CN112301156A

CN112301156A - RDA method and kit for rapidly detecting human adenovirus

Info

Publication number: CN112301156A
Application number: CN202010081196.7A
Authority: CN
Inventors: 季宇; 刘华勇; 谢婵芳; 陈翀
Original assignee: Guangzhou Universal Junan Biotechnology Co ltd
Current assignee: Guangzhou Universal Junan Biotechnology Co ltd
Priority date: 2020-02-06
Filing date: 2020-02-06
Publication date: 2021-02-02
Anticipated expiration: 2040-02-06
Also published as: CN112301156B

Abstract

The invention discloses an RDA method and a kit for rapidly detecting human adenovirus, which comprise a specific primer pair and an RDA fluorescence labeling probe, so as to realize safe, specific, sensitive and simple detection on human adenovirus (HAdV), thereby making up the defects of the existing traditional detection technology. The kit provided by the method can save the step of nucleic acid extraction, can realize the detection of the human adenovirus within 20min at the constant temperature of 37-42 ℃, has the specificity of 100 percent, and is very suitable for on-site rapid detection. Compared with the common PCR method, the RDA fluorescence method is a reaction at constant temperature, does not need temperature change, does not need complex instruments, and has short reaction time. Therefore, the method and the kit thereof have the characteristics of simple and rapid operation, good specificity, high sensitivity, low cost and the like, provide an effective technical means for the on-site rapid detection and screening of the human adenovirus, and have wide application prospects.

Description

RDA method and kit for rapidly detecting human adenovirus

Technical Field

The invention belongs to the technical field of molecular biology. More particularly, relates to a primer pair, a probe and a related kit for detecting human adenovirus nucleic acid based on an RDA fluorescence method detection technology.

Background

Human adenoviruses (HAdV) are a class of pathogens that mainly infect the Human respiratory, digestive, and genitourinary tracts, and are widely distributed in nature in numerous types. Adenoviruses belong to the mammalian genus adenoviruses (Mastadenoviridus) of the family Adenoviridae (Adenoviridae), are DNA viruses, and are divided into a-G7 subgroups, with 67 different types being identified at present. Airborne transmission via droplets is the major transmission route of adenovirus, and in addition, transmission via the fecal orifice and contact. One third of adenoviruses are associated with human diseases and mainly infect the human respiratory tract and digestive tract, wherein adenoviruses of

types

1, 2, 3, 4, 6, 7, 8, 11, 14, 21, 37, 40 and 41 and the like are easy to cause acute respiratory diseases, epidemic keratoconjunctivitis (pinkeye), acute pharyngoconjunctivitis, infantile lethal pneumonia, gastroenteritis and the like. Human adenovirus can cause regional epidemics or outbreaks, but because the clinical manifestations of the infection are usually nonspecific, no specific treatment method exists at present, and the mortality rate is high once severe pneumonia develops. Among them,

type

3 and 7 are highly infectious, and are the most common types causing respiratory tract adenovirus infection in children once occurring mass infection and outbreak epidemic in population. Diseases caused by human adenovirus, such as acute respiratory diseases, infantile diarrhea, pharyngeal-associated membranous fever and the like, are early in circulation, strong in infectivity, high in epidemic intensity and wide in spreading range, and meanwhile, because the general public has insufficient knowledge on the diseases and poor protection consciousness, patients often select basic community diagnosis and treatment institutions to treat the diseases, and because of the defects of the existing adenovirus detection method, untimely diagnosis and abuse of conventional antibiotics are often caused.

Most of the traditional adenovirus nucleic acid detection methods are based on PCR, and detection needs a PCR instrument or an expensive real-time quantitative PCR instrument, and needs a plurality of operation processes including virus lysis, virus DNA extraction and molecular detection, and the whole process is usually carried out in a laboratory, and needs precise instruments and skilled operators. However, these conditions are often difficult to obtain in the basic community medical institution, and the early discovery and prevention of adenovirus are seriously affected. At present, a simple, cheap and high-automation adenovirus detection kit suitable for basic level inspection is still lacked.

With the silent rise of in vitro isothermal amplification of nucleic acid, the limitations of the traditional amplification technology are changed, and in the past decade, isothermal nucleic acid amplification technologies, such as LAMP (loop-mediated nucleic acid amplification technology), HDA (helicase dependent isothermal nucleic acid amplification technology), etc., which make the in vitro amplification of nucleic acid simpler and more convenient, have been rapidly developed to amplify viral nucleic acid under isothermal conditions. These techniques can achieve efficient nucleic acid amplification by only requiring a temperature control device to maintain a constant reaction temperature, thereby getting rid of the dependence on a PCR instrument that precisely controls temperature variations. If nucleic acid amplification can be achieved at room temperature, the nucleic acid amplification technique will be further simplified, and the technique will be useful for a wider range of applications. The timely and accurate discovery of infectious disease epidemic situation has important significance for the prevention and treatment of diseases and the control of epidemic situation, so that the research and development of a kit which can be used in basic level diagnosis and treatment institutions and can rapidly detect nucleic acid at normal temperature is very necessary.

Disclosure of Invention

The invention aims to solve the technical problem of overcoming the defects and shortcomings of the existing human adenovirus detection technology. The research obtains a human adenovirus (HAdV) RDA fluorescence method detection kit, realizes the rapid detection of the human adenovirus, and only needs 20-30min from sample treatment to result completion in the whole process of detecting the HAdV, thereby greatly shortening the conventional detection time and improving the detection efficiency.

The present invention aims to provide a probe and a primer pair for detecting human adenovirus after optimization.

The nucleotide sequence of the probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

Preferably, two protocols are used to design RDA fluorescently labeled probes, the first protocol being: selecting 25-35bp conserved sequence as probe sequence in the target region, marking luminous group at 5 'end, marking quenching group at 3' end, and replacing tetrahydrofuran residue (THF) at any position of 5-10 th base. The second scheme is as follows: the probe is 46-52 nucleotides in length, at least 30 of which are located at the 5 'end of the THF site, and at least 15 of which are located at the 3' end. Through serial experimental comparison, the two probe design schemes are both suitable for the RDA fluorescence detection method, and have no obvious difference in detection sensitivity and specificity.

The nucleotide sequence is a probe of SEQ ID NO. 1, the 5 'end of the probe is marked with a luminous group, the 3' end of the probe is marked with a quenching group, any position of the 5 th to 10 th bases is replaced by a tetrahydrofuran residue (THF), and the specific information is as follows:

HAdV-P1（SEQ ID NO .1）：

5’- FAM-CACCG[THF]WACGTACTTCAGCCTGACGTACTT-BHQ1 -3′

the nucleotide sequence is a probe of SEQ ID NO. 2, the 30 th base T at the 5 'end of the probe is marked with FAM or other luminescent groups, the 32 th base is replaced by tetrahydrofuran residue (THF), the 33 th base is marked with BHQ1 or other quenching groups, and the 3' end is subjected to C3-spacer blocking modification, wherein the specific information is as follows:

HAdV-P2（SEQ ID NO .2）：

5-GGCTGGTGCAGTTTGCCCGCGCCACCGAWACG[dT-FAM]A[THF]T[dT-BHQ]CAGCCTGACGTACTT[C3-spacer] -3’

the nucleotide sequences of the primer pair are shown as SEQ ID NO. 3 and SEQ ID NO. 4, the target sequence is shown as SEQ ID NO. 5, and the specific information is as follows:

HAdV-F1（SEQ ID NO .3）： 5’-CAGGACGCCTCGGAGTACCTGAGCCCCG -3’；

HAdV-R1（SEQ ID NO .4）： 5’-CGCAGCGTCRAACGCTGGGACCGGTCYGTG -3’。

the invention also aims to provide a kit for detecting human adenovirus based on isothermal amplification technology.

The kit comprises a nucleic acid extraction reagent, a constant temperature amplification reaction module, a positive control, a negative control, the probe and the primer.

Preferably, the isothermal amplification reaction module is a lyophilized powder reagent of an isothermal amplification reaction mixed reagent.

Preferably, the isothermal amplification reaction mixed reagent is an RPA or Recombinase-dependent amplification (RDA) isothermal amplification reaction mixed reagent.

Another object of the present invention is to provide a recombinant enzyme-dependent amplification (RDA) based kit for detecting human adenovirus.

The Recombinase-dependent amplification (RDA) is realized by the following technical scheme:

the invention utilizes a bioinformatics method to analyze and simulate batch protein structures and virtually screen the protein structures at high flux, and finally finds out a new recombinase combination with high stability through a large number of biological experiments. Specifically, the invention develops a novel recombinase combination comprising a recombinase KX and an auxiliary protein KY, wherein the nucleotide sequence of the recombinase KX is shown as SEQ ID No.6, the amino acid sequence of the recombinase KX is shown as SEQ ID No.7, the nucleotide sequence of the auxiliary protein KY is shown as SEQ ID No.8, and the amino acid sequence of the auxiliary protein KY is shown as SEQ ID No. 9.

The recombinase KX can replace the recombinase UvsX or RecA in the RPA reaction, and the KY protein can replace the UvsY protein in the RPA reaction.

The recombinase KX has 50% of sequence homology with the T4UvsX protein (201/395). Based on the recombinase combination, the team develops a new detection method and a detection system of a recombinase-dependent amplification technology (RDA) with high stability and strong specificity. The preparation process of the recombinase KX is simple, the yield and the stability are greatly improved, and the mass production cost is low. And based on the amplification technology developed by the recombinase combination, the required primer is short (18-30 bp), the requirement on the length of the target sequence is low, and the applicability is wide. Furthermore, the technology has good detection specificity and high sensitivity on the nucleic acid target sequence, can realize high-sensitivity and high-precision rapid molecular detection under the constant temperature condition of 25-42 ℃, has low detection cost and convenient and rapid operation, and has wide application prospect.

The recombinase KX and the protein KY are derived from Escherichia phase phT4A phage, and Escherichia phase phT4A belongs to the genus Slopekvarus in Myoviridae subfamily.

The recombinase KX and the protein KY can realize a large amount of soluble expression in escherichia coli.

Specifically, as an alternative, the preparation method is as follows:

s1, introducing the target gene expression fragment into an expression vector to obtain a recombinant expression vector;

s2, transferring the recombinant expression vector into an expression bacterium to obtain a recombinant engineering bacterium;

s3, performing induction culture on the recombinant engineering bacteria, and obtaining unpurified recombinase through engineering bacteria enrichment, ultrasonic crushing and centrifugation;

s4, purifying the unpurified recombinase by chromatography to obtain the recombinase KX. The purified recombinant enzyme KX does not have the phenomenon of coagulation or precipitation at low temperature.

Wherein, the target gene expression fragment in the step S1 contains a nucleic acid sequence shown as SEQ ID NO.6, the 5 'end of the target gene expression fragment has a BamHI enzyme cutting site cohesive end, and the 3' end of the target gene expression fragment has a Sall enzyme cutting site cohesive end.

Preferably, the expression vector in step S1 is a pET-28a vector.

Preferably, the expression bacteria in step S2 are escherichia coli.

The preparation process is simple, the yield and the stability are greatly improved, and the mass production cost is low.

Preferably, the reaction system of the recombinase-dependent amplification technique (RDA) comprises the following reagents: recombinase KX, KY protein, gp32 protein, strand displacement DNA polymerase, exonuclease, creatine kinase, creatine phosphate, Tris-buffer, potassium acetate or sodium acetate, PEG20000 or PEG35000, DTT, dNTPs, dATP, probe, primer pair and magnesium acetate. Preferably, the reaction system further comprises a detection template, such as DNA or RNA of a sample to be detected.

Preferably, the reaction condition of the reaction system is that the reaction is carried out for 10-60min at 25-42 ℃.

More preferably, the reaction conditions of the reaction system are 39 ℃ for 30 min.

The reaction principle of the recombinase-dependent amplification technology (RDA) reaction system is as follows: (1) in the reaction system, a recombinase-primer complex is formed by combining a recombinase with a specific primer of 18-30bp, and a target site is searched in a double-stranded DNA template; (2) after the recombinase-primer complex recognizes a template specific sequence, positioning occurs and strand exchange is initiated, and the single-strand binding protein is combined with a D-Loop structure formed by the displaced DNA strands; (3) the dATP conformation in the recombinase-primer complex hydrolysis system is changed, the 3 'end of the primer is exposed and recognized by DNA polymerase after the recombinase is dissociated, and the DNA polymerase starts DNA synthesis at the 3' end of the primer according to a template sequence; (4) the DNA polymerase has a strand displacement function, continues to unwind the double-helix DNA structure of the template while the primer is extended, and the DNA synthesis process continues; (5) completing the amplification of the two primers to form a complete amplicon; (6) in the reaction system, dATP is hydrolyzed to supply energy to recombinase and then becomes dADP, phosphocreatine can transfer the phosphate group of the phosphocreatine into a dADP molecule under the catalysis of creatine kinase to form dATP, and therefore the level of dATP in the reaction system is restored. The above process is repeated continuously, and finally the high-efficiency amplification of nucleic acid is realized.

A kit for detecting human adenovirus (HAdV) based on recombinase dependent amplification technology (RDA) is constructed based on the reaction system, and comprises a nucleic acid extraction reagent, an RDA constant temperature amplification reaction module, a positive control, a negative control, the probe and the primer.

Preferably, the RDA constant temperature amplification reaction module is freeze-dried powder of a mixed reagent of the RDA constant temperature amplification reaction.

Preferably, the RDA constant temperature amplification reaction module comprises recombinase KX 60-600 ng/mu L, KY protein 16-192 ng/mu L, single-chain binding protein gp 32100-1000 ng/mu L, strand displacement DNA polymerase 3-100 ng/mu L, exonuclease 30-200U, creatine kinase 0.1-0.8 mg/ml, phosphocreatine 25-75 mM, Tris buffer 20-100mM, PEG 2.5-10%, potassium acetate or sodium acetate 0-150 mM, dATP 1-5 mM, dNTPs 150-600nM each, DTT 1-12 mM, probe 150nM-600nM, primer pair 150-600 nM.

Preferably, the Tris-buffer is Tris-tricine.

Preferably, the concentration of Tris-tricine is 100 mM.

The nucleic acid extraction reagent comprises Buffer A and Buffer B. Buffer A is sample lysate, containing Tris-HCL Buffer system, NaOH, SDS, EDTA, guanidinium isothiocyanate, Tween80, and Triton; buffer B contains a Tris Buffer system, potassium chloride and magnesium chloride; the positive control was a pUC57 plasmid containing the human adenovirus HEXON gene, and the negative control was an empty vector pUC57 plasmid.

Still another object of the present invention is to provide a method for detecting human adenovirus based on recombinase-dependent amplification technology.

The detection method comprises the following steps: extracting nucleic acid of a sample to be detected, performing real-time fluorescence RDA reaction in the presence of a primer pair, a probe, an RDA freeze-dried powder reagent, Buffer A and Buffer B of human adenovirus by taking the nucleic acid of the sample to be detected as a template, and analyzing the sample to be detected according to a real-time fluorescence RDA amplification curve; wherein the nucleotide sequence of the probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2, wherein the reaction temperature is 25-42 ℃, and the reaction time is more than 10 minutes.

Preferably, the method comprises the following steps:

1) sample processing

Shaking and uniformly mixing 20 mu L of Buffer A and 5 mu L of positive control/negative control/sample to be detected, and standing for 10-15min at room temperature;

2) system formulation and assay

Adding 25 mu L of Buffer B, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence method reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is as follows: collecting fluorescence signals every minute at 39 ℃ for 1 minute for 30 cycles, and completing detection in 30 min;

3) determination of results

And (4) judging the result according to the Time (Time Threshold, Tt) when the fluorescence value generated by the reaction system reaches a Threshold value.

(ii) positive control: typical amplification curves appear, and the Tt value is less than 25min, which is a valid result;

negative control: no amplification curve appears, or the Tt value is more than or equal to 25min, which is an effective result;

thirdly, the detected sample:

a. if the Tt value is less than 25min, judging the test result to be positive;

b. if the Tt value is more than or equal to 30min, judging the result to be negative;

c. if Tt value is less than or equal to 25min and less than 30min, the result is judged to be suspicious and needs to be repeatedly detected for confirmation; the result of the secondary detection is that the Tt value is more than or equal to 25min and less than 30min, the negative control Tt value is referred to, and if the negative control Tt value is more than or equal to 30min, the positive result is judged.

The invention has the following beneficial effects:

1. the kit provided by the invention is used for detecting the human adenovirus DNA in respiratory tract specimens such as throat swabs, nasopharyngeal aspirates or bronchoalveolar lavage fluid and the like or serum specimens of acute stages and convalescent stages of patients, has the characteristics of simple, rapid and sensitive operation, provides an effective technical means for on-site rapid detection and screening of human adenovirus, and has important significance in clinical detection of human adenovirus.

2. The kit provided by the invention adopts an RDA constant temperature amplification detection method, can realize effective amplification of the target gene under the condition of 37-42 ℃, and does not need temperature change and complex instruments. The reaction time is short, the reaction can be completed within 20-30min, the specificity is 100%, and the detection sensitivity is 1 copies/mu l.

3. In the RDA method, recombinase KX protein and KY protein have high specificity to a target sequence in the amplification process, and amplification is started only when a primer is completely complementary with a template sequence, so that the amplification specificity is greatly improved, and high-efficiency constant-temperature nucleic acid amplification without background is realized.

Drawings

FIG. 1 is a graph showing the results of ATP hydrolysis activity of 4 proteins in recombinase screening of example 1 of the present invention.

FIG. 2 is an agarose gel image of the isothermal amplification reaction of 4 proteins in recombinase screening of example 1 of the invention.

FIG. 3 is a three-dimensional structural diagram of KX protein in example 1 of the present invention.

FIG. 4 is a three-dimensional structure diagram of a KY protein heptamer in example 1 of the present invention.

FIG. 5 is a graph showing the results of the RDA fluorescence assay kit according to example 1 of the present invention.

FIG. 6 is a graph showing the results of the sensitivity test of the RDA fluorescence assay kit of example 2 of the present invention.

FIG. 7 is a diagram showing the results of the specificity test of the RDA fluorescence detection kit of example 3 of the present invention.

FIG. 8 is a graph showing the results of the 37-degree stability test of the RDA fluorescence assay kit in example 4 of the present invention.

FIG. 9 is a graph showing the results of the 37-degree stability test of the RDA fluorescence assay kit in example 4 of the present invention.

FIG. 10 is a graph showing the results of the 37-degree stability test of the RDA fluorescence assay kit in example 4 of the present invention.

FIG. 11 is a graph showing the results of the 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. It will be appreciated by those skilled in the art that various other changes, modifications, substitutions, combinations, and omissions may be made in the form and detail of the invention without departing from the spirit and scope of the invention.

Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated. Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

Unless otherwise indicated, the present invention employs immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, recombinant DNA and the like, which are within the ordinary skill of the art. See Sambrook (Sambrook), friech (Fritsch) and mani-tius (manitis), molecular cloning: a LABORATORY Manual (MOLEC M LAR CLONING: A LABORATORY MANUAL), 2 nd edition (1989); a Current Manual of molecular BIOLOGY experiments (Current Protocols IN MOLEC. mu.M.LAR BIOLOGY) (edited by F. M. Ausubel et al, (1987)); METHODS IN ENZYMOLOGY (METHODS IN Enzymology) series (academic Press): PCR2 practical methods (PCR 2: A PRARVICAL APPROACH) (M.J. MacPherson, B.D. Nimes (B.D. Hames) and G.R. Taylor (G.R. Taylor) editions (1995)), Harlow (Harlow) and Lane (Lane) editions (1988) antibodies: a LABORATORY Manual (ANTIBODIES, A LABORATORY MANUAL), and animal cell culture (ANIMAL CELL C μm LTURE) (edited by R.I. Freshenib (R.I. Freshney) (1987)).

Example 1 detection kit for human adenovirus (HAdV) RDA by fluorescence method

(1) Acquisition of recombinase KX and KY proteins

The reported recombinase UvsX has poor stability and is difficult to be produced in quantity and stored for a long time, and in order to solve the problem, a new recombinase KX and an auxiliary protein KY thereof are finally found by analyzing and simulating large batch protein structures by using a bioinformatics method by the research and development team.

In this embodiment, a research and development team extracts key functional site information in a recombinase structure, such as a DNA binding site, an ATP hydrolysis site, and the like, maps the information to a three-dimensional spatial structure of a protein, obtains secondary structure information and tertiary structure information, and constructs a data model for recombinase protein structure screening by integrating functional residues of a primary structure sequence, secondary structure characteristics, and a tertiary structure spatial distance. A template matched with recombinase proteins in a primary structure is searched from SwissProt and PDB data, 312 protein sequences are preliminarily screened, then secondary structure and tertiary structure comparison is respectively carried out, similarity scores are calculated, and 15 proteins suspected to have recombinase activity are screened in a simulated mode according to the similarity score ranking.

The 15 proteins are respectively constructed into recombinant protein expression vectors, after expression and purification, the ATP hydrolysis capacity of the recombinant protein expression vectors is detected, wherein 4 proteins have ATP hydrolysis activity and are KX, X-1, X-2 and X-3 proteins respectively. The firefly luciferase ATP bioluminescence detection kit is used in the experiment, and the experiment is carried out according to the operation of the instruction, and the result is shown in figure 1.

4 proteins with ATP hydrolytic activity are prepared into a constant-temperature amplification system for amplification reaction, the result is shown in figure 2, N is negative control, P is positive control added with T4UvsX for amplification, 1-4 proteins added respectively are KX, X-1, X-2 and X-3, wherein only the KX protein has amplification activity. The KX protein is derived from Escherichia phase phT4A phage and its three-dimensional structure diagram is shown in FIG. 3.

In the same way, we screened the recombinase KX from the helper protein KY of Escherichia phase phT4A phage, and the three-dimensional structure diagram is shown in FIG. 4. Wherein the auxiliary protein KY needs to play an active role in the form of heptamer.

Finally obtaining recombinase KX for RDA amplification, wherein the nucleotide sequence of the recombinase KX is shown as SEQ ID NO.6, and the amino acid sequence of the recombinase KX is shown as SEQ ID NO. 7; recombinase KY, the nucleotide sequence of which is shown as SEQ ID NO.8, and the amino acid sequence of which is shown as SEQ ID NO. 9.

(2) Human adenovirus detection primer and probe design and screening

The sequences conserved within and between species of the pathogen were selected as target regions by searching for the human adenovirus whole gene sequence through NCBI (www.ncbi.nlm.nih.gov), homology alignment and sequence analysis using Clone manager software and BLAST. After the whole genome sequence alignment and homology analysis of various human adenoviruses, finally, a conserved HEXON gene is selected as a target gene (reference sequence GenBank accession number: MK995003.1), and RDA detection primer and probe design is carried out on the target fragment. And (3) entrusting Shanghai Czeri bioengineering Limited company to synthesize a target gene DNA plasmid, a primer and a probe sequence. The highly conserved sequence of the HEXON gene of the human adenovirus is selected as follows:

CAGGACGCCTCGGAGTACCTGAGCCCCGGGCTGGTGCAGTTTGCCCGCGCCACCGAGACGTACTTCAGCCTGAATAACAAGTTTAGAAACCCCACGGTGGCGCCTACGCACGACGTGACCACAGACCGGTCCCAGCGTTTGACGCTGCG（SEQ ID NO .5）

in the embodiment, the RDA technology primer design principle is adopted for design, the lengths of the upstream primer and the downstream primer are 18-30bp, 3 upstream primers and 3 downstream primers are designed according to the human adenovirus HEXON gene conserved sequence, and the primer sequences are as follows:

the upstream primer HAdV-F1: 5'-CAGGACGCCTCGGAGTACCTGAGCCCCG-3'

The upstream primer HAdV-F2: 5'-CAGGACGCCTCGGAGTACCTGAGCC-3'

The upstream primer HAdV-F3: 5'-GAGTACCTGAGCCCCGGGCTGGTGCA-3'

Downstream primer HAdV-R1: 5 '-CGCAGCGTCRAACGCTGGGACCGGTCYGTG-3'

Downstream primer HAdV-R2: 5 '-CGCAGCGTCRAACGCTGGGACCGGTC-3'

Downstream primer HAdV-R3: 5 '-TCRAACGCTGGGACCGGTCYGTGGT-3'

And 3 pairs of primers are paired pairwise to form 9 combinations for optimal primer combination screening.

Combination 1: HAdV-F1 and HAdV-R1; and (3) combination 2: HAdV-F1 and HAdV-R2 combination 3: HAdV-F1 and HAdV-R3

And (4) combination: HAdV-F2 and HAdV-R1; and (3) combination 5: combination of HAdV-F2 and HAdV-R2 6: HAdV-F2 and HAdV-R3

And (3) combination 7: HAdV-F3 and HAdV-R1; and (4) combination 8: combination of HAdV-F3 and HAdV-R2 9: HAdV-F3 and HAdV-R3

Through a series of experimental screening and evaluation, combination 1 (HAdV-F1 and HAdV-R1) is determined as an optimal primer set, and specifically comprises the following components:

HAdV-F1（SEQ ID NO .3）： 5’-CAGGACGCCTCGGAGTACCTGAGCCCCG -3’；

HAdV-R1（SEQ ID NO .4）： 5’-CGCAGCGTCRAACGCTGGGACCGGTCYGTG -3’。

in the RDA fluorescence detection technology, two schemes are adopted to design RDA fluorescence labeling probes, wherein the first scheme is as follows: selecting a conserved sequence of 25-35bp as a probe sequence in a target region, wherein the conserved sequence is a probe sequence, a luminescent group is marked at the 5 'end, a quenching group is marked at the 3' end, and any position in the 5 th-10 th bases is replaced by a tetrahydrofuran residue (THF), the nucleotide sequence is the probe of SEQ ID NO. 1, the luminescent group is marked at the 5 'end, the quenching group is marked at the 3' end, and any position in the 5 th bases is replaced by the tetrahydrofuran residue (THF), and the specific information is as follows:

HAdV-P1（SEQ ID NO .1）：

5’- FAM-CACCG[THF]WACGTACTTCAGCCTGACGTACTT-BHQ1 -3′

the second scheme is as follows: the probe is 46-52 nucleotides in length, at least 30 of which are located at the 5 'end of the THF site, and at least 15 of which are located at the 3' end. In the probe with the nucleotide sequence of SEQ ID NO. 2, the 30 th base T at the 5 'end is labeled with FAM or other luminescent groups, the 32 th base is replaced by Tetrahydrofuran (THF), the 33 th base is labeled with BHQ1 or other quenching groups, and the 3' end is subjected to C3-spacer blocking modification, and the specific information is as follows:

HAdV-P2（SEQ ID NO .2）：

through series of experimental comparison, the two probe design schemes are both suitable for the RDA fluorescence detection method, and have NO obvious difference in detection sensitivity and specificity, wherein the target conserved sequence required by the first probe design is shorter, and the requirement on the nucleic acid sequence is low, and in the subsequent embodiment of the patent, the first probe HAdV-P1 (SEQ ID NO. 1) is used as a detection probe to prepare an RDA constant temperature amplification reaction system.

(3) Establishment of human adenovirus (HAdV) RDA detection method

The patent constructs a kit for detecting human adenovirus (HAdV) based on recombinase dependent amplification technology (RDA), which comprises a nucleic acid extraction reagent, an RDA constant-temperature amplification reaction module, a positive control and a negative control, wherein the nucleic acid extraction reagent comprises Buffer A and Buffer B, the Buffer A is a sample lysate and contains a Tris-HCL Buffer system, NaOH, SDS, EDTA, guanidinium isothiocyanate, Tween80 and triton, and the Buffer B contains a Tris Buffer system, potassium chloride and magnesium chloride; the optimal proportion of the reaction system in the RDA isothermal amplification reaction module is shown in Table 1, and the reaction system comprises the fluorescence labeling probe and the primer described in the embodiment; the positive control was a plasmid containing the target gene of human adenovirus (HAdV), and the negative control was an empty vector pUC57 plasmid.

TABLE 1 RDA constant temperature amplification reaction module reaction system ratio

Serial number	Components	Concentration of content
			1	Tris-tricine（PH 7.9）	100mM
2	Potassium acetate	50mM
			3	PEG20000 or PEG35000	5%
4	DTT	2mM
			5	dNTPs	200nM each
6	dATP	2mM
			7	Creatine kinase (Creatine kinase)	0.2mg/ml
8	Creatine phosphate (Creatine phosphate)	50mM
			9	Strand-displacing DNA polymerase	50ng/ul
10	gp32 protein	300 ng/ul
			11	Recombinase KX	120 ng/ul
12	Accessory protein KY	60ng/ul
			13	Exonuclease	50U
14	Upstream primer	500nM
			15	Downstream primer	500nM
16	Fluorescent-labeled probe	300nM
			17	Acetic acidMagnesium alloy	14mM

The reaction conditions of the reaction system are as follows: reacting for 10-60min at 25-42 ℃.

The optimal reaction conditions are as follows: the reaction was carried out at 37 ℃ for 30 min.

In the embodiment, 4 collected respiratory tract/serum samples which are positive to human adenovirus DNA are verified by fluorescent quantitative PCR, and the respiratory tract/serum samples are tested by using the RDA fluorescent method detection kit disclosed by the invention.

The specific operation is as follows:

step one, sample processing. Shaking and uniformly mixing 20 mu L of Buffer A and 5 mu L of positive control/negative control/sample to be detected, and standing for 10-15min at room temperature;

step two, system preparation and detection. Adding 25 mu L of Buffer B, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence method reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is as follows: collecting fluorescence signals every minute at 39 ℃ for 1 minute for 30 cycles, and completing detection within 30 min;

and step three, judging a result.

thirdly, the detected sample:

a. if the Tt value is less than 25min, judging the test result to be positive;

The detection results are shown in table 2 and fig. 5, and the positive control and the negative control are in accordance with the "first positive control: typical amplification curves appear, and the Tt value is less than 25min, which is a valid result; negative control: no amplification curve appears, or the Tt value is more than or equal to 25min, which is the content of effective result, and the Tt value of each sample is less than 25min, and the sample is judged to be positive.

The result shows that the detection method of the RDA fluorescence detection kit established in the embodiment can detect the human adenovirus DNA in the respiratory tract/serum sample.

TABLE 2 establishment of the detection method of the kit

Negative control

Positive control

Sample

1

Sample 2

Sample 3

Tt value

-

05:59

07:15

07:42

08:24

EXAMPLE 2 detection of reagent sensitivity test by RDA fluorescence method

The positive control was a pUC57 plasmid containing the human adenovirus (HAdV) HEXON gene, and the negative control was an empty vector pUC57 plasmid.

The specific operation is as follows:

step one, the positive control plasmid is diluted to 10^3c, and then diluted to 10^2c, 10^1c and 10^0c respectively by 10 times of gradient dilution.

And step two, sample processing. Respectively taking 5 mu L of the plasmids with each concentration in the step one in an EP tube, simultaneously taking 5 mu L of the negative control in another EP tube, respectively adding 20 mu L of Buffer A, uniformly mixing by shaking, and standing for 10-15min at room temperature;

and step three, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, vibrating and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence method reaction module, covering a tube cover, vibrating and centrifuging, and immediately detecting; the reaction procedure is as follows: collecting fluorescence signals every minute at 39 ℃ for 1 minute and 30 cycles;

and step four, judging a result. And (3) judging standard:

thirdly, the detected sample:

a. if the Tt value is less than 25min, judging the test result to be positive;

The results are shown in table 3 and fig. 6. The negative control has no amplification curve, and meets the content that 'no amplification curve appears or Tt value is more than or equal to 25 min' in the determination standard. Tt values of 10^3c, 10^2c, 10^1c and 10^0c are all less than 25min, and according to the result judgment standard, results of 10^3c, 10^2c, 10^1c and 10^0c are positive.

That is, the sensitivity of the RDA fluorescence detection kit reaches a single copy.

TABLE 3 sensitivity test results

	Negative control	10^3	10^2	10^1	10^0
						Tt value	-	06:55	08:02	10:21	14:53

Example 3 detection of reagent specificity by RDA fluorescence assay

3 samples which are clinically collected and verified to be positive to corresponding viruses by fluorescent quantitative PCR (total 5 samples of 3 Human adenoviruses (HAdV), 1 Norovirus (NV) and 1 Rotavirus (Rotavirus, RV) are detected, and the specificity of the kit is tested.

The specific operation is as follows:

step one, sample processing. Respectively taking 5 mu L of the above 5 positive samples in an EP tube, simultaneously taking 5 mu L of the positive control and the negative control of the kit in a new EP tube, respectively adding 20 mu L of Buffer A, shaking and uniformly mixing, and standing at room temperature for 10-15 min;

and step four, judging a result. And (3) judging standard:

thirdly, the detected sample:

a. if the Tt value is less than 25min, judging the test result to be positive;

The results are shown in table 4 and fig. 7. The positive control and the negative control accord with' a positive control: typical amplification curves appear, and the Tt value is less than 25min, which is a valid result; negative control: no amplification curve appeared, or the Tt value was not less than 25mn, which is the content of effective result ". Tt values of the HAdV samples are all less than 25min, and the HAdV samples are judged to be positive; NV and RV have no amplification curve and are judged to be negative.

That is, RDA fluorescence detection is positive only when the target pathogen is human adenovirus, and negative for other viruses.

TABLE 4 results of specificity test

Sample name	Tt value	Sample name	Tt value
				Negative control	-	HAdV-3	06:30
Positive control	06:26	NV	-
				HAdV-1	11:05	RV	-
HAdV-2	09:96

Example 4 RDA fluorescence assay kit stability test

The liquid reagent needs to be stored at low temperature and can not be repeatedly frozen and thawed. The RDA fluorescence method reaction module is dried in vacuum to form the powdery reagent in the kit, and the freeze-dried powdery reagent can be stored at normal temperature, so that the cost of cold chain transportation and low-temperature storage is saved, and the operation is simpler. This example demonstrates the stability of the RDA fluorescence detection kit.

The specific operation is as follows:

the eight tubes containing the lyophilized reagents were sealed in aluminum foil bags containing a desiccant and stored in a 37 ℃ incubator. 2 reaction wells were taken for testing at 0 day, 30 days, 90 days, and 180 days, respectively.

Step one, sample processing. Respectively taking 5 mu L of positive control/negative control of the kit, respectively adding 20 mu L of Buffer A into an EP tube, shaking and uniformly mixing, and standing at room temperature for 10-15 min;

step two, system preparation and detection. Adding 25 mu L of Buffer B into each tube, vibrating and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence method reaction module, covering a tube cover, vibrating and centrifuging, and immediately detecting; the reaction procedure is as follows: collecting fluorescence signals every minute at 39 ℃ for 1 minute and 30 cycles;

and step three, judging a result. And (3) judging standard:

thirdly, the detected sample:

a. if the Tt value is less than 25min, judging the test result to be positive;

The results are shown in table 5 and fig. 8, 9, 10, and 11. The reagent freeze-dried powder of the RDA fluorescence method reaction module stored for 0 day, 30 days, 90 days and 180 days is tested respectively, each Tt value is less than 25min, and according to the result judgment standard, the detection results of the reagent in the reagent kit of the patent are positive in 0 day, 30 days, 90 days and 180 days after the reagent is freeze-dried. The reagent in the kit disclosed by the patent can be stably stored for at least 3 months at 37 ℃ after being lyophilized.

TABLE 437 ℃ storage stability

	Day 0	30 days	90 days	180 days
					Negative control	-	-	-	-
Positive control	08:58	09:07	09:32	10:25

Sequence listing

<110> Guangzhou Puchunjun biological science and technology Co., Ltd

<120> RDA method and kit for rapidly detecting adenovirus

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> FAM-labeled fluorescent Probe (SEQ ID NO. 1)

<400> 1

caccgawacg tacttcagcc tgacgtactt 30

<210> 2

<211> 52

<212> DNA

<213> FAM-labeled fluorescent Probe (SEQ ID NO. 2)

<400> 2

ggctggtgca gtttgcccgc gccaccgawa cgtacttcag cctgacgtac tt 52

<210> 3

<211> 28

<212> DNA

<213> primer sequence (SEQ ID NO. 3)

<400> 3

caggacgcct cggagtacct gagccccg 28

<210> 5

<211> 30

<212> DNA

<213> primer sequence (SEQ ID NO. 4)

<400> 5

cgcagcgtcr aacgctggga ccggtcygtg 30

<210> 5

<211> 149

<212> DNA

<213> target sequence (SEQ ID NO. 5)

<400> 5

caggacgcct cggagtacct gagccccggg ctggtgcagt ttgcccgcgc caccgagacg 60

tacttcagcc tgaataacaa gtttagaaac cccacggtgg cgcctacgca cgacgtgacc 120

acagaccggt cccagcgttt gacgctgcg 149

<210> 6

<211> 1158

<212> DNA

<213> recombinase KX nucleotide sequence (SEQ ID NO. 6)

<400> 6

atgtcaaaca aagcactact aaaaaaactg atcaaaaact cgaatagcca aactgcatct 60

gtactttctg aaagcgacgt attcaacaat attaccatca cgcgaacccg tgtgccgatt 120

ctgaatctgg cgttgtccgg tgcgtttaac ggtggcctaa cttctggtct tacccttttc 180

gctggcccgt ccaaacactt caaatccaac ttaggtttgc ttactgtagc ggcgtatctc 240

aaaacgtatg aagatgctgt gtgcctgttc tacgattcag aaaaaggtgt tactaaatcc 300

tatctgaaat caatgggtgt tgatccggat cgtgttgtgt atactcgtat cacgacggtc 360

gagcagttgc gtaatgacgt tgtaagccag cttaacgcgc ttgaacgcgg tgataaggtg 420

attgtattcg ttgactcagt aggcaacacg gcaagtaaaa aagaacttgc tgacgcgctt 480

tctgataacg ataaacagga tatgacgcga gcaaaagcat taaaaggtat gttccgtatg 540

gttacgcctt atctggctga cctggatatc ccgatggttt gtatctgtca tacctatgac 600

acacaagaaa tgtacagcaa gaaagttatt tctggtggta ctggtttaat gtattccgct 660

gatactgcga tcatcctggg taaacaacag gtgaaagaag gtactgaggt ggtaggttat 720

gatttcatca tgaatatcga aaaatctcga ttcgtgaaag agaaatcaaa attcccgctg 780

catgttacct atgaaggcgg tattagtatg tattctggcc ttttggatct ggcaatggaa 840

atgaactttg tacagaccgt aaccaaaggc tggcgcaacc gcgctttcct gaataccgag 900

actggcgaac tcgaagttga agaaaagaaa tggcgtgagt cagaaacaaa tagcgttgaa 960

ttctggcgtc ctctgtttac tcatcaacca ttcttgaaag ctatcgaaga aaagtataag 1020

atcccagatc gtgaaatcag tgatggttcc gcgctggaag atttatacag cactgatagc 1080

atcccagatc ctgatctgga tgatgacgat atcccagaat catttgatga tatcgaagaa 1140

aacgacgaaa ttttataa 1158

<210> 7

<211> 385

<212> PRT

<213> recombinase KX amino acid sequence (SEQ ID NO. 7)

<400> 7

Met Ser Asn Lys Ala Leu Leu Lys Lys Leu Ile Lys Asn Ser Asn Ser

1 5 10 15

Gln Thr Ala Ser Val Leu Ser Glu Ser Asp Val Phe Asn Asn Ile Thr

20 25 30

Ile Thr Arg Thr Arg Val Pro Ile Leu Asn Leu Ala Leu Ser Gly Ala

35 40 45

Phe Asn Gly Gly Leu Thr Ser Gly Leu Thr Leu Phe Ala Gly Pro Ser

50 55 60

Lys His Phe Lys Ser Asn Leu Gly Leu Leu Thr Val Ala Ala Tyr Leu

65 70 75 80

Lys Thr Tyr Glu Asp Ala Val Cys Leu Phe Tyr Asp Ser Glu Lys Gly

85 90 95

Val Thr Lys Ser Tyr Leu Lys Ser Met Gly Val Asp Pro Asp Arg Val

100 105 110

Val Tyr Thr Arg Ile Thr Thr Val Glu Gln Leu Arg Asn Asp Val Val

115 120 125

Ser Gln Leu Asn Ala Leu Glu Arg Gly Asp Lys Val Ile Val Phe Val

130 135 140

Asp Ser Val Gly Asn Thr Ala Ser Lys Lys Glu Leu Ala Asp Ala Leu

145 150 155 160

Ser Asp Asn Asp Lys Gln Asp Met Thr Arg Ala Lys Ala Leu Lys Gly

165 170 175

Met Phe Arg Met Val Thr Pro Tyr Leu Ala Asp Leu Asp Ile Pro Met

180 185 190

Val Cys Ile Cys His Thr Tyr Asp Thr Gln Glu Met Tyr Ser Lys Lys

195 200 205

Val Ile Ser Gly Gly Thr Gly Leu Met Tyr Ser Ala Asp Thr Ala Ile

210 215 220

Ile Leu Gly Lys Gln Gln Val Lys Glu Gly Thr Glu Val Val Gly Tyr

225 230 235 240

Asp Phe Ile Met Asn Ile Glu Lys Ser Arg Phe Val Lys Glu Lys Ser

245 250 255

Lys Phe Pro Leu His Val Thr Tyr Glu Gly Gly Ile Ser Met Tyr Ser

260 265 270

Gly Leu Leu Asp Leu Ala Met Glu Met Asn Phe Val Gln Thr Val Thr

275 280 285

Lys Gly Trp Arg Asn Arg Ala Phe Leu Asn Thr Glu Thr Gly Glu Leu

290 295 300

Glu Val Glu Glu Lys Lys Trp Arg Glu Ser Glu Thr Asn Ser Val Glu

305 310 315 320

Phe Trp Arg Pro Leu Phe Thr His Gln Pro Phe Leu Lys Ala Ile Glu

325 330 335

Glu Lys Tyr Lys Ile Pro Asp Arg Glu Ile Ser Asp Gly Ser Ala Leu

340 345 350

Glu Asp Leu Tyr Ser Thr Asp Ser Ile Pro Asp Pro Asp Leu Asp Asp

355 360 365

Asp Asp Ile Pro Glu Ser Phe Asp Asp Ile Glu Glu Asn Asp Glu Ile

370 375 380

Leu

385

<210> 8

<211> 420

<212> DNA

<213> KY protein nucleotide sequence (SEQ ID NO. 8)

<400> 8

atgagtttga aattagaaga tctacaaaat gaacttgaaa aggatatgct gatagatccc 60

ctcaagttgc aatcagaatc agcggatatc ccgaagattt gggctaaatg gcttcgatac 120

cattcaaacg ctaagaaaaa attgatccaa cttcatgcga aaaaagaagc tgatgtgaag 180

gatcgtatgt tgtactacac cggaaggcat gacaaagaaa tgtgcgaagt ggtgtatact 240

gggactactg aaattaaaat cgcgatcgct ggggatccga aaattgtaga aaccaacaag 300

ctgatccagt attatgacat ggtggtagat ttcaccagca aagcactgga tatcgtcaaa 360

aacaaaggat actctatcaa aaacatgtta gagatccgta aattagaaag tggtgcataa 420

<210> 9

<211> 139

<212> PRT

<213> KY protein amino acid sequence (SEQ ID NO. 9)

<400> 9

Met Ser Leu Lys Leu Glu Asp Leu Gln Asn Glu Leu Glu Lys Asp Met

1 5 10 15

Leu Ile Asp Pro Leu Lys Leu Gln Ser Glu Ser Ala Asp Ile Pro Lys

20 25 30

Ile Trp Ala Lys Trp Leu Arg Tyr His Ser Asn Ala Lys Lys Lys Leu

35 40 45

Ile Gln Leu His Ala Lys Lys Glu Ala Asp Val Lys Asp Arg Met Leu

50 55 60

Tyr Tyr Thr Gly Arg His Asp Lys Glu Met Cys Glu Val Val Tyr Thr

65 70 75 80

Gly Thr Thr Glu Ile Lys Ile Ala Ile Ala Gly Asp Pro Lys Ile Val

85 90 95

Glu Thr Asn Lys Leu Ile Gln Tyr Tyr Asp Met Val Val Asp Phe Thr

100 105 110

Ser Lys Ala Leu Asp Ile Val Lys Asn Lys Gly Tyr Ser Ile Lys Asn

115 120 125

Met Leu Glu Ile Arg Lys Leu Glu Ser Gly Ala

130 135

Claims

1. A probe for detecting human adenovirus is characterized in that the nucleotide sequence of the probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

2. The probe for detecting human adenovirus according to claim 1, wherein the nucleotide sequence is the probe of SEQ ID NO. 1, the 5 'end of which is labeled with a luminescent group, the 3' end of which is labeled with a quencher group, and any one of the 5 th to 10 th bases of which is substituted with a tetrahydrofuran residue (THF).

3. The probe for detecting human adenovirus according to claim 1, wherein the nucleotide sequence is the probe of SEQ ID NO. 2, the 30 th base T from the 5 'end is labeled with a luminescent group, the 32 th base is replaced with a tetrahydrofuran residue (THF), the 33 th base is labeled with a quencher group, and the 3' end is modified by C3-spacer blocking.

4. A group of target sequences, primer pairs and probes for detecting human adenovirus, wherein the probes are the probes of any one of claims 1-3, the nucleotide sequences of the primer pairs are shown as SEQ ID NO. 3 and SEQ ID NO. 4, and the target sequences are shown as SEQ ID NO. 5.

5. A kit for detecting human adenovirus, which comprises a nucleic acid extraction reagent, an isothermal amplification reaction module, a positive control and a negative control, a probe according to any one of claims 1 to 3 and a primer pair according to claim 4.

6. The kit of claim 5, wherein the isothermal amplification reaction module is a lyophilized powder reagent of a mixed reagent of RDA or RPA isothermal amplification reaction; the freeze-dried powder reagent of the mixed reagent for the RDA constant-temperature amplification reaction comprises recombinase KX with a nucleotide sequence shown in SEQ ID NO. 6.

7. The kit of claim 6, wherein the lyophilized powder reagent of the mixed reagent for RDA isothermal amplification reaction comprises recombinase KX 60-600 ng/μ L, KY protein 16-192 ng/μ L, single-stranded binding protein gp 32100-1000 ng/μ L, strand-displacement DNA polymerase 3-100 ng/μ L, exonuclease 30-200U, creatine kinase 0.1-0.8 mg/ml, creatine phosphate 25-75 mM, Tris buffer 20-100mM, PEG 2.5-10%, potassium acetate or sodium acetate 0-150 mM, dATP 1-5 mM, dNTPs 150-600nM, DTT 1-12 mM, the probe 150nM-600nM, and the primer pair 150-600 Nm.

8. The kit of claim 5, wherein the nucleic acid extraction reagent comprises Buffer A, Buffer B; the Buffer A is a sample lysate and contains a Tris-HCL Buffer system, NaOH, SDS, EDTA, guanidinium isothiocyanate, Tween80 and triton; the Buffer B contains a Tris Buffer system, potassium chloride and magnesium chloride; the positive control is a plasmid containing a human adenovirus target gene, and the negative control is an empty vector pUC57 plasmid.

9. A method for detecting human adenovirus for non-disease diagnostic purposes, comprising the steps of:

extracting nucleic acid of a sample to be detected, performing real-time fluorescence RDA reaction in the presence of a primer pair, a probe, an RDA freeze-dried powder reagent, Buffer A and Buffer B of human adenovirus by taking the nucleic acid of the sample to be detected as a template, and analyzing the sample to be detected according to a real-time fluorescence RDA amplification curve; wherein the nucleotide sequence of the probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2, wherein the reaction temperature is 25-42 ℃, and the reaction time is more than 10 minutes.

10. The detection method according to claim 9, wherein the reaction temperature is 39 ℃ and the reaction time is 30 minutes.