CN101654706B - Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof - Google Patents
Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof Download PDFInfo
- Publication number
- CN101654706B CN101654706B CN2009101427624A CN200910142762A CN101654706B CN 101654706 B CN101654706 B CN 101654706B CN 2009101427624 A CN2009101427624 A CN 2009101427624A CN 200910142762 A CN200910142762 A CN 200910142762A CN 101654706 B CN101654706 B CN 101654706B
- Authority
- CN
- China
- Prior art keywords
- liquid
- reagent kit
- diagnostic reagent
- rapid diagnostic
- legionella pneumophilia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a rapid diagnostic reagent kit of legionella pneumophilia genes based on a loop-mediated isothermal amplification technique and a detecting method thereof, wherein the reagent kit consists of two pairs of primers, DNA polymerase, a stable liquid, a reaction liquid, a sample pretreatment liquid, a color rendering liquid and a positive contrast liquid which are respectively placed in a container. The gene rapid diagnostic reagent kit can judge whether target substances exist or not by applying applies six sections and the four primers according amplification or non-amplification, and thereby has high specificity. The gene rapid diagnostic reagent kit has high speed, high efficiency and high sensitivity, only needs a constant temperature for amplification reaction without special reagents and equipment, and has low detection cost. The gene rapid diagnostic reagent kit has simple identification, can generate magnesium pyrophosphate deposits as a byproduct by combining pyrophosphate ions precipitated from dNTP and Mg<2> in a reaction solution, can identify the magnesium pyrophosphate deposits through visual study, and has remarkable color rendering difference of negative and positive results after the color rendering liquid is added, and is more marked and reliable.
Description
Technical field
The present invention relates to biological detection reagent, be specifically related to a kind of rapid diagnostic reagent kit of legionella pneumophilia genes and detection method thereof.
Background technology
At present legionella pneumophilia there is multiple detection method, from being accredited as main national standard (GB/T4789.7-2003) with pathogenic micro-organism isolation identification, morphology evaluation and automatic biochemical, immunology detection technology, nucleic acid probe, polymerase chain reaction (PCR) technology equimolecular biological detection method [food safety detection and modern biotechnology to differential protein, Chemical Industry Press, 2004].Wherein the cause of disease detection of nucleic acids all improves a lot at aspects such as rapidity, security, accuracy and susceptibilitys, these new technologies are attempted to break through microbiologies such as traditional morphology, biochemical reaction and are detected old model, do not need microorganism is separated purification, and directly its gene and gene product are carried out rapid detection with the enrichment liquid of sample or sample, and combine with Protocols in Molecular Biology and information biology means, to accurately, fast, the direction of sensitivity and automatization develops.
With polymerase chain reaction (PCR) technology is that the cause of disease nucleic acid detection technique of representative also exists some problems in actual applications, as the special instrument of common polymerase chain reaction (PCR) Technology Need, and there are easy crossed contamination and the loaded down with trivial details shortcoming of operating process.And fluorescence real-time quantitative polymerase chain reaction (real time PCR) though technology has solved the problem of crossed contamination preferably, and has simplified operating process, needs more complicated quantitative assay instrument, therefore is not suitable for field quick detection.And the cost of fluorescent probe is higher in the real-time quantitative polymerase chain reaction PCR technology, has strengthened the difficulty of applying.The immunology detection technology is fast and convenient with low cost, but requires the monoclonal antibody of high quality high stability, otherwise because of accuracy is not enough, can only be the auxiliary detection means at present.So in time use the newest fruits of biotech development significant to satisfying improving constantly of pathogenic micro-organism detection requirement.Wherein isothermal duplication (Isothermal Amplification) nucleic acid Fast Detection Technique is the rapid progress on the cause of disease nucleic acid detection technique, the loop-mediated isothermal amplification technique of now having set up (loop-mediated isothermal amplication of DNA, be called for short LAMP) have a lot of superiority, and do not see that useful loop-mediated isothermal amplification technique detects the gene quick diagnosis kit of legionella pneumophilia at present yet.
Summary of the invention
The objective of the invention is deficiency, a kind of rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique that cost is low, easy to use, detection speed is fast, specificity is high that detects is provided at the prior art existence.
Another object of the present invention provides the detection method of above-mentioned rapid diagnostic reagent kit of legionella pneumophilia genes.
Above-mentioned purpose of the present invention is achieved by following technical solution:
One, rapid diagnostic reagent kit of legionella pneumophilia genes of the present invention is made up of two pairs of primers, Bst archaeal dna polymerase, reaction solution, stable liquid, sample pretreatment liquid, colour developing liquid and positive control solution, more than seven kinds of liquid place container respectively, wherein:
Described two pairs of primers are:
Outer primer F3:TCTATTGAAATAGCACTTAAGCT is shown in SEQ ID NO:1;
Outer primer B3:TGGATTCCGATCGGGATG is shown in SEQ ID NO:2;
Inner primer FIP:GCTGTTCCATAACTGCTCACAATTTttttAATTTAGAGTCTTCATACGACTG A is shown in SEQ ID NO:3;
Inner primer BIP:TTAGAAGTAAGTCGAAATGCGAGTGttttGTATTTCATTGCCAGCCTG is shown in SEQ ID NO:4;
Contain 1.6～2mmol dNTP, 20～25mmolTris-HCl, 10～12.5mmol Repone K, 10～12.5mmol ammonium sulfate, 8～10mmol sal epsom, 1～1.25ml TritonX-100,0.8～1mol trimethyl-glycine, each 1.6～2mol of inner primer FIP/BIP and each 0.2～0.25mol of outer primer F3/B3 in above-mentioned every 1L reaction solution; Preferred ratio is to contain 2mmol dNTP, 25mmol Tris-HCl, 12.5mmol Repone K, 12.5mmol ammonium sulfate, 10mmol sal epsom, 1.25ml TritonX-100,1mol trimethyl-glycine, each 2mol of inner primer FIP/BIP and each 0.25mol of outer primer F3/B3 in every 1L reaction solution.
Tris-HCl, the 1～2mmol EDTA and the 10～12ml Triton X-100 that contain 10～20mmol pH 8.0 in above-mentioned every 1L sample pretreatment liquid.Preferred ratio is to contain 20mmol Tris-HCl (pH 8.0), 2mmol EDTA and 12ml TritonX-100 in every 1L sample pretreatment liquid.
Above-mentioned colour developing liquid is preferably fluorescence dye SYBR Green I or EvaGreen;
Aforementioned stable liquid is preferably paraffin oil.
Above-mentioned positive control is legionella pneumophilia genes group DNA.
Two, the production technique of gene quick diagnosis kit of the present invention
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, reaction solution is aseptic subpackaged, and determine the quality inspection of sampling with carrying out concentration according to experiment;
3, stable liquid is aseptic subpackaged, the sampling quality inspection;
4, with the positive control sample preparations, packing, sampling quality inspection;
5, assembling test kit.
Three, the detection method of gene quick diagnosis kit of the present invention
1, sample preparation
Testing sample is filtered through filter membrane (the filter membrane aperture is 0.22 μ m～0.45 μ m), behind the wash-out, centrifugal in centrifuge tube, remove supernatant, add sample pretreatment liquid in the precipitation and mix cooled on ice after the boiling water bath deactivation, behind the high speed centrifugation, supernatant is the sample template DNA;
2, loop-mediated isothermal amplification technique reaction process
In reaction tubes, add reaction solution 38～40 volume %, big fragment 0.9～1.8 volume % of Bst archaeal dna polymerase, stable liquid 52～54.5 volume %, sample template DNA 4.5～9 volume %, 63～65 ℃ of isothermal reaction 45～90min.Described volume percent is meant the volume percent that accounts for four component cumulative volumes.
3, post-reaction treatment
In above-mentioned reaction tubes and positive controls, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative.
Principle of the present invention is the special inside and outside primer (being inner primer FIP/BIP and outer primer F3/B3) of two couples that utilizes the Bst archaeal dna polymerase and design according to target-gene sequence, six isolated areas on the specific recognition target sequence, start the endless chain replacement(metathesis)reaction, start complementary strand in target DNA district synthetic, and result's complementary sequence on same chain goes round and begins again and is formed with the very stem of polycyclic Cauliflower structure-circular DNA mixture.In the LAMP reaction process, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product---magnesium pyrophosphate milky white precipitate, can be by the visual inspection result of determination.The LAMP reaction is to finish in 45～90 minutes under constant temperature (63～65 ℃) condition.This comparatively gentle temperature condition and do not have temperature cycle that required instrument is oversimplified, overcome conventional P CR inherent detection time long, pollute easily and detect shortcoming such as cost height.In addition, this detection method is lower to testing staff's technical quality requirement, and actually operating is very easy, does not need special reagent and plant and instrument, helps setting up rapid screening system with low cost.The LAMP method is a kind of gene amplification method of easy, quick, high degree of specificity.Constant temperature gene amplification technology and round pcr (comprising the fluorescence real-time quantitative PCR technology) are compared, can find that this technology is equivalent to or is better than round pcr on methodology indexs such as sensitivity, specificity and sensing range, and do not rely on any special plant and instrument and can realize on-the-spot high-throughput rapid detection, and detect cost far below fluorescent quantitative PCR technique.Domestic do not have the test kit of this respect to sell at present as yet.At present in the national standard with microorganism separation and Culture and morphology be accredited as main, in conjunction with the passing method that biochemical analysis and serological typing are identified, preliminary evaluation needs 2～3 days, finishes probation report and needs 10～15 days; Adopt gene quick diagnosis kit of the present invention only to need 2 hours.And, having added colour developing liquid in the reaction solution of the present invention, qualification result is more visual and clear.
Compared with prior art, the present invention has following beneficial effect:
1. gene quick diagnosis kit of the present invention only needs just energy amplified reaction of a steady temperature, does not need special reagent and equipment, and it is low to detect cost; 2. gene quick diagnosis kit of the present invention is used six sections, four primers, and whether the existence that just can judge target substance according to whether increasing to be, so has high specific; 3. gene quick diagnosis kit of the present invention amplification fast and efficient can be finished amplification less than 1 hour, and the productive rate height; 4. gene quick diagnosis kit of the present invention is highly sensitive, and amplification template only needs 10 copies or still less; 5. gene quick diagnosis kit of the present invention is identified easy, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product-magnesium pyrophosphate precipitation, can identify by visual inspection, and after adding colour developing liquid, yin and yang attribute colour development difference as a result is remarkable, checking rate height, more obviously reliable.
Description of drawings
Fig. 1 is LAMP figure as a result;
1 positive contrast; 2 negative contrasts; The positive sample of 3-10; 11-12 is a disturbed specimen, and wherein 11 is the Salmonellas sample, and 12 is the Vibrio parahaemolyticus sample;
Fig. 2 is a LAMP detected result electrophorogram;
" M " is the dna molecular standard, " 1 " positive contrast, and " 2 " negative contrast, " 3～10 " are respectively legionella separation and Culture liquid sample, and " 11 " are the Salmonellas sample, and " 12 " are the Vibrio parahaemolyticus sample
Embodiment
The preparation of embodiment 1 test kit
(1) in the following sequence through the synthetic oligomerization picodna primer of dna synthesizer:
Outer primer F3:TCTATTGAAATAGCACTTAAGCT is shown in SEQ ID NO:1;
Outer primer B3:TGGATTCCGATCGGGATG is shown in SEQ ID NO:2;
Inner primer FIP:GCTGTTCCATAACTGCTCACAATTTttttAATTTAGAGTCTTCATACGACTG A is shown in SEQ ID NO:3;
Inner primer BIP:TTAGAAGTAAGTCGAAATGCGAGTGttttGTATTTCATTGCCAGCCTG is shown in SEQ ID NO:4;
(2) purchase archaeal dna polymerase: Bst DNA polymerase (big fragment) places container.
(3) preparation reaction solution: the prescription of reaction solution contains each 0.25mol preparation of 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol Repone K, 12.5mmol ammonium sulfate, 10mmol sal epsom, 1.25ml TritonX-100,1mol trimethyl-glycine, each 2mol of inner primer FIP/BIP and outer primer F3/B3 by every 1L solution, places container.
(4) preparation sample pretreatment liquid: the prescription of sample pretreatment liquid contains 20mmol Tris-HCl (pH 8.0), 2 mmol EDTA and 12ml Triton X-100 preparation by every 1L solution, places container.
(5) purchase stable liquid: paraffin oil places container;
(6) purchase colour developing liquid: SYBR Green I places container.
(7) extract positive control: staphylococcus aureus gene group DNA places container.
(8) above-mentioned 7 containers are dressed up test kit, encapsulation.
Preparation technology is summarized as follows:
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, reaction solution is aseptic subpackaged, and determine the quality inspection of sampling with carrying out concentration according to experiment;
3, with the stable liquid packing, the sampling quality inspection;
4, with the positive control sample preparations, packing, sampling quality inspection;
5, assembling test kit.
The preparation of embodiment 2 test kits
The prescription of reaction solution is: contain 1.6mmol dNTP, 20mmolTris-HCl, 10mmol Repone K, 10mmol ammonium sulfate, 8mmol sal epsom, 1ml TritonX-100,0.8mol trimethyl-glycine, each 1.6mol of inner primer FIP/BIP and each 0.2mol of outer primer F3/B3 in every 1L reaction solution;
The prescription of sample pretreatment liquid is: Tris-HCl, the 1mmol EDTA and the 10ml Triton X-100 that contain 10mmol pH8.0 in every 1L sample pretreatment liquid.
Colour developing liquid is EvaGreen.
Other are with embodiment 1.
The application of embodiment 3 rapid diagnostic reagent kit of legionella pneumophilia genes
(1) experiment purpose
Estimate sensitivity, specificity and the accuracy of the legionella pneumophilia LAMP gene quick detection kit (embodiment 1) of Guangzhou Huafeng Biotech Co., Ltd.'s development.
(2) selection of reference reagent
The conventional reagent that uses in the daily detection of selection Guangzhou Disease Prevention-Control Center, People's Republic of China's health industry standard: legionnaires disease Case definition and treatment principle WS 195--2001 are contrast.
The reagent of examination is the legionella pneumophilia LAMP gene quick detection kit (embodiment 1) of Guangzhou Huafeng Biotech Co., Ltd.'s development.
(3) selection of research object
The contrast method of process of selecting Guangzhou Disease Prevention-Control Center to provide is confirmed as 8 parts of legionella separation and Culture of male liquid, and 2 parts are disturbed bacterial strains; The cultivation of legionella is finished by Disease Control and Prevention Center.
(4) LAMP operation
The LAMP operation is undertaken by the legionella pneumophilia LAMP gene quick detection kit specification sheets of Guangzhou Huafeng Biotech Co., Ltd.'s development, finishes 65 ℃ of insulation 1h in metal bath, time error 1～2min; Operate by the technician of Guangzhou Huafeng Biotech Co., Ltd..
(5) control experiment
Simultaneously identical sample is required that according to " the legionnaires disease Case definition and the treatment principle WS 195--2001 " of the Ministry of Health's issue sample is carried out affirmation program validations such as the separation and Culture of legionella and evaluation and carry out control experiment by the technician of Disease Control and Prevention Center.
(6) result:
The control group detected result is that 8 routine separation and Culture liquid are that legionella is positive and 2 examples disturb the bacterial strain samples all negative.
Use that LAMP method detected result sees Table 1, Fig. 1 and Fig. 2, positive 2 examples of same 8 examples are negative.Among Fig. 1, if the same shows green with control tube of reaction tubes is then positive, if reaction tubes manifests orange then negative.Fig. 2 is the LAMP method detected result electrophorogram of Fig. 1.This time experimental result shows that the primer of design and the test kit of assembling (embodiment 1) can detect the legionella in the sample.
Rapid diagnostic reagent kit of legionella pneumophilia genes and detection method sequence table .txtSEQUENCE LISTING thereof based on loop-mediated isothermal amplification technique
＜110〉Guangzhou Huafeng Biotech Co., Ltd.
＜120〉based on the rapid diagnostic reagent kit of legionella pneumophilia genes and the detection method thereof of loop-mediated isothermal amplification technique
<130>
<160>4
<170>PatentIn?version?3.2
<210>1
<211>23
<212>DNA
＜213〉synthetic
<400>1
tctattgaaa?tagcacttaa?gct 23
<210>2
<211>18
<212>DNA
＜213〉synthetic
<400>2
tggattccga?tcgggatg 18
<210>3
<211>53
<212>DNA
＜213〉synthetic
<400>3
gctgttccat?aactgctcac?aattttttta?atttagagtc?ttcatacgac?tga 53
<210>4
<211>48
<212>DNA
＜213〉synthetic
<400>4
ttagaagtaa?gtcgaaatgc?gagtgttttg?tatttcattg?ccagcctg 48
Claims (5)
1. rapid diagnostic reagent kit of legionella pneumophilia genes is characterized in that being made up of two pairs of primers, Bst archaeal dna polymerase, reaction solution, stable liquid, sample pretreatment liquid, colour developing liquid and positive control solution, more than seven kinds of liquid place container respectively,
Above-mentioned two pairs of primers are:
Outer primer F3:TCTATTGAAATAGCACTTAAGCT;
Outer primer B3:TGGATTCCGATCGGGATG;
Inner primer FIP:GCTGTTCCATAACTGCTCACAATTTttttAATTTAGAGTCTTCATACGACTG A;
Inner primer BIP:TTAGAAGTAAGTCGAAATGCGAGTGttttGTATTTCATTGCCAGCCTG;
Contain 1.6～2mmol dNTP, 20～25mmol Tris-HCl, 10～12.5mmol Repone K, 10～12.5mmol ammonium sulfate, 8～10mmol sal epsom, 1～1.25ml TritonX-100,0.8～1mol trimethyl-glycine, each 1.6～2mol of inner primer FIP/BIP and each 0.2～0.25mol of outer primer F3/B3 in every 1L reaction solution;
Tris-HCl, the 1～2mmol EDTA and the 10～12ml Triton X-100 that contain 10～20mmol pH 8.0 in every 1L sample pretreatment liquid;
Above-mentioned positive control is legionella pneumophilia genes group DNA.
2. according to the described test kit of claim 1, it is characterized in that described colour developing liquid is SYBRGreen I or EvaGreen.
3. according to the described test kit of claim 1, it is characterized in that containing in described every 1L sample pretreatment liquid Tris-HCl, 2mmol EDTA and the 12ml TritonX-100 of 20mmol pH 8.0.
4. according to the described test kit of claim 1, it is characterized in that containing in described every 1L reaction solution 2mmol dNTP, 25mmol Tris-HCl, 12.5mmol Repone K, 12.5mmol ammonium sulfate, 10mmol sal epsom, 1.25ml TritonX-100,1mol trimethyl-glycine, each 2mol of inner primer FIP/BIP and each 0.25mol of outer primer F3/B3.
5. according to the described test kit of claim 1, it is characterized in that described stable liquid is paraffin oil.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009101427624A CN101654706B (en) | 2008-05-30 | 2009-05-26 | Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810028442.1 | 2008-05-30 | ||
| CNA2008100284421A CN101302554A (en) | 2008-05-30 | 2008-05-30 | Legionella pneumophila gene rapid diagnosis reagent kit base on loop-mediated isothermal amplification technology and detection method thereof |
| CN2009101427624A CN101654706B (en) | 2008-05-30 | 2009-05-26 | Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101654706A CN101654706A (en) | 2010-02-24 |
| CN101654706B true CN101654706B (en) | 2011-10-05 |
Family
ID=40112654
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100284421A Pending CN101302554A (en) | 2008-05-30 | 2008-05-30 | Legionella pneumophila gene rapid diagnosis reagent kit base on loop-mediated isothermal amplification technology and detection method thereof |
| CN2009101427624A Active CN101654706B (en) | 2008-05-30 | 2009-05-26 | Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100284421A Pending CN101302554A (en) | 2008-05-30 | 2008-05-30 | Legionella pneumophila gene rapid diagnosis reagent kit base on loop-mediated isothermal amplification technology and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN101302554A (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101736082A (en) * | 2008-11-24 | 2010-06-16 | 广州迪澳生物科技有限公司 | Rapid detection kit and detection method of isothermal gene amplification of legionnella |
| CN101597647B (en) * | 2009-07-09 | 2011-08-17 | 广州金域医学检验中心有限公司 | Rapid detection kit of legionella bacteria and detection method thereof |
| EP2556154A4 (en) * | 2010-03-25 | 2013-11-13 | Gen Electric | Compositions and methods for the rapid detection of legionella pneumophila |
| CN101979660B (en) * | 2010-11-16 | 2012-12-12 | 广州华峰生物科技有限公司 | Brucella detection kit and using method thereof |
| CN102719548B (en) * | 2010-11-16 | 2014-01-15 | 广州华峰生物科技有限公司 | Kit for detecting brucella and use method thereof |
| CN102168131B (en) * | 2010-12-20 | 2013-11-27 | 南开大学 | Primer for amplifying specific regions of common pathogenic type Legionella gyrB genes and application thereof |
| EP3161153B1 (en) * | 2014-06-30 | 2019-08-21 | Dow Global Technologies LLC | Method and reagents for detecting water contamination |
| CN107907397A (en) * | 2017-11-23 | 2018-04-13 | 苏州泽科生物科技有限公司 | Collagenous fibres horse pine trichrome stain kit and preparation method thereof and colouring method |
| CN108918517A (en) * | 2018-05-15 | 2018-11-30 | 汕尾市食品药品检验所 | A method of the magnesium sulfate illegally added in detection Chinese medicine and medicine materical crude slice |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101008036A (en) * | 2007-01-15 | 2007-08-01 | 深圳市第二人民医院 | Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology |
| CN101082579A (en) * | 2006-05-29 | 2007-12-05 | 广州华峰生物科技有限公司 | Gene rapid diagnosis method based on annular mediated isothermal amplification technology |
-
2008
- 2008-05-30 CN CNA2008100284421A patent/CN101302554A/en active Pending
-
2009
- 2009-05-26 CN CN2009101427624A patent/CN101654706B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101082579A (en) * | 2006-05-29 | 2007-12-05 | 广州华峰生物科技有限公司 | Gene rapid diagnosis method based on annular mediated isothermal amplification technology |
| CN101008036A (en) * | 2007-01-15 | 2007-08-01 | 深圳市第二人民医院 | Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology |
Non-Patent Citations (1)
| Title |
|---|
| Liu H.Use of the dnaJ gene for the detection and identification of all Legionella pneumophila serogroups and description of the primers used to detect 16S rDNA gene sequences of major members of the genus Legionella..《Microbiol Immunol》.2003,859-869. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101654706A (en) | 2010-02-24 |
| CN101302554A (en) | 2008-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101654706B (en) | Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof | |
| CN101570795B (en) | Mycobacterium tuberculosis gene rapid diagnostic primer based on loop-mediated isothermal amplification technology and use in preparing rapid diagnostic kit | |
| CN101660005B (en) | Rapid diagnostic kit based on loop-mediated isothermal amplification technique for hepatitis A virus genes and detection method thereof | |
| CN101082581A (en) | Colon bacillus 0157 gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology | |
| CN101403001B (en) | Rapid diagnosis reagent kit and detection method for pseudomonas aeruginosa gene | |
| CN101008036A (en) | Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology | |
| CN101008039A (en) | EB virus gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology | |
| CN101935693A (en) | Mycobacterium tuberculosis detection kit and use method thereof | |
| CN101082579A (en) | Gene rapid diagnosis method based on annular mediated isothermal amplification technology | |
| CN101307356A (en) | Rapid diagnosis kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN102094090B (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN101082580A (en) | vibrio parahaemolyticus gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology | |
| CN101824468B (en) | Primer group for detecting Yersinia pestis, rapid diagnosis kit and detection method | |
| CN101555529B (en) | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof | |
| CN101368204B (en) | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique | |
| CN101736081A (en) | Kit for rapidly detecting isothermal gene amplification of Mycobacterium tuberculosis and detection method | |
| CN101942508A (en) | Escherichia coli detection kit and use method thereof | |
| CN101368203A (en) | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection | |
| CN101403005B (en) | Rapid diagnosis reagent kit and detection method for cholera vibrio gene | |
| CN101403004B (en) | Rapid diagnosis reagent kit and detection method for vibrio vulnficus gene | |
| CN100478674C (en) | Salmonella gene rapid diagnosis reagent kit based on annular mediated isothermal amplification technology | |
| CN101338345A (en) | H5 avian influenza viral gene rapid diagnosis kit based on ring mediating isothermal amplification technology and detecting process thereof | |
| CN101403003B (en) | Rapid diagnosis reagent kit and detection method for staphylococcus epidermidis gene | |
| CN102719548B (en) | Kit for detecting brucella and use method thereof | |
| CN101824482B (en) | Detection kit for vibrio cholerae O1 group and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |