product is special containing bacterium 16s rRNA are inserted into respectively Specific amplification region, fungi ITS specific amplifications region, Mycoplasma 16s rRNA specific amplifications region, milk cow 12s The pUC57 vector plasmid mixtures in rRNA specific amplifications region, wherein the general conservative region sequences of bacterium 16s rRNA are such as SEQ ID NO：Shown in 13, the general conservative region sequences of fungi ITS rRNA such as SEQ ID NO：Shown in 14, Mycoplasma The general conservative region sequences of 16srRNA such as SEQ ID NO：Shown in 15, milk cow 12s rRNA specific conservatives regional sequences such as SEQ ID NO：Shown in 16.The feminine gender quality-control product is sterile TE buffer.

A kind of genetic chip for the detection of mastitis for milk cows pathogen fast typing, including chip carrier and set on described The probe combinations of chip carrier, the probe combinations include：Oligonucleotide probe for detecting pathogenic bacteria, sequence is such as SEQ ID NO:Shown in 3；Oligonucleotide probe for detecting pathogenic fungus, sequence such as SEQ ID NO:Shown in 6；For Detect the oligonucleotide probe of pathogenic mycoplasma, sequence such as SEQ ID NO:Shown in 9.

The beneficial effects of the invention are as follows：Multiple real time fluorescence round pcr can be used, bacillary pathogenic bacteria, true are directed to Bacterium property pathogenic bacteria, Mycoplasma pathogenic bacteria separately design universal primer and probe, include and cause all related causes of mastitis for milk cows Germ type may be implemented to carry out quick type parting to mastitis for milk cows pathogenic microorganism, and for the later stage, precisely detection provides Data supporting can be used for early screening and molecule epidemic disease-ology research, relevant disease prevention of mastitis for milk cows etc..

Description of the drawings

Fig. 1 is the FAM channel linear experimental data knots of present embodiment pathogens from dairy cattle affected smastitis parting detecting reagent Fruit is schemed, wherein E1-E7 indicates a concentration of 1.0 × 10⁸CFU/mL、1.0×10⁷CFU/mL、1.0×10⁶CFU/mL、1.0× 10⁵CFU/mL、1.0×10⁴CFU/mL、1.0×10³CFU/mL、1.0×10²The Escherichia coli amplification curve of CFU/mL, each 3 Duplicate data, CK are negative quality-control product；It can illustrate the kit in the detection of bacterium 1.0 × 10 by the figure⁸CFU/ ML to 1.0 × 10²There is good linear relationship between CFU/mL；

Fig. 2 is the HEX channel linear experimental data knots of present embodiment pathogens from dairy cattle affected smastitis parting detecting reagent Fruit is schemed, wherein F1-F6 indicates a concentration of 1.0 × 10⁸CFU/mL、1.0×10⁷CFU/mL、1.0×10⁶CFU/mL、1.0× 10⁵CFU/mL、1.0×10⁴CFU/mL、1.0×10³The Candida albicans quality-control product amplification curve of copies/ml, each 3 repetitions Data, CK are negative quality-control product, can illustrate the kit in the detection of candida albicans 1.0 × 10 by the figure⁸CFU/mL To 1.0 × 10³There is good linear relationship between CFU/mL；

Fig. 3 is the ROX channel linear experimental data knots of present embodiment pathogens from dairy cattle affected smastitis parting detecting reagent Fruit is schemed, wherein M1-M6 indicates 1.0 × 10⁸copies/mL、1.0×10⁷copies/mL、1.0×10⁶copies/mL、1.0× 10⁵copies/mL、1.0×10⁴copies/mL、1.0×10³The milk Mycoplasma bovis quality-control product amplification curve of copies/mL, each 3 A duplicate data, CK are negative quality-control product, by the figure can illustrate the kit in the detection of Mycoplasma 1.0 × 10⁸Copies/mL to 1.0 × 10³There is good linear relationship between copies/mL；

Fig. 4 is the channels the Cy5 reagent milk sample number of present embodiment pathogens from dairy cattle affected smastitis parting detecting reagent According to result figure, wherein N1-N5 is respectively the amplification curve of the milk sample of 5 parts of separate sources, each 1 duplicate data, and PC is sun Property quality-control product, CK is negative quality-control product, can illustrate be used as internal standard using milk cow 12s rRNA and supervising for the kit by the figure Control can meet kit Quality Control demand；

Fig. 5 is the channels the FAM Precision Experiment data of present embodiment pathogens from dairy cattle affected smastitis parting detecting reagent Result figure, wherein CK represents negative quality-control product, and wherein precision reference material J1 is a concentration of 5.0 × 10⁷The large intestine bar of CFU/mL Bacterium bacteria liquid sample, precision reference material J2 are a concentration of 5.0 × 10³The Escherichia coli bacteria liquid sample of CFU/mL, each 10 repetitions Data, CV%≤5% illustrate that the kit precision is good；

Fig. 6 is the specificity experiments data result figure of new anomaly high-pathogenicity porcine reproductive and respiratory syndrome virus detection kit, In, CK represents negative quality-control product, and specific reference material is respectively Escherichia coli, staphylococcus aureus, Streptococcusagalactiae, excrement intestines Coccus, Friedlander's bacillus, proteus mirabilis, salmonella, Candida albicans, the 8 species specificity reference material have allusion quotation " S " type amplification curve of type illustrates that kit specificity is good.

Specific implementation mode

Below by specific implementation mode combination attached drawing, invention is further described in detail.

The present invention is a kind of to realize that fast typing detects mastitis for milk cows pathogenic microorganism class with multiple real time fluorescence round pcr The upstream and downstream primer and fluorescence probe of type combine, and establish kit for detecting nucleic acid based on the primer and fluorescence probe combination, should Detection kit quick and precisely can carry out preliminary parting by the pathogenic bacteria in the milk cow milk sample to suffering from garget, in order to Follow-up precisely detection, while avoiding the generation of missing inspection.

The present invention separately designs a pair of universal primer for pathogenic bacteria, pathogenic fungus, pathogenic mycoplasma And fluorescence probe.

General positive, reverse primer and fluorescence probe sequence for pathogenic bacteria are respectively：

Forward primer：5'-GAAGTCGGAATCGCTAGTAATCG-3'(SEQ ID NO：1)

Reverse primer：5'-GTGTGACGGGCGGTGTGT-3'(SEQ ID NO：2)

Oligonucleotide probe：5'-CGGTGAATACGTTCCCGGGCCTTGT-3'(SEQ ID NO：3)；

General positive, reverse primer and fluorescence probe sequence for principal causative fungi are respectively：

Forward primer：5'-ACTCTCAACGACGGATGTCTAGG-3'(SEQ ID NO：4)

Reverse primer：5'-GCAATTCACACTACGTATCGCA-3'(SEQ ID NO：5)

Oligonucleotide probe：5'-TTCGCTGCGTTCTTCATCGATGC-3'(SEQ ID NO：6)；

General positive, reverse primer and fluorescence probe sequence for Common Pathogenic mycoplasma are respectively：

Forward primer：5'-TCCTACGGGAGGCAGCAGT-3'(SEQ ID NO：7)

Reverse primer：5'-CCCTAACYACAGCASTTTACA-3'(SEQ ID NO：8)

Oligonucleotide probe：5'-TGGAGCGACACAGCGTGCAGGATGA-3'(SEQ ID NO：9)；

3 ' ends of above-mentioned fluorescence probe are marked with fluorescent quenching group, and 5 ' ends are marked with different fluorescence report bases respectively Group.

A kind of kit detecting mastitis for milk cows pathogen type based on multiple fluorescence PCR method fast typing, it includes Q-PCR reaction solutions, enzyme mixation, positive quality control product and negative quality-control product, wherein Q-PCR reaction solutions mainly by dATP, dUTP, Four kinds of nucleotide such as dGTP, dCTP, for detection bacterium, fungi, the fluorescence RT-PCR primer of mycoplasma and fluorescence probe and As interior target milk cow specific primer and probe, the buffer solution composition containing magnesium ion.

As interior target milk cow specificity, positive, reverse primer and fluorescence probe sequence are respectively：

Forward primer：5'-GTTTGGTCCCAGCCTTCCT-3'(SEQ ID NO：10)

Reverse primer：5'-CGTCGTGAGCTACAGGGTGTG-3'(SEQ ID NO：11)

Oligonucleotide probe：5'-ATAACCTAGAGGGCATTCT-3'(SEQ ID NO：12)；

5 ' ends of above-mentioned probe are marked with fluorescent reporter group, and 3 ' ends are marked with fluorescent quenching group.

The above fluorescent reporter group can be selected from FAM, NEX, ROX, TET, TAMRA, JOE, VIC, CY3, CY5 or Texas Red；Fluorescent quenching group can be selected from BHQ, TAMRA, MGB, Eclipse, Dabcyl, Lowa Black^TMRQ or Lowa Black^TM FQ。

Enzyme mixation can be the buffer solution for including the Taq archaeal dna polymerases of thermal starting, UDG enzymes.

Positive quality control product can be containing insertion bacterium 16s rRNA specific amplifications region respectively, fungi ITS specificity Amplification region, Mycoplasma 16s rRNA specific amplifications region, milk cow 12s rRNA specific amplifications region pUC57 carriers Plasmid mixture, four recombinant plasmids are transformed into respectively in bacillus coli DH 5 alpha after proliferation, and spectrophotometer is used in extracted purifying After measured concentration and purity, mixing after being diluted with sterile TE buffer.Wherein, each plasmid of positive quality control product is a concentration of 1.0×10⁶copies/ml。

In positive quality control product, the general conservative region sequences of bacterium 16s rRNA are：

ATGAAGTCGGAATCGCTAGTAATCGTGGATCAGAATGCCACGGTGAATACGTTCCCGGGCCTTGTACACACCGCCCG TCACACCA(SEQ ID NO：13)

In positive quality control product, the general conservative region sequences of fungi ITS rRNA are：

CAACTCTCAACGACGGATGTCTAGGCTCCCGCATCGATGAAGAACGCAGCGAACTGCGATACGTAGTGTGAATTGCA GAG(SEQ ID NO：14)

In positive quality control product, the general conservative region sequences of Mycoplasma 16s rRNA are：

ACTCCTACGGGAGGCAGCAGTAGGGAATTTTCCACAATGGACGAAAGTCTGATGGAGCGACACAGCGTGCAGGATGA CGGCCTTCGGGTTGTAAACTGCTGTTGTTAGGGAA(SEQ ID NO：15)

In positive quality control product, milk cow 12s rRNA specific conservative's regional sequences are：

AGGTTTGGTCCCAGCCTTCCTGTTAACTCTTAATAAACTTACACATGCAAGCATCTACACCCCAGTGAGAATGCCCT CTAGGTTATTAAAACTAAGAGGAGCTGGCATCAAGCACACACCCTGTAGCTCACGACGCCTT(SEQ ID NO：16)

Negative quality-control product is sterile TE buffer, which is prepared using DEPC water.

This kit is stored in -20 DEG C, reduces multigelation to the greatest extent.

A kind of multiple fluorescence PCR method of fast typing detection mastitis for milk cows pathogenic microorganism type, including following step Suddenly：

1) extraction of sample DNA：The sample DNA may be used extracts examination by the DNA of bacteria magnetic bead that Tiangeng company produces Agent box is carried out according to kit specification extraction.

2) using sample DNA to be detected as template, Q-PCR reaction solutions, enzyme mixation etc. is added and is made into Q-PCR reaction systems, It carries out amplification reaction, wherein reaction system is as follows：18 μ L of Q-PCR reaction solutions, 2 μ L of enzyme mixation, 5 μ L of DNA profiling.

3) Q-PCR amplifications carry out RT-PCR amplifications according to following procedure：

4) interpretation of result：

Detection data file is preserved after 4.1 experiments.

4.2 analysis conditions are arranged：According to the Start values, Stop values of image adjustment baseline (Baseline) after analysis and (user can voluntarily adjust the Value values of threshold value (Threshold) according to actual conditions, and Start values can in 3-15, end value Amplification curve in 5-20, to adjust negative control is straight or is less than threshold line), so that instrument is provided correct result.

5) quality control

5.1 negative control：Without amplification curve, Ct values are shown as Undet by the channels FAM, the channels HEX, the channels ROX and Cy5 Or No Ct；

5.2 positive control：The channels FAM, the channels HEX, the channels ROX and Cy5 have amplification curve, and Ct values are ≤32；

Two above requires in same primary experiment need to simultaneously meet, and otherwise, this experiment is invalid, needs to re-start reality It tests.

6) result interpretation

6.1 have amplification curve when the channels FAM and the channels Cy5, and Ct values are ≤37, can determine that milk cow is bacillary breast Inflammation infection；

6.2 have amplification curve when the channels HEX and the channels Cy5, and Ct values are ≤37, can determine that milk cow is fungoid breast Inflammation infection；

6.3 have amplification curve when the channels FAM, the channels ROX and the channels Cy5, and Ct values are ≤37, can determine that milk cow is branch Substance mammitis infects；

6.4 have amplification curve, 37 ＜ Ct values≤40, Cy5 channels to have when the channels FAM, the channels HEX and the channels ROX of sample Amplification curve, whens and Ct values≤30, suggest being repeated once experiment, if result is same as above, can determine that as weakly positive, if without amplification, It can determine that as feminine gender；

6.5 work as the channels FAM, the channels HEX and the channels ROX of sample without amplification curve, but there is amplification curve in the channels Cy5, and It can determine that as feminine gender when Ct values≤30；

6.6 work as the channels FAM, the channels HEX, the channels ROX and the channels Cy5 of sample without amplification curve, and Ct values are shown as Undet or No Ct, experiment is invalid, recommended replacement a batch reagent is tested again

The definition of Ct values (cycle threshold, Ct) is：Fluorescence signal reaches given threshold when institute in each reaction tube The recurring number of experience.The setting of threshold value is usually to set it to that negative control and the fluorescence of blank control can be covered just At value, therefore it can be very good removal reaction tube fluorescent value i.e. background.

Present invention is generally directed in the mastitis for milk cows pathogenic microorganism the characteristics of, separately design pathogenic bacteria, pathogenic The universal primer and probes of design such as fungi (including former capsule algae etc.), pathogenic mycoplasma category, and it is based on the primer and probe group It runs jointly and sends out the type that multiple real time fluorescence round pcr detects pathogenic microorganism in milk sample for fast typing, be next Precisely detection provides reliable data to step, to avoid the generation of missing inspection.This is further described with reference to specific embodiment Invention, the application method i.e. detection side of pathogenic microorganism type of this kit in the milk sample of mastitis for milk cows is suffered from detection Method carries out Linear Experiment, Precision Experiment and specificity experiments by taking kit as an example below.

The Linear Experiment of 1 kit of embodiment

This kit needs to separately verify the linear relationship of three pairs of primer and probes such as bacterium, fungi, mycoplasma combination, because This is respectively adopted the bacterium solution of Escherichia coli reference culture, the bacterium solution of Candida albicans reference culture, contains Mycoplasma bovis purpose piece Plasmid of section etc. prepares the reference material of Linear Experiment.

As shown in Figure 1, the channel of detection pathogenic bacteria is FAM signal paths, E1-E7 indicates a concentration of 1.0 respectively × 10⁸CFU/mL、1.0×10⁷CFU/mL、1.0×10⁶CFU/mL、1.0×10⁵CFU/mL、1.0×10⁴CFU/mL、1.0× 10³CFU/mL、1.0×10²The DNA of the bacterium solution extraction of the Escherichia coli reference culture of CFU/mL, is shown experimentally that the kit 1.0 × 10 in terms of detecting pathogenic bacteria⁸CFU/mL to 1.0 × 10²There is good linear relationship between CFU/mL, lead to Cross calculate the kit fitting linear equation be：Y=-3.5643x+41.736, coefficient R²=0.9977, wherein Y generations Table Ct values, x represent the logarithm of Escherichia coli reference material.

As shown in Fig. 2, the channel of detection pathogenic fungus is HEX signal paths, F1-F6 expressions a concentration of 1.0 × 10⁸CFU/mL、1.0×10⁷CFU/mL、1.0×10⁶CFU/mL、1.0×10⁵CFU/mL、1.0×10⁴CFU/mL、1.0× 10³The DNA of the bacterium solution extraction of the Candida albicans reference culture of CFU/mL, is shown experimentally that the kit is pathogenic in detection 1.0 × 10 in terms of fungi⁸CFU/mL to 1.0 × 10³There is good linear relationship, by calculating the reagent between CFU/mL Box fitting linear equation be：Y=-3.6143x+46.862, coefficient R²=0.9992, wherein Y represent Ct values, and x is represented The logarithm of Candida albicans reference material.

As shown in figure 3, the channel of detection pathogenic mycoplasma is ROX signal paths, M1-M6 expressions a concentration of 1.0 × 10⁸copies/mL、1.0×10⁷copies/mL、1.0×10⁶copies/mL、1.0×10⁵copies/mL、1.0× 10⁴copies/mL、1.0×10³The plasmid containing Mycoplasma bovis target fragment of copies/mL, is shown experimentally that the reagent Box is in terms of detecting pathogenic mycoplasma 1.0 × 10⁸Copies/ml to 1.0 × 10³There is good line between copies/ml Sexual intercourse, while the linear equation of kit fitting is：Y=-3.16x+43.147, coefficient R²=0.9992, wherein Y Ct values are represented, x represents the logarithm of positive reference product.

The internal reference confirmatory experiment of 2 kit of embodiment

This kit devises a pair of of Idiotype primer and probe as the examination using the 12s rRNA conservative regions of milk cow The internal standard of agent box, monitors the validity of nucleic acid extraction link, this experiment detects milk sample using the primer and probe, extracts altogether The milk sample of 5 parts of separate sources is expanded using the kit, and Ct values show that the primer and probe can between 20-25 Using the internal standard as the kit, experimental result is with reference to shown in figure 4.

The Precision Experiment of 3 kit of embodiment

This experiment mainly illustrates batch interior precision of the kit by verifying the precision of pathogenic bacteria sense channel Degree, wherein using a concentration of 5.0 × 10⁷The Escherichia coli bacteria liquid sample of CFU/mL is referred to as the precision of enriched sample Product are labeled as J1, using a concentration of 5.0 × 10³Precision of the Escherichia coli bacteria liquid sample of CFU/mL as low concentration sample Reference product is labeled as J2, each 10 repeated samples, the experimental results showed that two concentration data coefficient of variation of height are respectively less than 5%, Experimental result is refering to what is shown in Fig. 5, illustrate that the kit has good repeatability.

The specificity experiments of 4 kit of embodiment

There is good specificity on detection variety classes bacterium, fungi to verify the kit, large intestine is respectively adopted Bacillus, staphylococcus aureus, Streptococcusagalactiae, enterococcus faecalis, Friedlander's bacillus, proteus mirabilis, salmonella, The reference cultures bacterium solution such as Candida albicans, which is added in fresh milk, is configured to certain density simulated infection milk sample work For specific reference material.It is extracted in the above simulated infection milk sample using the DNA of bacteria extracts kit of Tiangeng company production DNA tested as template, experimental data shows that the kit has typically when detecting this 8 species specificity reference material " S " type amplification curve illustrates that kit specificity is good, and experimental result is with reference to shown in figure 6.

The present invention can realize that the milk sample of fast typing detection mastitis for milk cows is the infection for belonging to which kind of pathogen, It has the following advantages that：

1. be directed to respectively pathogenic bacteria, pathogenic fungus (including candida albicans, cryptococcus, Aspergillus, mucor and Former capsule algae etc.), pathogenic mycoplasma belong to etc. separately design universal Idiotype primer and probe, cover all cow breasts Scorching pathogenic bacteria type, keeps detection more comprehensive, prevents the generation of missing inspection；

In 2. for the validity of guarantee detection, in kit, the specific primer and probe of innovative addition milk cow are used as Mark is accused, is monitored extraction efficiency and is excluded inhibitor interference；

3., can be anti-pollution to add UDG-dUTP in amplification system to solve the common Aerosol of Bacteria Detection System, while being detected using a tubular type stopped pipe, prevent the pollution that aerosol is brought；

4. the distinctive advantage of multiple probe method fluorescent quantitative PCR technique, i.e., specific stronger, sensitivity higher, detection speed Degree is fast, extracts report testing result from nucleic acid, whole process can be controlled in 2 hours, fully meet the morning of recessive mastitis The demand of phase screening, while direction is provided for follow-up precisely detection, it is suitable for mastitis for milk cows quick diagnosis and epidemic situation monitors, Authentic data is provided for milk cow medication, reduces treatment cost, improves cure rate.

The above content is combining, specific embodiment is made for the present invention to be further described, and it cannot be said that this hair Bright specific implementation is confined to these explanations.For those of ordinary skill in the art to which the present invention belongs, it is not taking off Under the premise of from present inventive concept, a number of simple deductions or replacements can also be made.

SEQUENCE LISTING

<110>Shenzhen City Second People's Hospital

<120>Probe combinations for the detection of mastitis for milk cows pathogen fast typing

<130> 18I26056

<160> 16

<170> PatentIn version 3.3

<210> 1

<211> 23

<212> DNA

<213>For the sequence of the forward primer of pathogenic bacteria

<400> 1

gaagtcggaa tcgctagtaa tcg 23

<210> 2

<211> 18

<212> DNA

<213>For the sequence of the reverse primer of pathogenic bacteria

<400> 2

gtgtgacggg cggtgtgt 18

<210> 3

<211> 25

<212> DNA

<213>For the sequence of the probe of pathogenic bacteria

<400> 3

cggtgaatac gttcccgggc cttgt 25

<210> 4

<211> 23

<212> DNA

<213>For the sequence of the forward primer of pathogenic fungus

<400> 4

actctcaacg acggatgtct agg 23

<210> 5

<211> 22

<212> DNA

<213>For the sequence of the reverse primer of pathogenic fungus

<400> 5

gcaattcaca ctacgtatcg ca 22

<210> 6

<211> 23

<212> DNA

<213>For the sequence of the probe of pathogenic fungus

<400> 6

ttcgctgcgt tcttcatcga tgc 23

<210> 7

<211> 19

<212> DNA

<213>For the sequence of the forward primer of pathogenic mycoplasma

<400> 7

tcctacggga ggcagcagt 19

<210> 8

<211> 21

<212> DNA

<213>For the sequence of the reverse primer of pathogenic mycoplasma

<400> 8

ccctaacyac agcastttac a 21

<210> 9

<211> 25

<212> DNA

<213>For the sequence of the probe of pathogenic mycoplasma

<400> 9

tggagcgaca cagcgtgcag gatga 25

<210> 10

<211> 19

<212> DNA

<213>The sequence of milk cow specific forward primer

<400> 10

gtttggtccc agccttcct 19

<210> 11

<211> 21

<212> DNA

<213>The sequence of milk cow specific reverse primers

<400> 11

cgtcgtgagc tacagggtgt g 21

<210> 12

<211> 19

<212> DNA

<213>The sequence of milk cow specific probe

<400> 12

ataacctaga gggcattct 19

<210> 13

<211> 85

<212> DNA

<213>The general conservative region sequences of bacterium 16s rRNA

<400> 13

atgaagtcgg aatcgctagt aatcgtggat cagaatgcca cggtgaatac gttcccgggc 60

cttgtacaca ccgcccgtca cacca 85

<210> 14

<211> 80

<212> DNA

<213>The general conservative region sequences of fungi ITS rRNA

<400> 14

caactctcaa cgacggatgt ctaggctccc gcatcgatga agaacgcagc gaactgcgat 60

acgtagtgtg aattgcagag 80

<210> 15

<211> 112

<212> DNA

<213>The general conservative region sequences of Mycoplasma 16s rRNA

<400> 15

actcctacgg gaggcagcag tagggaattt tccacaatgg acgaaagtct gatggagcga 60

cacagcgtgc aggatgacgg ccttcgggtt gtaaactgct gttgttaggg aa 112

<210> 16

<211> 139

<212> DNA

<213>Milk cow 12s rRNA specific conservative's regional sequences

<400> 16

aggtttggtc ccagccttcc tgttaactct taataaactt acacatgcaa gcatctacac 60

cccagtgaga atgccctcta ggttattaaa actaagagga gctggcatca agcacacacc 120

ctgtagctca cgacgcctt 139

Claims

1. a kind of probe combinations for the detection of mastitis for milk cows pathogen fast typing, which is characterized in that including：

2. a kind of primer combination of probe for the detection of mastitis for milk cows pathogen fast typing, which is characterized in that including：

Sequence such as SEQ ID NO for the forward primer for detecting pathogenic bacteria:1 shown, reverse primer sequence such as SEQ ID NO:2 shown, oligonucleotide probe sequence such as SEQ ID NO:Shown in 3；

Sequence such as SEQ ID NO for the forward primer for detecting pathogenic fungus:4 shown, reverse primer sequence such as SEQ ID NO:5 shown, oligonucleotide probe sequence such as SEQ ID NO:Shown in 6；

Sequence such as SEQ ID NO for the forward primer for detecting pathogenic mycoplasma:7 shown, reverse primer sequence such as SEQ ID NO:8 shown, oligonucleotide probe sequence such as SEQ ID NO:Shown in 9.

3. primer combination of probe as claimed in claim 2, which is characterized in that further include：

Sequence as interior target milk cow specific forward primer such as SEQ ID NO:10 shown, reverse primer sequence such as SEQ ID NO:11 shown, fluorescence probe sequence such as SEQ ID NO:Shown in 12.

4. a kind of kit for the detection of mastitis for milk cows pathogen fast typing, which is characterized in that including：

5. kit as claimed in claim 4, which is characterized in that further include：

As interior target milk cow specific oligonucleotide probe, sequence such as SEQ ID NO:Shown in 12.

6. a kind of kit for the detection of mastitis for milk cows pathogen fast typing, which is characterized in that reacted including Q-PCR Liquid, enzyme mixation, positive quality control product and negative quality-control product, the Q-PCR reaction solutions contain the few core described in claim 4 or 5 Thuja acid probe.

7. kit as claimed in claim 6, which is characterized in that the enzyme mixation be thermal starting Taq DNA polymerase and UDG enzyme mixations.

8. kit as claimed in claim 6, which is characterized in that the positive quality control product is containing insertion bacterium 16s respectively RRNA specific amplifications region, fungi ITS specific amplifications region, Mycoplasma 16srRNA specific amplifications region, milk cow The pUC57 vector plasmid mixtures in 12s rRNA specific amplifications region, wherein the general conservative region sequences of bacterium 16s rRNA Such as SEQ ID NO：Shown in 13, the general conservative region sequences of fungi ITSrRNA such as SEQ ID NO：Shown in 14, Mycoplasma 16s The general conservative region sequences of rRNA such as SEQ ID NO：Shown in 15, milk cow 12s rRNA specific conservatives regional sequences such as SEQ IDNO：Shown in 16.

9. kit as claimed in claim 6, which is characterized in that the feminine gender quality-control product is sterile TE buffer.

10. a kind of genetic chip for the detection of mastitis for milk cows pathogen fast typing, which is characterized in that including chip carrier And the probe combinations set on the chip carrier, the probe combinations include：