CN101338345A - H5 avian influenza viral gene rapid diagnosis kit based on ring mediating isothermal amplification technology and detecting process thereof - Google Patents
H5 avian influenza viral gene rapid diagnosis kit based on ring mediating isothermal amplification technology and detecting process thereof Download PDFInfo
- Publication number
- CN101338345A CN101338345A CNA200810030108XA CN200810030108A CN101338345A CN 101338345 A CN101338345 A CN 101338345A CN A200810030108X A CNA200810030108X A CN A200810030108XA CN 200810030108 A CN200810030108 A CN 200810030108A CN 101338345 A CN101338345 A CN 101338345A
- Authority
- CN
- China
- Prior art keywords
- reaction
- liquid
- volume
- avian influenza
- colour developing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a H5 AIV gene fast detecting reagent box based on an annular-mediated constant temperature augmentation technology and a detecting method thereof. The reagent box consists of two pairs of primers, a DNA polymerase, a reaction liquid, a reverse transcriptase, a RNA enzyme inhibitor, a stabilizing liquid, a color development liquid and a masculine contrast liquid; the eight liquids are respectively arranged in containers. The gene fast detecting reagent box of the invention applies six segments and four primers to judge the existence of a target matter or not according to whether augmentation or not, thereby having high specificity. The gene fast detecting reagent box of the invention is fast, effective and has high sensitivity as well as can carry out augmentation reaction only by one constant temperature without a special reagent and device. The gene fast detecting reagent box of the invention identifies simply; a pyrophosphate ion separated out from dNTP is combined with the Mg<2+> in a reaction liquid to generate the deposition of a byproduct of magnesium pyrophosphate which can be identified by visual inspection; besides, after the color development liquid is added, the color development difference of the negative and positive results is remarkable, thus being more obvious and reliable.
Description
Technical field
The present invention relates to biological detection reagent, be specifically related to a kind of H5 avian influenza viral gene rapid diagnosis kit and detection method thereof based on loop-mediated isothermal amplification technique.
Background technology
At present H5 avian influenza virus there is multiple detection method, from identify the national standard (GB/T 18936-2003) with serological identification based on pathogenic micro-organism isolation identification, morphology, to immunology detection technology, nucleic acid probe, polymerase chain reaction (PCR) the technology equimolecular biological detection method (GB 19438.1-2004, GB/T 19439-2004) of differential protein.Wherein the cause of disease detection of nucleic acids all improves a lot at aspects such as rapidity, security, accuracy and susceptibilitys, these new technologies are attempted to break through microbiologies such as traditional morphology, biochemical reaction and are detected old model, do not need microorganism is separated purification, and directly its gene and gene product are carried out rapid detection with the enrichment liquid of sample or sample, and combine with Protocols in Molecular Biology and information biology means, to accurately, fast, the direction of sensitivity and automatization develops.
With polymerase chain reaction (PCR) technology is that the cause of disease nucleic acid detection technique of representative also exists some problems in actual applications, as the special instrument of common polymerase chain reaction (PCR) Technology Need, and there are easy crossed contamination and the loaded down with trivial details shortcoming of operating process.And fluorescence real-time quantitative polymerase chain reaction (real time PCR) though technology has solved the problem of crossed contamination preferably, and has simplified operating process, needs more complicated quantitative assay instrument, therefore is not suitable for field quick detection.And the cost of fluorescent probe is higher in the real-time quantitative polymerase chain reaction PCR technology, has strengthened the difficulty of applying.The immunology detection technology is fast and convenient with low cost, but requires the monoclonal antibody of high quality high stability, otherwise because of accuracy is not enough, can only be the auxiliary detection means at present.So in time use the newest fruits of biotech development significant to satisfying improving constantly of pathogenic micro-organism detection requirement.Wherein isothermal duplication (Isothermal Amplification) nucleic acid Fast Detection Technique is the rapid progress on the cause of disease nucleic acid detection technique, the loop-mediated isothermal amplification technique of now having set up (LAMP) has a lot of superiority, and does not also see that useful loop-mediated isothermal amplification technique detects the gene quick diagnosis kit of mycobacterium tuberculosis at present.
Summary of the invention
The objective of the invention is at the deficiencies in the prior art, provide a kind of detect cost low, easy to use, detect rapidly and efficiently, highly sensitive H5 avian influenza viral gene rapid diagnosis kit based on loop-mediated isothermal amplification technique, this test kit is based on loop-mediated isothermal amplification technique and detects H5 avian influenza virus.
Another object of the present invention provides the detection method of above-mentioned H5 avian influenza viral gene rapid diagnosis kit.
Above-mentioned purpose of the present invention is achieved by following technical solution:
One, H5 avian influenza viral gene rapid diagnosis kit of the present invention, form by two pairs of primers, Bst archaeal dna polymerase, reversed transcriptive enzyme, RNA enzyme inhibitors, stable liquid, reaction solution, colour developing liquid and positive control solution, more than eight kinds of liquid place container respectively, wherein:
Described two pairs of primers are:
Outer primer F3:GACAGAGCAGGTTGACAC;
Outer primer B3:CCTTCTCCACTATGTAAGACC;
Inner primer FIP:TAGATCGCAGAGCTTCCCGTTTTTACTGTTACACATGCCCAAG;
Inner primer BIP:GATTGTAGTGTAGCTGGATGGCTTTTATTCCGGCACATTGATGA;
Above-mentioned reaction solution contains 1.6～2mmol/L dNTP, 20～25mmol/L Tris-HCl, 10～12.5mmol/L Repone K, 10～12.5mmol/L ammonium sulfate, 8～10mmol/L sal epsom, 0.1～0.125%TritonX-100,0.8～1mol/L trimethyl-glycine, each 1.6～2mol/L of inner primer FIP/BIP and each 0.2～0.25mol/L of outer primer F3/B3.Preferred ratio is: reaction solution contains 2mmol/L dNTP, 25mmol/L Tris-Cl, 12.5mmol/L Repone K, 12.5mmol/L ammonium sulfate, 10mmol/L sal epsom, 0.125%TritonX-100,1mol/L trimethyl-glycine, each 2mol/L of inner primer FIP/BIP and each 0.25mol/L of outer primer F3/B3.(0.1～0.125%TritonX-100 is: the volume percent that Triton X-100 accounts for reaction solution is 0.1～0.125%)
Above-mentioned reversed transcriptive enzyme is preferably the AMV reversed transcriptive enzyme.
Above-mentioned positive control is the plasmid DNA of carrying the H5 avian influenza virogene.
Above-mentioned colour developing liquid is preferably SYBR Green I or EvaGreen.
Aforementioned stable liquid is preferably paraffin oil.
Two, the production technique of gene quick diagnosis kit of the present invention
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, reaction solution is aseptic subpackaged, and determine the quality inspection of sampling with carrying out concentration according to experiment;
3, stable liquid is aseptic subpackaged, the sampling quality inspection;
4, reversed transcriptive enzyme is aseptic subpackaged, the sampling quality inspection;
5, the RNA enzyme inhibitors is aseptic subpackaged, the sampling quality inspection;
6, with the positive control sample preparations, packing, sampling quality inspection;
7, assembling test kit.
Three, the detection method of gene quick diagnosis kit of the present invention
1, sample preparation:
Sample collecting, preservation and processing can adopt among the GB/T 18936-2003 2.1 sections to carry out;
Extract sample nucleic acid, can adopt GB/T 19439-2004 to carry out the sample nucleic acid extraction and obtain the commercialization nucleic acid extraction kit by specification operation that sample template or use be equal to and extract the RNA template.
2, loop-mediated isothermal amplification technique reaction process
In reaction tubes, add reaction solution 38～40 volume %, Bst archaeal dna polymerase 0.9～1.8 volume %, reversed transcriptive enzyme 0.9～1.8 volume %, RNA enzyme inhibitors 0.9～1.8 volume %, stable liquid 52～54.5 volume %, sample template ribonucleic acid 4.5～7.3 volume %, 63～65 ℃ of isothermal reaction 45～90min.Described volume percent is meant the volume percent that accounts for six component cumulative volumes.
3, post-reaction treatment
In above-mentioned reaction tubes and positive controls, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative.
The present invention is said based on loop-mediated isothermal amplification technique (loop-mediated isothermal amplication of DNA, abbreviation LAMP) method of rapid detection H5 avian influenza virus, be utilize the Bst archaeal dna polymerase and according to two couple of target-gene sequence design special in, outer primer (being inner primer FIP/BIP and outer primer F3/B3), six isolated areas on the specific recognition target sequence, start the endless chain replacement(metathesis)reaction, start complementary strand in target DNA district synthetic, and result's complementary sequence on same chain goes round and begins again and is formed with the very stem of polycyclic Cauliflower structure-circular DNA mixture.In the LAMP reaction process, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product---magnesium pyrophosphate milky white precipitate, can be by the visual inspection result of determination.The LAMP reaction is to finish in 45～90 minutes under constant temperature (63～65 ℃) condition.This comparatively gentle temperature condition and do not have temperature cycle that required instrument is oversimplified, overcome conventional P CR inherent detection time long, pollute easily and detect shortcoming such as cost height.In addition, this detection method is lower to testing staff's technical quality requirement, and actually operating is very easy, does not need special reagent and plant and instrument, helps setting up rapid screening system with low cost.The LAMP method is a kind of gene amplification method of easy, quick, high degree of specificity.Constant temperature gene amplification technology and round pcr (comprising the fluorescence real-time quantitative PCR technology) are compared, can find that this technology is equivalent to or is better than round pcr on methodology indexs such as sensitivity, specificity and sensing range, and do not rely on any special plant and instrument and can realize on-the-spot high-throughput rapid detection, and detect cost far below fluorescent quantitative PCR technique.Domestic do not have the test kit of this respect to sell at present as yet.At present in the national standard with microorganism separation and Culture and morphology be accredited as main, in conjunction with the passing method that biochemical analysis and serological typing are identified, preliminary evaluation needs 2～3 days, finishes probation report and needs 10～15 days; Adopt gene quick diagnosis kit of the present invention only to need 2 hours.And, having added colour developing liquid in the reaction solution of the present invention, qualification result is more visual and clear.
Compared with prior art, the present invention has following beneficial effect: 1. gene quick diagnosis kit of the present invention only needs just energy amplified reaction of a steady temperature, does not need special reagent and equipment, and it is low to detect cost; 2. gene quick diagnosis kit of the present invention is used six sections, four primers, and whether the existence that just can judge target substance according to whether increasing to be, so has high specific; 3. gene quick diagnosis kit of the present invention amplification fast and efficient can be finished amplification less than 1 hour, and the productive rate height; 4. gene quick diagnosis kit of the present invention is highly sensitive, and amplification template only needs 10 copies or still less; 5. gene quick diagnosis kit of the present invention is identified easy, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2 +In conjunction with, produce by product one magnesium pyrophosphate precipitation, can identify by visual inspection, and after adding colour developing liquid, yin and yang attribute colour development difference as a result is remarkable, checking rate height, more obviously reliable.
Embodiment
The preparation of embodiment 1 test kit
(1) in the following sequence through the synthetic oligomerization picodna primer of dna synthesizer:
Outer primer F3:GACAGAGCAGGTTGACAC;
Outer primer B3:CCTTCTCCACTATGTAAGACC;
Inner primer FIP:TAGATCGCAGAGCTTCCCGTTTTTACTGTTACACATGCCCAAG;
Inner primer BIP:
GATTGTAGTGTAGCTGGATGGCTTTTATTCCGGCACATTGATGA；
(2) purchase archaeal dna polymerase: the Bst archaeal dna polymerase places container.
(3) preparation reaction solution: reaction solution contains 2mmol/LdNTP, 25mmol/L Tris-Cl, 12.5mmol/L Repone K, 12.5mmol/L ammonium sulfate, 10mmol/L sal epsom, 0.125 volume %TritonX-100,1mol/L trimethyl-glycine, each 2mol/L of inner primer FIP/BIP and each 0.25mol/L of outer primer F3/B3, places container.
(4) purchase reversed transcriptive enzyme: the AMV reversed transcriptive enzyme places container.
(5) purchase the RNA enzyme inhibitors: the RNA enzyme inhibitors places container.
(6) purchase stable liquid: paraffin oil places container.
(7) purchase colour developing liquid: SYBR Green I places container.
(8) extract positive control: extract the plasmid DNA that contains the H5 avian influenza virogene, place container.
(9) above-mentioned 8 containers are dressed up test kit, encapsulation.
Preparation technology is summarized as follows:
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, reaction solution is aseptic subpackaged, and determine the quality inspection of sampling with carrying out concentration according to experiment;
3, with the stable liquid packing, the sampling quality inspection;
4, with the packing of Bst enzyme, the sampling quality inspection;
5, with the reversed transcriptive enzyme packing, the sampling quality inspection;
6, with the packing of RNA enzyme inhibitors, the sampling quality inspection;
7, with the positive control sample preparations, packing, sampling quality inspection;
8, the liquid packing that will develop the color, the sampling quality inspection;
9, assembling test kit.
The preparation of embodiment 2 test kits
The prescription of reaction solution is: reaction solution contains 1.6mmol/LdNTP, 20mmol/LTris-Cl, 10mmol/L Repone K, 10mmol/L ammonium sulfate, 8mmol/L sal epsom, 0.1 volume %TritonX-100,0.8mol/L trimethyl-glycine, each 1.6mol/L of inner primer FIP/BIP and each 0.2mol/L of outer primer F3/B3.
Colour developing liquid is EvaGreen.
Other are with embodiment 1.
The application of embodiment 3H5 avian influenza virus gene quick diagnosis kit
1, sample preparation (template ribonucleic acid extraction)
According to 2.1 sections method collected specimens among the GB/T 18936-2003,
Carry out the sample nucleic acid extraction according to the method for GB/T 19439-2004 and obtain the sample template.
2, the reaction process of loop-mediated isothermal amplification technique
(1) in 200 μ l reaction tubess preparation reaction system: reaction solution 22 μ l, Bst archaeal dna polymerase 0.5 μ l (4U), AMV reversed transcriptive enzyme 0.5 μ l, RNA enzyme inhibitors 0.5 μ l, stable liquid 30 μ l, template ribonucleic acid 2.5 μ l.
(2) with the reaction tubes for preparing in 63 ℃ of isothermal reaction 1h.
3, post-reaction treatment
In above-mentioned reaction tubes, add 2 μ l SYBR Green I, mixing, also add SYBR GreenI mixing in the heliotropism control tube (extraction contains the plasmid DNA of H5 avian influenza virogene) simultaneously, if the same shows green with control tube of reaction tubes is then positive, if reaction tubes manifests orange then negative.
Claims (8)
1, based on the H5 avian influenza viral gene rapid diagnosis kit of loop-mediated isothermal amplification technique, it is characterized in that forming by two pairs of primers, Bst archaeal dna polymerase, reversed transcriptive enzyme, RNA enzyme inhibitors, stable liquid, reaction solution, colour developing liquid and positive control solution, more than eight kinds of liquid place container respectively
Above-mentioned two pairs of primers are:
Outer primer F3:GACAGAGCAGGTTGACAC;
Outer primer B3:CCTTCTCCACTATGTAAGACC;
Inner primer FIP:TAGATCGCAGAGCTTCCCGTTTTTACTGTTACACATGCCCAAG;
Inner primer BIP:GATTGTAGTGTAGCTGGATGGCTTTTATTCCGGCACATTGATGA;
Above-mentioned reaction solution contains 1.6～2mmol/L dNTP, 20～25mmol/L Tris-Cl, 10～12.5mmol/L Repone K, 10～12.5mmol/L ammonium sulfate, 8～10mmol/L sal epsom, 0.1～0.125%TritonX-100,0.8～1mol/L trimethyl-glycine, each 1.6～2mol/L of inner primer FIP/BIP and each 0.2～0.25mol/L of outer primer F3/B3;
Above-mentioned positive control is the plasmid DNA of carrying the H5 avian influenza virogene.
2, test kit according to claim 1 is characterized in that described colour developing liquid is SYBRGreenI or EvaGreen.
3, test kit according to claim 1 is characterized in that described reaction solution contains 2mmol/L dNTP, 25mmol/L Tris-Cl, 12.5mmol/L Repone K, 12.5mmol/L ammonium sulfate, 10mmol/L sal epsom, 0.125%TritonX-100,1mol/L trimethyl-glycine, each 2mol/L of inner primer FIP/BIP and each 0.25mol/L of outer primer F3/B3.
4, utilize the described test kit of claim 1 to detect the method for H5 avian influenza virus, it is characterized in that this method comprises the steps:
(1) collected specimens;
(2) extract sample nucleic acid;
(3) in reaction tubes, add reaction solution 38～40 volume %, Bst archaeal dna polymerase 0.9～1.8 volume %, reversed transcriptive enzyme 0.9～1.8 volume %, RNA enzyme inhibitors 0.9～1.8 volume %, stable liquid 52～54.5 volume %, sample template DNA 4.5～7.3 volume %, isothermal reaction;
(4) in above-mentioned reaction tubes and positive controls, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative.
5,, it is characterized in that in the step (3) that the reaction conditions of isothermal reaction is 63～65 ℃ of temperature, reaction times 45～90min according to the described detection method of claim 4.
6,, it is characterized in that described stable liquid is paraffin oil according to the described detection method of claim 1.
7,, it is characterized in that described reversed transcriptive enzyme is the AMV reversed transcriptive enzyme according to the described detection method of claim 1.
8,, it is characterized in that described colour developing liquid is SYBR Green I or EvaGreen according to the described detection method of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA200810030108XA CN101338345A (en) | 2008-08-12 | 2008-08-12 | H5 avian influenza viral gene rapid diagnosis kit based on ring mediating isothermal amplification technology and detecting process thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA200810030108XA CN101338345A (en) | 2008-08-12 | 2008-08-12 | H5 avian influenza viral gene rapid diagnosis kit based on ring mediating isothermal amplification technology and detecting process thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101338345A true CN101338345A (en) | 2009-01-07 |
Family
ID=40212516
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA200810030108XA Pending CN101338345A (en) | 2008-08-12 | 2008-08-12 | H5 avian influenza viral gene rapid diagnosis kit based on ring mediating isothermal amplification technology and detecting process thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101338345A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845515B (en) * | 2009-12-04 | 2012-01-04 | 山东出入境检验检疫局检验检疫技术中心 | Method for detection of swine influenza A H1N1 virus based on pyrosequencing technology |
| CN103320532A (en) * | 2013-06-09 | 2013-09-25 | 中国人民解放军第四军医大学 | Rapid detection primer group of H7N7 subtype avian influenza virus and use thereof |
| CN105986043A (en) * | 2016-01-29 | 2016-10-05 | 中国动物卫生与流行病学中心 | Method for quickly detecting nucleic acid of H5 subtype highly pathogenic avian influenza virus |
-
2008
- 2008-08-12 CN CNA200810030108XA patent/CN101338345A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845515B (en) * | 2009-12-04 | 2012-01-04 | 山东出入境检验检疫局检验检疫技术中心 | Method for detection of swine influenza A H1N1 virus based on pyrosequencing technology |
| CN103320532A (en) * | 2013-06-09 | 2013-09-25 | 中国人民解放军第四军医大学 | Rapid detection primer group of H7N7 subtype avian influenza virus and use thereof |
| CN105986043A (en) * | 2016-01-29 | 2016-10-05 | 中国动物卫生与流行病学中心 | Method for quickly detecting nucleic acid of H5 subtype highly pathogenic avian influenza virus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101570795B (en) | Mycobacterium tuberculosis gene rapid diagnostic primer based on loop-mediated isothermal amplification technology and use in preparing rapid diagnostic kit | |
| CN101660005B (en) | Rapid diagnostic kit based on loop-mediated isothermal amplification technique for hepatitis A virus genes and detection method thereof | |
| CN101654706B (en) | Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof | |
| CN101008036A (en) | Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology | |
| CN101082581A (en) | Colon bacillus 0157 gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology | |
| CN101403001B (en) | Rapid diagnosis reagent kit and detection method for pseudomonas aeruginosa gene | |
| CN101008039A (en) | EB virus gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology | |
| CN101307356A (en) | Rapid diagnosis kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN101935693A (en) | Mycobacterium tuberculosis detection kit and use method thereof | |
| CN101082580A (en) | vibrio parahaemolyticus gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology | |
| CN101307351A (en) | Rapid diagnosis kit for listeria monocytogenes gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN102094090A (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN101736081A (en) | Kit for rapidly detecting isothermal gene amplification of Mycobacterium tuberculosis and detection method | |
| CN101824468B (en) | Primer group for detecting Yersinia pestis, rapid diagnosis kit and detection method | |
| CN101942508A (en) | Escherichia coli detection kit and use method thereof | |
| CN101338345A (en) | H5 avian influenza viral gene rapid diagnosis kit based on ring mediating isothermal amplification technology and detecting process thereof | |
| CN101403005B (en) | Rapid diagnosis reagent kit and detection method for cholera vibrio gene | |
| CN100478674C (en) | Salmonella gene rapid diagnosis reagent kit based on annular mediated isothermal amplification technology | |
| CN101403004B (en) | Rapid diagnosis reagent kit and detection method for vibrio vulnficus gene | |
| CN102719548B (en) | Kit for detecting brucella and use method thereof | |
| CN101403003B (en) | Rapid diagnosis reagent kit and detection method for staphylococcus epidermidis gene | |
| CN113481326A (en) | Isothermal nucleic acid amplification reaction reagent, isothermal nucleic acid amplification method and application thereof | |
| CN101979660A (en) | Brucella detection kit and using method thereof | |
| CN101824482A (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| CN101418342A (en) | Rapid diagnosis kit of enterocolitis yersinia genus gene based on loop-mediated isothermal amplification technique |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20090107 |