CN103937666A - Rapid detection kit and detection method for mycobacterium tuberculosis - Google Patents
Rapid detection kit and detection method for mycobacterium tuberculosis Download PDFInfo
- Publication number
- CN103937666A CN103937666A CN201410185161.2A CN201410185161A CN103937666A CN 103937666 A CN103937666 A CN 103937666A CN 201410185161 A CN201410185161 A CN 201410185161A CN 103937666 A CN103937666 A CN 103937666A
- Authority
- CN
- China
- Prior art keywords
- sample
- detection
- amplification reaction
- reaction solution
- mycobacterium tuberculosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a rapid detection kit and a detection method for mycobacterium tuberculosis. According to the rapid detection kit and the detection method, four specific primers are designed aiming at the specific gene sequence conservation segments of mycobacterium tuberculosis and a target gene sequence is amplified under the condition of constant temperature in combination with a DNA polymerase, so that the mycobacterium tuberculosis is detected rapidly. The rapid detection kit and the detection method are applicable to the rapid detection on mycobacterium tuberculosis in a sputum or swab sample. By virtue of the rapid detection kit, the operation steps are programmed, the detection on mycobacterium tuberculosis in the sputum and the swab sample is achieved, and the operation process is simple and controllable; in the detection process, closed pipe type detection is adopted and a stabilizing liquid is added for preventing aerosol from being formed, so that the pollution problem is solved and the result is reliable. The kit has the advantages of being high in speed and sensitivity, simple to operate, low in cost and the like, thereby being suitable to popularization and application on detection sites and in primary medical institutions.
Description
Technical field
The present invention relates to the detection kit in biology field, specifically, the present invention relates to a kind of concretion mycobacterium nucleic acid quick detection kit and detection method.
Background technology
Mycobacterium tuberculosis is pathogenic agent lungy.Tuberculosis has become a great global public health problem of serious threat human health at present, and WHO has jointly classified tuberculosis as the mankind's main killer together with AIDS, malaria, has high mortality, high infection rate, the features such as end degradation rate.China is that 22 tuberculosis height are born one of country in the world, has the infection population that exceedes 400,000,000.The existing pulmonary tuberculosis patient of China approximately 5,000,000, approximately has 130,000 people to die from this disease every year.According to the study, in infected crowd, 10% people can be developed into tuberculosis.Therefore, early diagnosis, treatment are in time effectively to control transmission of tuberculosis to spread, and recover the key of tuberculosis patient health.
At present, clinical diagnosis lungy is mainly according to results such as medical history, rabat, phlegm cultivation, smear acid-fast stains.There is the deficiencies such as sensitivity is low, length consuming time in traditional detection method wherein, easily some patients were caused mistaken diagnosis or failed to pinpoint a disease in diagnosis.Immunology detection technology is fast and convenient with low cost, but requires the monoclonal antibody of high quality high stable, otherwise accuracy is inadequate, only can serve as auxiliary detection means.Therefore can provide fast, Gao Min, the emphasis that special, easy, reliable, detection technique that be applicable to clinical application has become domestic and international research.
The advantages such as it is sensitive, special, quick that Protocols in Molecular Biology has, can improve the recall rate of pathogeny, and there are to important promoter action in China and global diseases prevention and treatment.But at present conventional molecular biosciences means, PCR method trace routine relative complex, has relatively high expectations to laboratory environment, electrophoresis experiment very easily produces and pollutes the generation that causes false positive results simultaneously; Fluorescence PCR method has solved pollution problem, but applies because its expensive plant and instrument also difficulty carries out basic medical unit.
In the detection method of mycobacterium tuberculosis, it is high that polymerase chain reaction (PCR) technology for detection mycobacterium tuberculosis has susceptibility, the feature of high specificity, but also there is the aspect problems such as easy crossed contamination, length consuming time in this technology in process of clinical application, except human factor, round pcr must have high-accuracy temperature cycling device in operating process; Although and quantitative fluorescent PCR has the dual specificity of primer and probe, compared with normal PCR, greatly improve in the specificity that mycobacterium tuberculosis is detected, but it detects and is also prone to false positive, and needing expensive instrument, cost is high, strengthens and applies difficulty.So the in time newest fruits of Applied Biotechnology exploitation is a kind of, and to be suitable for the Mycobacterium tuberculosis detection kit of clinical expansion significant.
Loop-mediated isothermal amplification technique (LAMP) is the novel isothermal DNA amplification growing up after round pcr, is equaled to set up for 2000 by Notomit.This technology is by 6 special regions and a kind of archaeal dna polymerase with strand displacement on identification target sequence, constant temperature realize target sequence fast, Gao Min, special amplification.This technology does not need expensive high-accuracy temperature cycling device because of it again, only need be under a constant temp complete operation, greatly reduce cost and also saved the time simultaneously, be more suitable for applying.Obviously, exploitation mycobacterium tuberculosis fast, Gao Min, a kind of test kit special, reliable, that be applicable to clinical application be very important.
Summary of the invention
The object of this invention is to provide a kind of concretion mycobacterium nucleic acid quick detection kit and detection method, to overcome the not high and uppity shortcoming of experimental pollution of prior art specificity, susceptibility, simplification, stdn, the standardization, rapid of mycobacterium tuberculosis testing process are realized.
Another object of the present invention is to provide a kind of detection kit for Site Detection and basic hospital.
First, the present invention chooses for conservative four Auele Specific Primers of section design of the peculiar gene order of mycobacterium tuberculosis, realizes the amplification of target-gene sequence in conjunction with archaeal dna polymerase under constant temperature, thereby realizes the detection to mycobacterium tuberculosis.
The present invention chooses the conservative gene fragment of mycobacterium tuberculosis complex, carries out bioinformatic analysis again with reference to bacille Calmette-Guerin vaccine genome sequence simultaneously, chooses specific gene fragment as four primer specials of target-gene sequence design.This gene fragment is because of its high conservative, and be extensively present in mycobacterium tuberculosis composite flora, and in bacille Calmette-Guerin vaccine genome sequence, there is not this gene fragment, therefore choosing of this gene order both can detect all bacterial classifications of Mycobacterium tuberculosis composite flora, mycobacterium tuberculosis natural infection and artificial bacille Calmette-Guerin vaccine immunity are successfully differentiated again, avoid the false-positive generation of artificial bacille Calmette-Guerin vaccine immunity, made detected result more reliable.
For further shortening detection time, simplifying detecting step, the present invention is optimized this detection kit.First the treatment process of sputum or swab is optimized, and adopts boiling method to carry out nucleic acid extraction (containing NP-40 in lysate), greatly shortened sample nucleic acid preparation time.
The present invention has also solved the problem that detection of nucleic acids is easily polluted, and the technical scheme adopting is stopped pipe type prepackage nucleic acid dye detection method.The built-in amplification reaction solution of detector tube and nucleic acid dye that the present invention adopts; reaction finishes rear concussion repeatedly up and down; under the condition of not opening pipe lid, realize mixing of amplification reaction solution and nucleic acid dye; in detector tube, also add stable liquid simultaneously and prevented aerocolloidal formation in amplified reaction process; realize duplicate protection, effectively eliminated Pollution risk.
Concretion mycobacterium nucleic acid quick detection kit of the present invention comprises:
(1) sluicing pipe, in-built sample washings;
(2) cracking tube, in-built sample lysate;
(3) detector tube, in-built amplification reaction solution, nucleic acid dye and stable liquid, the every 8 pipe seal stacks of detector tube are in aluminium foil bag; Amplification reaction solution is made up of following component: each 0.1～0.4 μ M of the outer primer F3 of amplimer and B3, each 1～2 μ M of the inner primer FIP of amplimer and BIP, dATP, dTTP, the each 0.8～2.0mM of dCTP, dGTP, MgCl24～10mM, Betaine0.6～1.2M, Tris-HCl10～40mM, KCl10～20mM, MgSO41～4mM, (NH4) 2SO46～12mM, Triton X-1000.05%～1.0%, Bst archaeal dna polymerase 8～20U; Nucleic acid dye is dyestuff conventional in molecular biology, comprises GeneFinder
tM, SYBR Green or GelRed etc.; And nucleic acid dye adheres to the tube wall inside front of middle position inside the pipe lid of detector tube or detector tube in advance; Stable liquid composition is paraffin oil.
(4) negative nucleic acid pipe, the negative solution of the non-infectious DNA fragmentation of in-built nontuberculous mycobacteria gene;
(5) positive nucleus acid tube, is inside equipped with the positive solution of the non-infectious DNA fragmentation of mycobacterium tuberculosis gene;
Amplimer described in above-mentioned concretion mycobacterium nucleic acid quick detection kit designs according to the peculiar gene of mycobacterium tuberculosis, and its nucleotide sequence is as follows:
Outer primer F3:CGCAATCCAGGGAAATGTCA
Outer primer B3:CCCAGTGACGTTGCCTTC
Inner primer FIP:ACGCCTCCGAACCGCTACCTTTTCCTCCTTGACGAGGGGAAG
Inner primer BIP:AATGGGACGCCACGGCTACCTTTTCATTGCCTGACCGGCTT
The method that detects mycobacterium tuberculosis in sputum or swab sample with the above-mentioned nucleic acid rapid detection kit of the present invention, follows these steps to carry out:
(1) sample process, estimates the amount of sputum sample, adds 4% NaOH solution of 2-4 times of volume, fully mixes, and room temperature leaves standstill liquefaction 10min-20min, and it is fully liquefied; Swab sample is directly stored in swab and preserves in liquid;
(2) sample washing, gets sputum (or the swab washing fluid) sample of liquefaction and transfers in centrifuge tube, and centrifugal removal supernatant liquor collecting precipitation, with the washing precipitation of sample washings, centrifugal collecting precipitation;
(3) nucleic acid extraction, by the resuspended above-mentioned precipitation of sample lysate, mixes, and 100 DEG C of temperature are bathed cracking 5-15min, are placed in immediately on ice, and then centrifugal, supernatant liquor is sample template DNA;
(4) application of sample reaction, takes out detector tube, and mark negative control pipe, detector tube and positive control pipe, add respectively negative solution, step (3) supernatant liquor and positive solution successively respectively, part insulation 30-60min under 60 65 DEG C of – bars;
(5) dyestuff mix, after above-mentioned steps completes, by above-mentioned negative control pipe, detector tube and the downward whipping of positive control pipe, the amplification reaction solution in pipe is fully mixed with dyestuff, centrifugal make mixed liquid be gathered in pipe bottom;
(6) result interpretation, visual inspection amplification reaction solution color, green if amplification reaction solution presents, the detected result of this expression sample is positive, orange-yellow if amplification reaction solution presents, and represents that the detected result of this sample is negative.
In above-mentioned steps, should should be shown in green according to positive control pipe amplification reaction solution when result interpretation, negative control pipe amplification reaction solution should be shown as orange-yellow, otherwise should judge that this experiment is invalid.
Compared with prior art, the present invention has following beneficial effect:
1. concretion mycobacterium nucleic acid quick detection kit of the present invention, apply six sections, article four, primer, whether increase and judge having or not of target-gene sequence according to target gene, therefore there is high specific, choosing of Special Targets gene order simultaneously, can distinguish mycobacterium tuberculosis natural infection and artificial bacille Calmette-Guerin vaccine immunity, and this test kit is negative to the test results report of bacille Calmette-Guerin vaccine; 2. test kit of the present invention, based on isothermal amplification technology, has been realized the quick of test kit, and high quick feature can complete augmentation detection in less than 1 hour, and amplification template only needs seldom; 3. test kit of the present invention is optimized respectively the nucleic acid extraction process in sputum sample and swab sample, operation steps is simplified, standardization; 4. test kit of the present invention only need just can react in the equipment of homo(io)thermism, does not need especial equipment requirements, and this is low to have reduced detection, and the interpolation of nucleic acid dye makes detected result naked eyes get final product interpretation, and result is more obviously reliable; 5. the whole testing process of test kit of the present invention is carried out under totally-enclosed covered state; add again stable liquid simultaneously; reaction and the result interpretation process of sample to be tested all completed under physical containment condition (PCR pipe lid and stable liquid duplicate protection); so this test kit effectively prevents laboratory amplified material crossed contamination; prevent the generation of false positive results, be suitable for Site Detection and basic hospital and use.
To sum up, test kit of the present invention organically combines nucleic acid extraction, DNA cloning and result interpretation together, has realized the simplification of testing process, rapid, sequencing and stdn and has been convenient to penetration and promotion.Test kit of the present invention has the susceptibility higher than PCR method and specificity, and detection is quick and cost is low, has broken away from the dependence to large-scale instrument in testing process, is particularly suitable for Site Detection and basic hospital and uses; Whole testing process is to have added stable liquid under the totally-enclosed covered state of stopped pipe simultaneously, plays and prevents crossed contamination and prevent that false-positive result from producing, and improved the reliability of detected result greatly.The present invention can realize the early prediction to mycobacterium tuberculosis, significant to the prevention and control of this disease, is worth and have very high promotion and application.
Embodiment
The invention will be further described by the following examples.
Embodiment 1 concretion mycobacterium nucleic acid quick detection kit
Test kit of the present invention is by forming with lower component
(1) sluicing pipe, 1, in-built sample washings;
(2) cracking tube, 1, in-built sample lysate;
(3) detector tube, in-built amplification reaction solution, nucleic acid dye and stable liquid, the every 8 pipe seal stacks of detector tube are in aluminium foil bag.Amplification reaction solution is made up of following component: each 0.1～0.4 μ M of the outer primer F3 of amplimer and B3, each 1～2 μ M of the inner primer FIP of amplimer and BIP, dATP, dTTP, the each 0.8～2.0mM of dCTP, dGTP, MgCl24～10mM, Betaine0.6～1.2M, Tris-HCl10～40mM, KCl10～20mM, MgSO41～4mM, (NH4) 2SO46～12mM, Triton X-1000.05%～1.0%, Bst archaeal dna polymerase 8～20U; Nucleic acid dye is dyestuff conventional in molecular biology, comprises GeneFinder
tM, SYBR Green or GelRed etc.; And nucleic acid dye adheres to the tube wall inside front of middle position inside the pipe lid of detector tube or detector tube in advance; Stable liquid composition is paraffin oil.
Primer information is as follows:
Outer primer F3:CGCAATCCAGGGAAATGTCA
Outer primer B3:CCCAGTGACGTTGCCTTC
Inner primer FIP:ACGCCTCCGAACCGCTACCTTTTCCTCCTTGACGAGGGGAAG
Inner primer BIP:AATGGGACGCCACGGCTACCTTTTCATTGCCTGACCGGCTT
(4) negative nucleic acid pipe, 1 pipe, the negative solution of the non-infectious DNA fragmentation of in-built nontuberculous mycobacteria gene;
(5) positive nucleus acid tube, 1 manages, and the positive solution of the non-infectious DNA fragmentation of mycobacterium tuberculosis gene is inside housed;
(6) packing box (1), an in-built sponge block that has a porous;
(7) working instructions, 1 part.
The quick detecting method of embodiment 2 concretion mycobacterium nucleic acid of the present invention
Use the detection kit of embodiment 1, carry out as follows:
(1) sample washing, gets sputum (or the swab washing fluid) sample of 1ml liquefaction and transfers in centrifuge tube, 12, the centrifugal 5min of 000r/min removes supernatant liquor collecting precipitation, with sample washings washing precipitation 1 time, the centrifugal 5min collecting precipitation of 12,000r/min;
(2) nucleic acid extraction, by the resuspended above-mentioned precipitation of 100 μ l sample lysate, mixes, and 100 DEG C of temperature are bathed cracking 10min, are placed in immediately 2min on ice, and then 8, the centrifugal 5min of 000r/min, supernatant liquor is sample template DNA;
(3) application of sample reaction, takes out detector tube, and mark negative control pipe, detector tube and positive control pipe, add respectively the each 2 μ l of negative solution, step (3) supernatant liquor and positive solution successively respectively, part insulation 60min under 65 DEG C of bars;
(4) dyestuff mix, after above-mentioned steps completes, by above-mentioned negative control pipe, detector tube and the downward whipping of positive control pipe, the amplification reaction solution in pipe is fully mixed with dyestuff, centrifugal make mixed liquid be gathered in pipe bottom;
(5) result interpretation, visual inspection amplification reaction solution color, green if amplification reaction solution presents, the detected result of this expression sample is positive, orange-yellow if amplification reaction solution presents, and represents that the detected result of this sample is negative.
In above-mentioned steps, should should be shown in green according to positive control pipe amplification reaction solution when result interpretation, negative control pipe amplification reaction solution should be shown as orange-yellow, otherwise should judge that this experiment is invalid.
Embodiment 3 uses test kit of the present invention to detect the sensitivity of concretion mycobacterium nucleic acid
Identify by test kit of the present invention and conventional PCR method respectively
1, use the detection kit of embodiment 1, carry out as follows:
(1) sample process, it is 1.0 × 10 that the mycobacterium tuberculosis of getting separation and purification once dilutes
6, 1.0 × 10
5, 1.0 × 10
4, 1.0 × 10
3, 1.0 × 10
2, 1.0 × 10
1cFU/mL, each concentration is done 3 repetitions;
(2) sample washing, get respectively the each 1ml of mycobacterium tuberculosis bacterium liquid of the different gradient concentrations after separation and purification dilution, transfer in centrifuge tube, 12, the centrifugal 5min of 000r/min removes supernatant liquor collecting precipitation, with sample washings washing precipitation 1 time, the centrifugal 5min collecting precipitation of 12,000r/min;
(3) nucleic acid extraction, by the resuspended above-mentioned precipitation of 100 μ l sample lysate, mixes, and 100 DEG C of temperature are bathed cracking 10min, are placed in immediately 2min on ice, and then 8, the centrifugal 5min of 000r/min, supernatant liquor is sample template DNA;
(4) application of sample reaction, take out detector tube, mark negative control pipe, detector tube (No. 1-18) and positive control pipe, add respectively the each 2 μ l of negative solution, step (3) supernatant liquor and positive solution successively respectively, part insulation 60min under 65 DEG C of bars;
(5) dyestuff mix, after above-mentioned steps completes, by above-mentioned negative control pipe, detector tube and the downward whipping of positive control pipe, the amplification reaction solution in pipe is fully mixed with dyestuff, centrifugal make mixed liquid be gathered in pipe bottom;
(6) result interpretation, visual inspection amplification reaction solution color, shows that negative control pipe amplification reaction solution is orange-yellow, positive control pipe amplification reaction solution is green; No. 17 amplification reaction solutions of detector tube are that orange-yellow result interpretation is negative; Other detector tube amplification reaction solutions are green, and result interpretation is positive.
2, use conventional PCR detection kit
(1) sample process, sample washing, nucleic acid extraction is consistent with step in embodiment 1;
(2) PCR primer, reaction adopts outer primer F3 and the B3 in present method reaction;
(3) PCR reaction, PCR system is 25 μ l systems, reaction solution is made up of following component: 10 × PCR buffer2.5 μ l (PCR reaction buffer, TAKARA company), 10mM dNTPs2 μ l (TAKARA company), the each 1ul of primers F 3 and B3, Taq enzyme 0.15 μ l (5U/ μ l, TAKARA company), template DNA 2 μ l, finally mend to 25 μ l volumes with aqua sterilisa.
(4) response procedures, 95 DEG C of denaturation 5min; 95 DEG C of sex change 30S, 58 DEG C of annealing 30S, 72 DEG C are extended 30S, 30 circulations; 72 DEG C are extended 10min.
(5) PCR product is got 10 μ l and 1% agarose gel electrophoresis, and 100V voltage 30min observes; Result demonstration, it is 1.0 × 10 that PCR detection method detects concentration of specimens
2, 1.0 × 10
1cFU/mL is without the amplification of object band, and result interpretation is negative; Other concentration of specimens have the amplification of object band positive.
Relatively can be found out by above two kinds of methods, nucleic acid rapid detection kit sensitivity of the present invention can arrive 1.0 × 10
1the concentration of CFU/mL, and the sensitivity of conventional PCR detection method is 1.0 × 10
3the concentration of CFU/mL is positive, and 1.0 × 10
2cFU/mL and following concentration results are all shown as feminine gender, and through contrast, nucleic acid rapid detection kit sensitivity of the present invention, apparently higher than the sensitivity of PCR method, can detect the sample of lower concentration content.
Embodiment 4 use test kit of the present invention detects the specificity of mycobacterium tuberculosis
According to the method for embodiment 3, the mycobacterium tuberculosis to separation and purification, mycobacterium avium, mycobacterium kansasii, Shigellae, Salmonellas, streptococcus aureus are identified respectively.
Detected result demonstration, mycobacterium avium, mycobacterium kansasii, Shigellae, Salmonellas, streptococcus aureus detector tube amplification reaction solution are orange-yellow, i.e. and result interpretation is negative; The detector tube amplification reaction solution of mycobacterium tuberculosis is green, and result interpretation is positive.This result and conventional PCR result always, demonstrate good specificity.
Reagent required for the present invention and material: primer is synthetic by Shanghai biotechnology limited liability company; Trimethyl-glycine (betaine), dNTP, KCl, MgSO4, (NH4)
2sO4, MgCl
2, NP-40, purchased from Shanghai biotechnology limited liability company; Purchased from traditional Chinese medicines group chemical reagent Beijing company limited; The BstDNA polysaccharase that constant-temperature amplification is used is purchased from NEB company; Nucleic acid dye Genefinder
tMpurchased from Xiamen Baiweixin Biological Technology Co., Ltd..
Claims (9)
1. a concretion mycobacterium nucleic acid quick detection kit, is characterized in that this detection kit comprises:
(1) sluicing pipe, in-built sample washings;
(2) cracking tube, in-built sample lysate;
(3) detector tube, in-built amplification reaction solution, nucleic acid dye and stable liquid, the every 8 pipe seal stacks of detector tube are in aluminium foil bag;
(4) negative nucleic acid pipe, the negative solution of the non-infectious DNA fragmentation of in-built nontuberculous mycobacteria gene;
(5) positive nucleus acid tube, is inside equipped with the positive solution of the non-infectious DNA fragmentation of mycobacterium tuberculosis gene.
2. detection kit as claimed in claim 1, is characterized in that above-mentioned nucleic acid dye is dyestuff conventional in molecular biology, comprises GeneFinder
tM, SYBR Green or GelRed.
3. detection kit as claimed in claim 1, is characterized in that nucleic acid dye in above-mentioned detector tube adheres to the tube wall inside front of middle position inside the pipe lid of detector tube or detector tube in advance.
4. detection kit as claimed in claim 1, it is characterized in that above-mentioned amplification reaction solution is made up of following component: each 0.1～0.4 μ M of the outer primer F3 of amplimer and B3, each 1～2 μ M of the inner primer FIP of amplimer and BIP, dATP, dTTP, the each 0.8～2.0mM of dCTP, dGTP, MgCl24～10mM, Betaine0.6～1.2M, Tris-HCl10～40mM, KCl10～20mM, MgSO41～4mM, (NH4) 2SO46～12mM, Triton X-1000.05%～1.0%, Bst archaeal dna polymerase 8～20U.
5. detection kit as claimed in claim 4, is characterized in that the primer that in amplification reaction solution, amplimer designs according to mycobacterium tuberculosis east gene.
6. detection kit as claimed in claim 4, is characterized in that in amplification reaction solution, the nucleotide sequence of amplimer is as follows:
Outer primer F3:CGCAATCCAGGGAAATGTCA
Outer primer B3:CCCAGTGACGTTGCCTTC
Inner primer FIP:ACGCCTCCGAACCGCTACCTTTTCCTCCTTGACGAGGGGAAG
Inner primer BIP:AATGGGACGCCACGGCTACCTTTTCATTGCCTGACCGGCTT.
7. detection kit claimed in claim 1 is applied to the detection of mycobacterium tuberculosis in sputum or swab sample.
8. right to use requires the method for test kit detection mycobacterium tuberculosis described in 1, it is characterized in that the detection method of this test kit comprises the steps:
(1) sample process, estimates the amount of sputum sample, adds 4% NaOH solution of 2-4 times of volume, fully mixes, and room temperature leaves standstill liquefaction 10min-20min, and it is fully liquefied; Swab sample is directly stored in swab and preserves in liquid;
(2) sample washing, gets sputum or the swab washing fluid sample of liquefaction and transfers in 1.5ml centrifuge tube, and centrifugal removal supernatant liquor collecting precipitation, with the washing precipitation of sample washings, centrifugal collecting precipitation;
(3) nucleic acid extraction, by the resuspended above-mentioned precipitation of sample lysate, mixes, and 100 DEG C of temperature are bathed cracking 5-15min, are placed in immediately on ice, and then centrifugal, supernatant liquor is sample template DNA;
(4) application of sample reaction, takes out detector tube, and mark negative control pipe, detector tube and positive control pipe, add respectively negative solution, step (3) supernatant liquor and positive solution successively respectively, under 60-65 DEG C of condition, is incubated 30-60min;
(5) dyestuff mix, after above-mentioned steps completes, by above-mentioned negative control pipe, detector tube and the downward whipping of positive control pipe, the amplification reaction solution in pipe is fully mixed with dyestuff, centrifugal make mixed liquid be gathered in pipe bottom;
(6) result interpretation, visual inspection amplification reaction solution color, green if amplification reaction solution presents, the detected result of this expression sample is positive, orange-yellow if amplification reaction solution presents, and represents that the detected result of this sample is negative.
9. test kit as claimed in claim 8, is characterized in that positive control pipe amplification reaction solution should be shown in green, and negative control pipe amplification reaction solution should be shown as orange-yellow, otherwise should judge that this experiment is invalid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410185161.2A CN103937666B (en) | 2014-05-04 | 2014-05-04 | Concretion mycobacterium nucleic acid quick detection kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410185161.2A CN103937666B (en) | 2014-05-04 | 2014-05-04 | Concretion mycobacterium nucleic acid quick detection kit and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103937666A true CN103937666A (en) | 2014-07-23 |
| CN103937666B CN103937666B (en) | 2016-08-24 |
Family
ID=51185546
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410185161.2A Active CN103937666B (en) | 2014-05-04 | 2014-05-04 | Concretion mycobacterium nucleic acid quick detection kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103937666B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108265105A (en) * | 2018-03-26 | 2018-07-10 | 郑州安图生物工程股份有限公司 | For quickly carrying out the sputum pre-treating method of detection of nucleic acids |
| CN112391486A (en) * | 2021-01-21 | 2021-02-23 | 中国农业大学 | Rapid closed tube visual detection kit for salmonella and detection method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101285062A (en) * | 2008-04-29 | 2008-10-15 | 博奥生物有限公司 | Process for abstracting bacterial DNA from phlegm, kit and uses thereof |
| CN101302553A (en) * | 2008-05-30 | 2008-11-12 | 广州华峰生物科技有限公司 | Mycobacterium tuberculosis gene rapid diagnosis reagent kit base on loop-mediated isothermal amplification technology and detection method thereof |
| CN101935693A (en) * | 2010-01-18 | 2011-01-05 | 广州华峰生物科技有限公司 | Mycobacterium tuberculosis detection kit and use method thereof |
| CN102277440A (en) * | 2011-08-30 | 2011-12-14 | 浙江省疾病预防控制中心 | Kit and method for quickly detecting mycobacterium tuberculosis and nontuberculous mycobacteria |
| CN102373273A (en) * | 2010-08-26 | 2012-03-14 | 杭州优思达生物技术有限公司 | Kit for detecting nucleic acid of mycobacterium tuberculosis and method thereof |
-
2014
- 2014-05-04 CN CN201410185161.2A patent/CN103937666B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101285062A (en) * | 2008-04-29 | 2008-10-15 | 博奥生物有限公司 | Process for abstracting bacterial DNA from phlegm, kit and uses thereof |
| CN101302553A (en) * | 2008-05-30 | 2008-11-12 | 广州华峰生物科技有限公司 | Mycobacterium tuberculosis gene rapid diagnosis reagent kit base on loop-mediated isothermal amplification technology and detection method thereof |
| CN101935693A (en) * | 2010-01-18 | 2011-01-05 | 广州华峰生物科技有限公司 | Mycobacterium tuberculosis detection kit and use method thereof |
| CN102373273A (en) * | 2010-08-26 | 2012-03-14 | 杭州优思达生物技术有限公司 | Kit for detecting nucleic acid of mycobacterium tuberculosis and method thereof |
| CN102277440A (en) * | 2011-08-30 | 2011-12-14 | 浙江省疾病预防控制中心 | Kit and method for quickly detecting mycobacterium tuberculosis and nontuberculous mycobacteria |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108265105A (en) * | 2018-03-26 | 2018-07-10 | 郑州安图生物工程股份有限公司 | For quickly carrying out the sputum pre-treating method of detection of nucleic acids |
| CN112391486A (en) * | 2021-01-21 | 2021-02-23 | 中国农业大学 | Rapid closed tube visual detection kit for salmonella and detection method thereof |
| CN112391486B (en) * | 2021-01-21 | 2021-04-23 | 中国农业大学 | Rapid closed tube visual detection kit for salmonella and detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103937666B (en) | 2016-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bialek et al. | Detection of Cryptococcus neoformans DNA in tissue samples by nested and real-time PCR assays | |
| Zhu et al. | Use of visual loop-mediated isotheral amplification of rimM sequence for rapid detection of Mycobacterium tuberculosis and Mycobacterium bovis | |
| CN102251052B (en) | Treponema pallidum real-time fluorescence quantitative PCR (Polymerase Chain Reaction) multitarget detection kit and preparation thereof | |
| CN101487057A (en) | Loop-mediated isothermal amplification fast detecting reagent kit and method for O157:H7 coliform | |
| CN104630388A (en) | Dengue virus rapid classification identification detection kit | |
| CN101712973B (en) | Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof | |
| CN105524989A (en) | Lyme disease spirochaete detection RPA primer and probe and detection method thereof | |
| CN101429539B (en) | Reagent kit for real time fluorescence quantitative PCR detection of bacillus pyocyaneus | |
| CN103468811A (en) | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit | |
| CN103484536A (en) | Kit used for rapid detection of enterobacter sakazakii in milk, and applications thereof | |
| Pan et al. | Comparison of four DNA extraction methods for detecting Mycobacterium tuberculosis by real-time PCR and its clinical application in pulmonary tuberculosis | |
| CN102653793A (en) | Multiple touchdown PCR (polymerase chain reaction) detection kit of acinetobacter baumannii | |
| CN101376912A (en) | Loop-mediated isothermal amplification detection kit of influenza A3 viruses and detecting method | |
| CN106282375A (en) | The LAMP primer group of a kind of Salmonella typhimurium and test kit and using method | |
| Pilotte et al. | A TaqMan-based multiplex real-time PCR assay for the simultaneous detection of Wuchereria bancrofti and Brugia malayi | |
| CN101225440B (en) | Detection method of leptospira | |
| CN102409103B (en) | Multiple landing PCR(Polymerase Chain Reaction) detection kit and detection method for pathogenic bacteria of lower respiratory tract | |
| Bruisten | Protocols for detection and typing of Treponema pallidum using PCR methods | |
| CN103937666B (en) | Concretion mycobacterium nucleic acid quick detection kit and detection method | |
| CN103014135B (en) | A kind of method identifying mycobacterium tuberculosis | |
| CN104031997B (en) | A kind of LAMP primer group for rapid detection ustilago scitaminea bacteria, test kit and detection method thereof | |
| CN103882140A (en) | Rapid diagnosis kit for mycobacterium tuberculosis | |
| CN104293903A (en) | Primer combination, kit and detection method for detecting babeisa canis | |
| CN103571939A (en) | Fluorescent quantitative polymerase chain reaction (PCR) method for detecting tubercle bacillus infection from clinical specimen | |
| CN203833934U (en) | Pneumocystis LAMP specific detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |