CN103937666B - Concretion mycobacterium nucleic acid quick detection kit and detection method - Google Patents
Concretion mycobacterium nucleic acid quick detection kit and detection method Download PDFInfo
- Publication number
- CN103937666B CN103937666B CN201410185161.2A CN201410185161A CN103937666B CN 103937666 B CN103937666 B CN 103937666B CN 201410185161 A CN201410185161 A CN 201410185161A CN 103937666 B CN103937666 B CN 103937666B
- Authority
- CN
- China
- Prior art keywords
- detection
- nucleic acid
- pipe
- amplification reaction
- built
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The present invention relates to a kind of concretion mycobacterium nucleic acid quick detection kit and detection method.The present invention chooses and guards section four specific primers of design for the distinctive gene order of mycobacterium tuberculosis, under constant temperature, the amplification of target-gene sequence is completed in conjunction with archaeal dna polymerase, thus realize the quick detection to mycobacterium tuberculosis, it is applied to the quick detection of mycobacterium tuberculosis in sputum or swab sample.Test kit sequencing of the present invention operating procedure, achieving the detection of mycobacterium tuberculosis in sputum and swab sample, make operating process easy and controlled, detection process uses stopped pipe detection to add again stabilizing solution simultaneously and prevents and treats aerocolloidal formation, solving pollution problem, result is more reliable.Test kit of the present invention is because of quick, Gao Min, simple to operate, low cost and other advantages applicable detection scene and basic medical unit popularization and application.
Description
Technical field
The present invention relates to the detection kit in biology field, specifically, the present invention relates to a kind of tuberculosis and divide
Branch bacillus nucleic acid rapid detection kit and detection method.
Background technology
Mycobacterium tuberculosis is pathogen lungy.Tuberculosis has become a weight of serious threat human health at present
Big global public health problem, WHO has cooperatively been classified as tuberculosis and AIDS, malaria the primary killers of the mankind, tool
There are the features such as high mortality, high infection rate, end degradation rate.China is that 22 tuberculosis height bear one of country in the world, has super
Cross the infection population of 400,000,000.The existing pulmonary tuberculosis patient of China about 5,000,000, there are about 130,000 people every year and dies from this disease.It was found that felt
In the crowd of dye, the people of 10% can develop into tuberculosis.Therefore, early diagnosis, in time treatment are effectively to control tuberculosis to pass
Broadcast and spread, recover the key that tuberculosis patient is healthy.
At present, clinical diagnosis lungy is mainly according to results such as medical history, rabat, Sputum culturing, smear acid-fast stains.Wherein
There is the deficiencies such as low, the time-consuming length of sensitivity in traditional detection method, some patients easily causes mistaken diagnosis or fails to pinpoint a disease in diagnosis.Immunology detection
Technology is fast and convenient with low cost, but requires the monoclonal antibody of high-quality high stable, and otherwise accuracy is inadequate, is only capable of as auxiliary
Help detection means.Therefore can provide quickly, Gao Min, detection technique special, easy, reliable, that be suitable for clinical practice become
The emphasis of research both at home and abroad.
Protocols in Molecular Biology has the advantages such as sensitive, special, quick, can improve the recall rate of source of disease, to China and
Global disease preventing and treating has important facilitation.But in the most conventional molecular biosciences means, PCR method detection program is relative
Complexity, requires higher to laboratory environment, and electrophoresis experiment easily produces and pollutes the generation causing false positive results simultaneously；Fluorescence
PCR method solves pollution problem, but because the instrument and equipment also difficulty of its costliness carries out basic medical unit popularization and application.
In the detection method of mycobacterium tuberculosis, polymerase chain reaction (PCR) technology for detection mycobacterium tuberculosis has
Sensitivity is high, the feature of high specificity, but this technology there is also the aspect such as easy cross-contamination, time-consuming length in process of clinical application
Problem, in addition to anthropic factor, round pcr must have high-accuracy temperature cycling device in operating process；Though and quantitative fluorescent PCR
So there is the dual specificity of primer and probe, compared with normal PCR, on the specificity that mycobacterium tuberculosis is detected greatly
Improving, but false positive the most easily occurs in its detection and it needs to expensive instrument, cost is high, strengthens popularization and application difficulty.So, and
Time Applied Biotechnology newest fruits develop a kind of Mycobacterium tuberculosis detection kit being suitable to clinical expansion have important
Meaning.
Loop-mediated isothermal amplification technique (LAMP) is the external nucleic acid amplification that grown up after round pcr is novel
Technology, is set up equal to 2000 by Notomit.This technology is by identifying that on target sequence, 6 specific regions and one have chain and put
The archaeal dna polymerase changed, constant temperature realize target sequence quickly, Gao Min, special amplification.This technology need not costliness because of it again
High-accuracy temperature cycling device, only need to complete operation under a stationary temperature, greatly reduces cost and also saves simultaneously
Time, it is more suitable for popularization and application.Obviously, exploitation mycobacterium tuberculosis quickly, Gao Min, special, reliable, be suitable for clinical practice
A kind of test kit is very important.
Summary of the invention
It is an object of the invention to provide a kind of concretion mycobacterium nucleic acid quick detection kit and detection method, to overcome
Prior art specificity, susceptiveness be the highest and the uppity shortcoming of experimental pollution, it is achieved that mycobacterium tuberculosis detected
The simplification of journey, standardization, standardization, rapid.
It is a further object of the present invention to provide a kind of detection kit for Site Detection and basic hospital.
First, the present invention choose for the peculiar gene order of mycobacterium tuberculosis guard section design four specificitys draw
Thing, realizes the amplification of target-gene sequence under constant temperature, thus realizes the inspection to mycobacterium tuberculosis in conjunction with archaeal dna polymerase
Survey.
The present invention chooses the conservative gene fragment of mycobacterium tuberculosis complex, the most again with reference to bacillus calmette-guerin vaccine genome sequence
Carry out bioinformatic analysis, choose specific gene fragment and design four primer specials as target-gene sequence.This genetic fragment
Because of its high conservative, and it is widely present in mycobacterium tuberculosis composite flora, and does not exists in bacillus calmette-guerin vaccine genome sequence
This genetic fragment, therefore choosing of this gene order both can detect all strains of Mycobacterium tuberculosis composite flora, becomes again
Merit differentiated mycobacterium tuberculosis natural infection and the immunity of artificial bacillus calmette-guerin vaccine, it is to avoid artificial bacillus calmette-guerin vaccine immunity is false-positive
Produce, make testing result more reliable.
For shortening the detection time further, simplifying detecting step, this detection kit is optimized by the present invention.First
The processing method of sputum or swab is optimized, and uses boiling method to carry out nucleic acid extraction (containing NP-40 in lysate),
Substantially reduce sample nucleic acid preparation time.
This invention also solves the problem that detection of nucleic acids is easily polluted, employed technical scheme comprise that stopped pipe type prepackage nucleic acid dye
Material detection method.The built-in amplification reaction solution of detection pipe of present invention employing and nucleic acid dye, react and the most repeatedly shake after terminating,
Realize the mixing of amplification reaction solution and nucleic acid dye under conditions of being not switched on lid, also added stabilizing solution in detection pipe simultaneously and prevent
Only aerocolloidal formation during amplified reaction, it is achieved duplicate protection, has effectively eliminated pollution risk.
The concretion mycobacterium nucleic acid quick detection kit of the present invention includes:
(1) sluicing pipe, built-in sample cleaning mixture；
(2) cracking tube, built-in sample lysate；
(3) detection pipe, built-in amplification reaction solution, nucleic acid dye and stabilizing solution, detection pipe every 8 pipe one group is sealed in aluminium foil bag
In；Amplification reaction solution is made up of following component: each 0.1～0.4 μM of outer primer F3 and B3 of amplimer, draws in amplimer
Each 1～2 μM of thing FIP and BIP, dATP, dTTP, dCTP, dGTP each 0.8～2.0mM, MgCl24～10mM, Betaine0.6～
1.2M, Tris-HCl10～40mM, KCl10～20mM, MgSO41～4mM, (NH4) 2SO46～12mM, Triton X-
1000.05%～1.0%, Bst archaeal dna polymerase 8～20U；Nucleic acid dye is dyestuff conventional in molecular biology, including
GeneFinderTM, SYBR Green or GelRed etc.；And nucleic acid dye is first attached to detect the lid inner central position of pipe in advance
Or the tube wall inside front of detection pipe；Stabilizing solution composition is paraffin oil.
(4) negative nucleic acid pipe, the negative solution of the built-in non-infectious DNA fragmentation of nontuberculous mycobacteria gene；
(5) hylon acid tube, built with the positive solution of the non-infectious DNA fragmentation of M. tuberculosis genes；
Amplimer described in above-mentioned concretion mycobacterium nucleic acid quick detection kit is according to mycobacterium tuberculosis
Peculiar gene and design, its nucleotide sequence is as follows:
Outer primer F3:CGCAATCCAGGGAAATGTCA
Outer primer B3:CCCAGTGACGTTGCCTTC
Inner primer FIP:ACGCCTCCGAACCGCTACCTTTTCCTCCTTGACGAGGGGAAG
Inner primer BIP:AATGGGACGCCACGGCTACCTTTTCATTGCCTGACCGGCTT
The method of mycobacterium tuberculosis in sputum or swab sample is detected with the above-mentioned nucleic acid rapid detection kit of the present invention,
Follow these steps to carry out:
(1) sample process, estimates the amount of sputum sample, the NaOH solution of the 4% of 2-4 times of volume of addition, fully mixes, room
Gentle and quiet put liquefaction 10min-20min so that it is fully liquefy；Swab sample is directly stored in swab and preserves in liquid；
(2) sample washing, sputum (or the swab flushing liquor) sample taking liquefaction is transferred in centrifuge tube, centrifugal segregation supernatant
Liquid collects precipitation, with sample cleaning mixture washing precipitation, centrifugal collecting precipitation；
(3) nucleic acid extraction, with the resuspended above-mentioned precipitation of sample lysate, mixing, 100 DEG C of temperature bath cracking 5-15min, puts immediately
In on ice, being then centrifuged for, supernatant is sample form DNA；
(4) sample-adding reaction, takes out detection pipe, and labelling negative control pipe, detection pipe and positive control pipe, distinguish successively respectively
Add negative solution, step (3) supernatant and positive solution, 60 65 DEG C of bar lower part insulation 30-60min；
(5) dyestuff mixing, after above-mentioned steps completes, gets rid of above-mentioned negative control pipe, detection pipe and positive control pipe downwards
Dynamic, make the amplification reaction solution in pipe be sufficiently mixed with dyestuff, be centrifuged and make mixed liquid accumulation bottom pipe；
(6) result interpretation, perusal amplification reaction solution color, if amplification reaction solution presents green, this expression sample
Testing result be positive, if amplification reaction solution presents orange-yellow, represent that the testing result of this sample is feminine gender.
In above-mentioned steps, during result interpretation should should be shown in green according to positive control pipe amplification reaction solution, negative right
Look after amplification reaction solution and should be shown as orange-yellow, otherwise should judge that this experiment is invalid.
Compared with prior art, there is advantages that
1. the concretion mycobacterium nucleic acid quick detection kit of the present invention, applies six sections, and four primers, according to target
Whether gene expands the presence or absence judging target-gene sequence, therefore has a high specific, simultaneously the choosing of Special Targets gene order, can
To distinguish mycobacterium tuberculosis natural infection and the immunity of artificial bacillus calmette-guerin vaccine, this test kit is cloudy to the test results report of bacillus calmette-guerin vaccine
Property；Test kit the most of the present invention is based on isothermal amplification technology, it is achieved that test kit quick, high quick feature, in less than 1 hour i.e.
Can complete augmentation detection, amplification template only needs seldom；Nucleic acid in sputum sample and swab sample is carried by test kit the most of the present invention
The process that takes is optimized respectively, makes operating procedure simplify, standardization；Test kit the most of the present invention only need to setting in temperature constant
Just can react in Bei, it is not necessary to especial equipment requirements, this is low to reduce detection, and the interpolation of nucleic acid dye makes testing result meat
Eye gets final product interpretation, and result becomes apparent from reliably；The whole detection process of test kit the most of the present invention is under totally-enclosed covered state
Carry out, with the addition of again stabilizing solution so that reaction and the result interpretation process of sample to be tested are all complete under the conditions of physical containment simultaneously
Become (PCR pipe lid and stabilizing solution duplicate protection), so this test kit effectively prevents laboratory amplification thing cross-contamination, prevent vacation
The generation of positive findings, is suitable to Site Detection and basic hospital uses.
To sum up, nucleic acid extraction, DNA cloning and result interpretation are organically combined together by test kit of the present invention, it is achieved that inspection
Penetration and promotion is easy in the simplification of survey process, rapid, sequencing and standardization.Test kit of the present invention has than PCR method more
High susceptiveness and specificity, detect quickly and low cost, broken away from the dependence to large-scale instrument, be particularly suitable for during detection
Site Detection and basic hospital use；Whole detection process be when stopped pipe totally-enclosed covered with the addition of simultaneously
Stabilizing solution, plays and prevents cross-contamination and prevent false-positive result from producing, substantially increase the reliability of testing result.This
Bright can realize the early prediction to mycobacterium tuberculosis, the prevention and control to this disease are significant, and have the highest popularization and
Using value.
Detailed description of the invention
The invention will be further described by the following examples.
Embodiment 1 concretion mycobacterium nucleic acid quick detection kit
The test kit of the present invention is formed by with lower component
(1) sluicing pipe, 1, built-in sample cleaning mixture；
(2) cracking tube, 1, built-in sample lysate；
(3) detection pipe, built-in amplification reaction solution, nucleic acid dye and stabilizing solution, detection pipe every 8 pipe one group is sealed in aluminium foil bag
In.Amplification reaction solution is made up of following component: each 0.1～0.4 μM of outer primer F3 and B3 of amplimer, draws in amplimer
Each 1～2 μM of thing FIP and BIP, dATP, dTTP, dCTP, dGTP each 0.8～2.0mM, MgCl24～10mM, Betaine0.6～
1.2M, Tris-HCl10～40mM, KCl10～20mM, MgSO41～4mM, (NH4) 2SO46～12mM, Triton X-
1000.05%～1.0%, Bst archaeal dna polymerase 8～20U；Nucleic acid dye is dyestuff conventional in molecular biology, including
GeneFinderTM, SYBR Green or GelRed etc.；And nucleic acid dye is first attached to detect the lid inner central position of pipe in advance
Or the tube wall inside front of detection pipe；Stabilizing solution composition is paraffin oil.
Primer information is as follows:
Outer primer F3:CGCAATCCAGGGAAATGTCA
Outer primer B3:CCCAGTGACGTTGCCTTC
Inner primer FIP:ACGCCTCCGAACCGCTACCTTTTCCTCCTTGACGAGGGGAAG
Inner primer BIP:AATGGGACGCCACGGCTACCTTTTCATTGCCTGACCGGCTT
(4) negative nucleic acid pipe, 1 pipe, the negative solution of the built-in non-infectious DNA fragmentation of nontuberculous mycobacteria gene；
(5) hylon acid tube, 1 pipe, built with the positive solution of the non-infectious DNA fragmentation of M. tuberculosis genes；
(6) packing box (1), built-in one piece of sponge block having a porous；
(7) operation instructions, 1 part.
The quick detecting method of concretion mycobacterium nucleic acid of embodiment 2 present invention
Use the detection kit of embodiment 1, carry out as follows:
(1) sample washing, sputum (or the swab flushing liquor) sample taking 1ml liquefaction is transferred in centrifuge tube, and 12,000r/
Min is centrifuged 5min and removes supernatant collection precipitation, precipitates 1 time with the washing of sample cleaning mixture, and 12,000r/min are centrifuged 5min collects
Precipitation；
(2) nucleic acid extraction, with the 100 μ resuspended above-mentioned precipitations of l sample lysate, mixing, 100 DEG C of temperature bath cracking 10min, stands
I.e. it is placed in 2min on ice, then 8,000r/min is centrifuged 5min, and supernatant is sample form DNA；
(3) sample-adding reaction, takes out detection pipe, and labelling negative control pipe, detection pipe and positive control pipe, distinguish successively respectively
Add negative solution, step (3) supernatant and the positive each 2 μ l of solution, 65 DEG C of bar lower part insulation 60min；
(4) dyestuff mixing, after above-mentioned steps completes, gets rid of above-mentioned negative control pipe, detection pipe and positive control pipe downwards
Dynamic, make the amplification reaction solution in pipe be sufficiently mixed with dyestuff, be centrifuged and make mixed liquid accumulation bottom pipe；
(5) result interpretation, perusal amplification reaction solution color, if amplification reaction solution presents green, this expression sample
Testing result be positive, if amplification reaction solution presents orange-yellow, represent that the testing result of this sample is feminine gender.
In above-mentioned steps, during result interpretation should should be shown in green according to positive control pipe amplification reaction solution, negative right
Look after amplification reaction solution and should be shown as orange-yellow, otherwise should judge that this experiment is invalid.
Embodiment 3 uses the sensitivity of test kit of the present invention detection concretion mycobacterium nucleic acid
Identify with test kit of the present invention and conventional PCR method respectively
1, use the detection kit of embodiment 1, carry out as follows:
(1) sample process, takes isolated and purified mycobacterium tuberculosis and is once diluted to 1.0 × 106、1.0×105、1.0×
104、1.0×103、1.0×102、1.0×101CFU/mL, each concentration does 3 repetitions；
(2) sample washing, the mycobacterium tuberculosis bacterium solution taking the different gradient concentrations after isolated and purified dilution respectively is each
1ml, transfers in centrifuge tube, and 12,000r/min are centrifuged 5min removes supernatant collection precipitation, by sample cleaning mixture washing precipitation
1 time, 12,000r/min are centrifuged 5min collects precipitation；
(3) nucleic acid extraction, with the 100 μ resuspended above-mentioned precipitations of l sample lysate, mixing, 100 DEG C of temperature bath cracking 10min, stands
I.e. it is placed in 2min on ice, then 8,000r/min is centrifuged 5min, and supernatant is sample form DNA；
(4) sample-adding reaction, takes out detection pipe, respectively labelling negative control pipe, detection pipe (No. 1-18) and positive control pipe,
It is separately added into negative solution, step (3) supernatant and the positive each 2 μ l of solution, 65 DEG C of bar lower part insulation 60min successively；
(5) dyestuff mixing, after above-mentioned steps completes, gets rid of above-mentioned negative control pipe, detection pipe and positive control pipe downwards
Dynamic, make the amplification reaction solution in pipe be sufficiently mixed with dyestuff, be centrifuged and make mixed liquid accumulation bottom pipe；
(6) result interpretation, perusal amplification reaction solution color, show that negative control pipe amplification reaction solution is orange-yellow,
Positive control pipe amplification reaction solution is green；Detection No. 17 amplification reaction solutions of pipe are that orange-yellow result interpretation is for negative；Other inspections
Test tube amplification reaction solution is green, and result interpretation is positive.
2, Standard PCR detection kit is used
(1) sample process, sample washs, and nucleic acid extraction is consistent with step in embodiment 1；
(2) PCR primer, reaction uses outer primer F3 and B3 in this method reaction；
(3) PCR reaction, PCR system is 25 μ l systems, and reactant liquor is made up of following component: 10 × PCR buffer2.5 μ l
(PCR reaction buffer, TAKARA company), 10mM dNTPs2 μ l (TAKARA company), each 1ul of primers F 3 and B3, Taq enzyme
0.15 μ l (5U/ μ l, TAKARA company), template DNA 2 μ l, finally mend to 25 μ l volumes with aquesterilisa.
(4) response procedures, 95 DEG C of denaturations 5min；95 DEG C of degeneration 30S, 58 DEG C of annealing 30S, 72 DEG C extend 30S, and 30 are followed
Ring；72 DEG C extend 10min.
(5) PCR primer takes 10 μ l and 1% agarose gel electrophoresis, 100V voltage 30min, observes；Result shows, PCR examines
Survey method detection concentration of specimens is 1.0 × 102、1.0×101CFU/mL is without the amplification of purpose band, and result interpretation is negative；Its
His concentration of specimens has the amplification of purpose band to be the positive.
Compared by both the above method it can be seen that the nucleic acid rapid detection kit sensitivity of the present invention can arrive 1.0
×101The concentration of CFU/mL, and the sensitivity of Standard PCR detection method is 1.0 × 103The concentration of CFU/mL is positive, 1.0 ×
102CFU/mL and following concentration results are illustrated as feminine gender, by contrast, and the nucleic acid rapid detection kit sensitivity of the present invention
Apparently higher than the sensitivity of PCR method, the sample of lower concentration content can be detected.
Embodiment 4 specificity of test kit of the present invention detection mycobacterium tuberculosis
According to the method for embodiment 3, respectively to isolated and purified mycobacterium tuberculosis, Mycobacterium avium, Kansas branch
Bacillus, shigella, Salmonella, staphylococcus aureus are identified.
Testing result shows, Mycobacterium avium, mycobacterium kansasii, shigella, Salmonella, Staphylococcus aureus
Bacterium detection pipe amplification reaction solution is orange-yellow, i.e. result interpretation is negative；The detection pipe amplification reaction solution of mycobacterium tuberculosis
For green, result interpretation is positive.This result with Standard PCR result always, demonstrates good specificity.
Reagent needed for the present invention and material: primer is synthesized by Shanghai biological engineering Co., Ltd；Glycine betaine
(betaine)、dNTP、KCl、MgSO4、(NH4)2SO4、MgCl2, NP-40, purchased from Shanghai biological engineering Co., Ltd；Purchase
From traditional Chinese medicines group chemical reagent Beijing company limited；The BstDNA polymerase of constant-temperature amplification is purchased from NEB company；Nucleic acid dye
GenefinderTMPurchased from Xiamen Baiweixin Biological Technology Co., Ltd..
Claims (4)
1. a concretion mycobacterium nucleic acid quick detection kit, it is characterised in that this detection kit includes:
(1) sluicing pipe, built-in sample cleaning mixture；
(2) cracking tube, built-in sample lysate；
(3) detection pipe, built-in amplification reaction solution, nucleic acid dye and stabilizing solution, detection pipe every 8 pipe one group is sealed in aluminium foil bag；
(4) negative nucleic acid pipe, the negative solution of the built-in non-infectious DNA fragmentation of nontuberculous mycobacteria gene；
(5) hylon acid tube, built with the positive solution of the non-infectious DNA fragmentation of M. tuberculosis genes；
Above-mentioned amplification reaction solution is made up of following component: each 0.1～0.4 μM of outer primer F3 and B3 of amplimer, amplimer
Each 1～2 μM of inner primer FIP and BIP, dATP, dTTP, dCTP, dGTP each 0.8～2.0mM, MgCl24～10mM,
Betaine 0.6～1.2M, Tris-HCl 10～40mM, KCl 10～20mM, MgSO41～4mM, (NH4)2SO46～
12mM, Triton X-100 0.05%～1.0%, Bst archaeal dna polymerase 8～20U；Amplimer in above-mentioned amplification reaction solution
Nucleotide sequence as follows:
Outer primer F3:CGCAATCCAGGGAAATGTCA
Outer primer B3:CCCAGTGACGTTGCCTTC
Inner primer FIP:ACGCCTCCGAACCGCTACCTTTTCCTCCTTGACGAGGGGAAG
Inner primer BIP:AATGGGACGCCACGGCTACCTTTTCATTGCCTGACCGGCTT.
2. detection kit as claimed in claim 1, it is characterised in that above-mentioned nucleic acid dye is conventional in molecular biology
Dyestuff, including GeneFinderTM, SYBR Green or GelRed.
3. detection kit as claimed in claim 1, it is characterised in that in above-mentioned detection pipe, nucleic acid dye adheres to inspection in advance
The lid inner central position of test tube or the tube wall inside front of detection pipe.
4. detection kit as claimed in claim 1, it is characterised in that in amplification reaction solution, amplimer is according to tuberculosis branch
Bacillus east gene and the primer that designs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410185161.2A CN103937666B (en) | 2014-05-04 | 2014-05-04 | Concretion mycobacterium nucleic acid quick detection kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410185161.2A CN103937666B (en) | 2014-05-04 | 2014-05-04 | Concretion mycobacterium nucleic acid quick detection kit and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103937666A CN103937666A (en) | 2014-07-23 |
| CN103937666B true CN103937666B (en) | 2016-08-24 |
Family
ID=51185546
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410185161.2A Active CN103937666B (en) | 2014-05-04 | 2014-05-04 | Concretion mycobacterium nucleic acid quick detection kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103937666B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108265105A (en) * | 2018-03-26 | 2018-07-10 | 郑州安图生物工程股份有限公司 | For quickly carrying out the sputum pre-treating method of detection of nucleic acids |
| CN112391486B (en) * | 2021-01-21 | 2021-04-23 | 中国农业大学 | Rapid closed tube visual detection kit for salmonella and detection method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101285062A (en) * | 2008-04-29 | 2008-10-15 | 博奥生物有限公司 | Process for abstracting bacterial DNA from phlegm, kit and uses thereof |
| CN101302553A (en) * | 2008-05-30 | 2008-11-12 | 广州华峰生物科技有限公司 | Mycobacterium tuberculosis gene rapid diagnosis reagent kit base on loop-mediated isothermal amplification technology and detection method thereof |
| CN101935693A (en) * | 2010-01-18 | 2011-01-05 | 广州华峰生物科技有限公司 | Mycobacterium tuberculosis detection kit and use method thereof |
| CN102277440A (en) * | 2011-08-30 | 2011-12-14 | 浙江省疾病预防控制中心 | Kit and method for quickly detecting mycobacterium tuberculosis and nontuberculous mycobacteria |
| CN102373273A (en) * | 2010-08-26 | 2012-03-14 | 杭州优思达生物技术有限公司 | Kit for detecting nucleic acid of mycobacterium tuberculosis and method thereof |
-
2014
- 2014-05-04 CN CN201410185161.2A patent/CN103937666B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101285062A (en) * | 2008-04-29 | 2008-10-15 | 博奥生物有限公司 | Process for abstracting bacterial DNA from phlegm, kit and uses thereof |
| CN101302553A (en) * | 2008-05-30 | 2008-11-12 | 广州华峰生物科技有限公司 | Mycobacterium tuberculosis gene rapid diagnosis reagent kit base on loop-mediated isothermal amplification technology and detection method thereof |
| CN101935693A (en) * | 2010-01-18 | 2011-01-05 | 广州华峰生物科技有限公司 | Mycobacterium tuberculosis detection kit and use method thereof |
| CN102373273A (en) * | 2010-08-26 | 2012-03-14 | 杭州优思达生物技术有限公司 | Kit for detecting nucleic acid of mycobacterium tuberculosis and method thereof |
| CN102277440A (en) * | 2011-08-30 | 2011-12-14 | 浙江省疾病预防控制中心 | Kit and method for quickly detecting mycobacterium tuberculosis and nontuberculous mycobacteria |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103937666A (en) | 2014-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bialek et al. | Detection of Cryptococcus neoformans DNA in tissue samples by nested and real-time PCR assays | |
| Zhu et al. | Use of visual loop-mediated isotheral amplification of rimM sequence for rapid detection of Mycobacterium tuberculosis and Mycobacterium bovis | |
| André et al. | Novel rapid PCR for the detection of Ile491Phe rpoB mutation of Mycobacterium tuberculosis, a rifampicin-resistance-conferring mutation undetected by commercial assays | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN106434888A (en) | Method and primers for rapid isothermal detection of staphylococcus aureus and application of primers | |
| Weiss et al. | An extended multilocus sequence typing (MLST) scheme for rapid direct typing of Leptospira from clinical samples | |
| CN102747165B (en) | Reagent kit and method for quickly detecting tilapia streptococcus agalactiae by using loop-mediated isothermal amplification technology | |
| CN102181541B (en) | Kit for specific PCR (polymerase chain reaction) detection of pneumocystis and detection method thereof | |
| CN101487057A (en) | Loop-mediated isothermal amplification fast detecting reagent kit and method for O157:H7 coliform | |
| CN106893782A (en) | One kind detection simultaneously identifies cryptococcal target gene, primer and probe and kit | |
| CN102816847A (en) | LAMP primer for detecting Brucella and kit containing the same | |
| CN103725798A (en) | Primer, kit and detection method of detecting haemorrhagic fever with renal syndrome virus by RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) method | |
| CN101712973A (en) | Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof | |
| Pan et al. | Comparison of four DNA extraction methods for detecting Mycobacterium tuberculosis by real-time PCR and its clinical application in pulmonary tuberculosis | |
| CN106148502A (en) | A kind of high throughput method directly detecting food source pathogenic bacteria | |
| CN101376912A (en) | Loop-mediated isothermal amplification detection kit of influenza A3 viruses and detecting method | |
| CN103937666B (en) | Concretion mycobacterium nucleic acid quick detection kit and detection method | |
| CN104450961A (en) | Kit for detecting grass carp reovirus types I, II and III based on RT-LAMP visualization technology and method for detecting grass carp reovirus types I, II and III | |
| CN101225440B (en) | Detection method of leptospira | |
| CN107022638A (en) | The LAMP primer group of quick detection salmonella and its application | |
| Bruisten | Protocols for detection and typing of Treponema pallidum using PCR methods | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| CN112501324A (en) | Primer and kit for detecting mycobacterium tuberculosis complex and nontuberculous mycobacterium complex based on loop-mediated isothermal amplification | |
| CN102286623A (en) | Method for quickly identifying life or death of Mycobacterium tuberculosis | |
| CN102277439A (en) | Rapid detection kit for goat contagious pleuropneumonia and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |