CN113999921B - Method and kit for rapidly and visually detecting shigella flexneri - Google Patents
Method and kit for rapidly and visually detecting shigella flexneri Download PDFInfo
- Publication number
- CN113999921B CN113999921B CN202111393446.1A CN202111393446A CN113999921B CN 113999921 B CN113999921 B CN 113999921B CN 202111393446 A CN202111393446 A CN 202111393446A CN 113999921 B CN113999921 B CN 113999921B
- Authority
- CN
- China
- Prior art keywords
- rpa
- crispr
- cas12a
- amplification
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
- C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method and a kit for rapidly and visually detecting shigella flexneri based on IMB-RPA-CRISPR/Cas12a, wherein a sample is pre-enriched through Immunocapture Magnetic Beads (IMB), RPA is amplified, and the detection method is combined with a CRISPR/Cas12 detection method to form a molecular detection kit and a detection method of the IMB-RPA-CRISPR/Cas12 a. The molecular detection method has the advantages of good specificity, extremely high sensitivity, simple and quick operation, low cost, no need of large-scale instruments and equipment, visualization and more contribution to popularization and application of the molecular detection technology of Shigella flexneri in a basic layer.
Description
Technical Field
The invention belongs to the field of detection, and particularly relates to a method and a kit for rapidly and visually detecting shigella flexneri based on IMB-RPA-CRISPR/Cas12 a.
Background
Diarrhea or bacillary dysentery is an acute infectious diarrhea that infects via the faecal-oral route, threatening the global public health system with its high morbidity (36.4/1000) and mortality (2.9/10 tens of thousands). It is estimated that shigella bacillary dysentery caused by shigella bacteria causes 1.65 million people worldwide each year, with infants under five years of age being relatively high. Shigella bacteria are divided into 4 types of shigella dysenteriae, shigella flexneri, shigella pallidum and shigella sonnei according to different antigen structures, and correspond to subgroups A, B, C and D respectively. The mortality rate of shigella flexneri infection was found to be significantly higher than the other three, about 60% of bacillary dysentery was caused by shigella flexneri.
At present, the detection of pathogenic bacteria mainly depends on the conventional bacteriological culture method, immunological method, nucleic acid probe technology, PCR and the like. The bacteriological culture method needs to be subjected to enrichment culture, selective separation, morphological characteristic observation, physiological and biochemical reaction, serological identification and other processes, generally needs 4 to 7 days, has the advantages of complex operation, time and labor consumption, low sensitivity and poor specificity, and can not detect damaged bacteria and dead bacteria; the immunological method is easy to pollute, has serious cross reaction, more false positives and lower sensitivity; the nucleic acid probe detection technology has the greatest advantage of strong specificity, but certain problems exist in the probe detection technology, such as insufficient sensitivity, and the preparation of a probe is needed for detecting a bacterium. The sensitivity and the specificity of the conventional PCR method can be guaranteed, but the detection time is long, and the conventional PCR method cannot be well used for point of care testing (POCT) because of the need of expensive supporting instruments such as a PCR temperature control instrument and the like.
CRISPR/Cas (regularly spaced clustered short palindromic repeats and their associated genes) system is a natural immune system present in bacteria and archaea for protection against phage invasion. When the foreign phage invades, the bacteria are able to generate crrnas that recognize the viral genome, bind to Cas proteins with endonuclease activity to form complexes, which together recognize and cleave the viral target sequence. The system has a brand-new corner in the field of gene editing in recent years, and the gene editing capability brings a new revolution to the biology world. A wide variety of Cas proteins have been identified that cleave target sites under the guidance of sgrnas. Cas12a belongs to one of the families, and can specifically cleave a target gene under the guidance of sgrnas, and meanwhile, activated Cas12a can exert nonspecific cleavage enzyme activity to nonspecific cleave single-stranded DNA (ssDNA) encountered. The system has the characteristics of specific targeting target DNA, accessory non-specific cutting of single-stranded DNA and the like, and has excellent targeting efficiency and specific enzyme cutting capability, so that the system has good application prospect in the aspect of rapid detection of nucleic acid.
However, the sensitivity of detection using a single CRISPR/Cas nucleic acid is very limited, and nucleic acid amplification techniques are often used in combination with such detection techniques to greatly increase the sensitivity of detection. Some existing rapid nucleic acid detection methods include LAMP (loop-mediated isothermal amplification), RPA (recombinase polymerase amplification), and the like. The method gets rid of the dependence on temperature changing equipment under the mediation of some special isothermal nucleic acid amplification enzymes, and target nucleic acid can be amplified and detected at fixed temperature. The isothermal amplification detection of nucleic acids based on LAMP or RAA, while free from the limitations of thermal cycling equipment, gives rise to the possibility of false positives due to its high speed amplification and high sensitivity. Therefore, a highly accurate CRISPR/Cas system is introduced on the basis of a constant temperature amplification method, and the accuracy and sensitivity of a detection method can be greatly improved.
Although combining isothermal amplification with the CRISPR/Cas system can greatly improve the accuracy of detection, it is still not applicable for very low concentrations of samples. Samples of very low concentration require enrichment of pathogens and extraction of DNA prior to detection to increase the sensitivity of the detection. The immune magnetic separation technology is a technology for coupling a pathogen specific antibody with a magnetic bead with a certain size to prepare an immune capture magnetic bead (IMB), separating an IMB-bacterial complex from the environment under the action of an external magnetic field by utilizing the principle that the specific antibody can be combined with a bacterial surface antigen, and obtaining a target pathogen, but only separation can be realized by using the technology alone, detection is required by combining other means, and the sensitivity of a detection method for separating by using the immune magnetic separation technology at present still needs to be improved.
Disclosure of Invention
The technical problems to be solved by the invention are as follows: provides a method for rapidly and visually detecting shigella flexneri based on IMB-RPA-CRISPR/Cas12 a.
Another object is to provide a kit for rapid visual detection of shigella flexneri based on IMB-RPA-CRISPR/Cas12 a.
The technical scheme of the invention is as follows: the method for rapidly and visually detecting shigella flexneri based on IMB-RPA-CRISPR/Cas12a comprises the following steps:
(1) Enriching a sample to be detected by using immunomagnetic beads (IMB);
(2) Extracting total DNA of the solution obtained after the immunomagnetic bead separation in the step (1);
(3) Performing Recombinase Polymerase Amplification (RPA) amplification by taking the total DNA obtained in the step (2) as a template and taking RPA-F and RPA-R as primers, wherein the sequence of the RPA-F is TTTGACCAAGCCTATCGTTGTTAATAATAC (SEQ ID No. 1) and the sequence of the RPA-R is AAACTTTCAGTTTATGGTCCGGGTTATTG (SEQ ID No. 2);
(4) Performing enzyme digestion and fluorescence detection on the amplification product in the step (3) in a CRISPR/Cas12a detection system, wherein the sequence of the sgRNA in the CRISPR/Cas12a detection system is sgRNA1: GAAUUUCUACUGUUGUAGAUUGCGGAGAGCAGUACUUCAGCGGA (SEQ ID No. 3) A or sgRNA2: GAAUUUCUACUGUUGUAGAUUGGUCCGGGUUAUUGUCACCAGAA (SEQ ID No. 4).
Further, in the step (3), the reaction system of the Recombinase Polymerase Amplification (RPA) amplification is: the 20 μl reagent system comprises: 10. Mu.L 2x Reaction Buffer,2. Mu.L 10 Xbasic E-mix,1.8mM dNTPs, 1. Mu.L 10mM forward/reverse primer, 1. Mu.L 20x Core Reaction Mix,1. Mu.L 280mM MgOAc and 5. Mu.L template DNA, reaction conditions: amplifying for 10min at 38 ℃.
Further, in step (4), the CRISPR/Cas12a detection system comprises 150nM of Lba Cas12a,0.625 μmsgrna,4U/μl rnase inhibitor, 2 μl of NEBuffer 2.1,1 μΜ fluorescent-quenching labeled ssDNA probe, and DEPC water.
Further, the fluorescence detection uses 485nm light source transmission.
The kit for rapidly and visually detecting shigella flexneri based on IMB-RPA-CRISPR/Cas12a comprises an RPA amplification reagent and a CRISPR/Cas12a detection reagent, wherein the RPA amplification reagent contains an RPA amplification primer pair, the nucleotide sequence of the RPA amplification primer pair is shown as SEQ ID No.1 and SEQ ID No.2, the CRISPR/Cas12a detection reagent contains an sgRNA primer, and the nucleotide sequence of the sgRNA primer is shown as SEQ ID No.3 or SEQ ID No. 4.
Further, the RPA amplification reagent comprises: 10. Mu.L 2x Reaction Buffer,2. Mu.L 10 Xbasic E-mix,1.8mM dNTPs, 1. Mu.L 10mM forward/reverse primer, 1. Mu.L 20x Core Reaction Mix,1. Mu.L 280mM MgOAc.
Further, the CRISPR/Cas12a detection reagent contains: 150nM Lba Cas12a, 0.625. Mu.M sgRNA, 4. 4U/. Mu.L RNase inhibitor, 2. Mu.L NEBuffer 2.1,1. Mu.M fluorescence-quenched labeled ssDNA probe and DEPC water.
Compared with the prior art, the invention has the following beneficial effects:
the invention combines immune capture magnetic beads (IMB) pre-enrichment sample, RPA amplification and CRISPR/Cas12 detection method into a IMB-RPA-CRISPR/Cas12a molecular detection kit and detection method. The molecular detection method has the advantages of good specificity, extremely high sensitivity, simple and quick operation, low cost, no need of large-scale instruments and equipment, visualization and more contribution to popularization and application of the molecular detection technology of Shigella flexneri in a basic layer.
Drawings
The IMB constructed in fig. 1 was incubated with shigella flexneri solution to capture a map;
FIG. 2 sgRNA screening of CRISPR/Cas12a detection system;
FIG. 3 variation of fluorescence intensity with incubation time;
FIG. 4 sensitivity detection of IMB-RPA-CRISPR/Cas12a identification system;
FIG. 5 IMB-RPA-CRISPR/Cas12a identification system detection;
FIG. 6 case of the identification of clinical Shigella flexneri by IMB-RPA-CRISPR/Cas12 a.
Detailed Description
The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from commercial sources.
Example 1: construction of Immunocapture Magnetic Beads (IMB)
1.1 pretreatment of magnetic beads
The magnetic beads are oscillated for 1min in a vortex mode, so that the magnetic beads are fully oscillated and resuspended; 500. Mu.L of the magnetic bead suspension was placed in a 1.5mLEP tube, the EP tube was placed in a magnetic separation rack, the magnetic beads were enriched, and the supernatant was removed. 1mL of pre-chilled Wash Buffer A at 4deg.C was added to Wash, magnetic separation was performed, the supernatant was discarded, the EP tube was removed from the magnetic separator, and the Wash was repeated once.
1.2 antibody coupling
After magnetically separating the magnetic bead suspension pretreated in the step 1.1, 500 mu L of shigella flexneri antibody solution is added into an EP tube, and the mixture is vortexed for 30s to be uniformly mixed. The EP tube was vortexed for 15s and placed on a vertical mixer and mixed for 2h at room temperature. And enriching the magnetic beads by adopting a magnetic separation frame, and preserving the flowing-through liquid.
1.3 magnetic bead closure
Add 1mL Blocking Buffer to the EP tube, vortex for 30s, place the EP tube in a magnetic separation rack, enrich the beads, discard the supernatant. The operation was repeated four times. Then, 1.1 mL Blocking Buffer was added to the EP tube, and the mixture was vortexed for 30 seconds, and the EP tube was placed in a vertical mixer and reacted at room temperature for 2 hours. The EP tube was placed in a magnetic separation rack, the beads were enriched, and the supernatant was discarded. Add 1mL of ultrapure water to the EP tube, mix well, enrich the beads with a magnetic rack, discard the supernatant.
1.4 determination of antigen Capture time by immunomagnetic beads
Will be 5X 10 3 The CFU/mL shigella flexneri solution is added into the coupled magnetic bead solution combined with the shigella flexneri specific antibody in the step 1.3, and is placed in a horizontal shaking table for 100 revolutions per minute for room temperature incubation, magnetic separation is carried out every 10 minutes, and then the bacterial count in the supernatant is detected through plate counting.
As shown in FIG. 1, the IMB constructed in the present invention is 5.5X10 3 The upper capture limit was reached after incubation of CFU/mL Shigella flexneri solution for 30 min.
Example 2: specific target gene screening and establishing RPA amplification method
1.1 local BLAST analysis
Downloading Shigella flexneri whole genome sequence from NCBI (http:// www.ncbi.nlm.nih.gov/genome /), and carrying out local BLAST search on a local nucleic acid database to obtain the comparison result of each sequence fragment of the strain and the database.
1.2BLAST reconfirmation
The strain specificity and strain identification availability were confirmed using the online BLAST function using 2 strategies. One strategy is to exclude the target strain when BLAST, and the result shows that the target strain specific gene is the one without any similar sequence; the second strategy is to select for searching within the target species when BLAST, and the result is that a large number of similar sequences are returned to be the consensus sequences of different strains of the target species. Combining the two strategies, and finally finding out the target genes meeting the two strategy standards.
1.3 primer design
In the test, a specific primer is designed by using a hypothesis protein gene (hypothetical protein) of shigella flexneri and GenBank accession number AE014073 (4170556.. 4171068). Specific primers were designed by on-line design of specific oligonucleotide primer tools (https:// www.ncbi.nlm.nih.gov/tools/primer-blast/index. Cgilink_loc=blasthome), primer F: TTTGACCAAGCCTATCGTTGTTAATAATAC, primer R: AAACTTTCAGTTTATGGTCCGGGTTATTG, this primer was used for RPA amplification.
1.4RPA amplification reaction
Extraction of 1.4.1DNA
The extraction and recovery are carried out by using a small amount of extraction kit of the bacterial genome DNA of Tiangen biochemical technology (Beijing) limited company, and the steps are as follows:
(1) the bacterial culture was centrifuged at 10,000rpm for 1 minute at 5mL and the supernatant was aspirated as much as possible.
(2) 200. Mu.L of buffer GA was added to the bacterial pellet, and the pellet was shaken until it was thoroughly suspended.
(3) mu.L of the protease K solution was added to the tube and mixed well.
(4) 220. Mu.L of buffer GB was added, shaken for 15 seconds, allowed to stand at 70℃for 10 minutes, the solution was strained clear, and centrifuged briefly to remove water droplets on the inner wall of the tube cap.
(5) Adding 220 μl of absolute ethanol, shaking thoroughly, mixing for 15 seconds, and centrifuging briefly to remove water droplets on the inner wall of the tube cover.
(6) The solution obtained in the previous step and the flocculent precipitate were both put into an adsorption column CB3 (the adsorption column was put into a collection tube), centrifuged at 12,000rpm for 30 seconds, the waste liquid was poured out, and the adsorption column CB3 was put into the collection tube.
(7) 500. Mu.L of buffer GD was added to the adsorption column CB3, and the mixture was centrifuged at 12,000rpm for 30 seconds, and the waste liquid was poured off to place the adsorption column CB3 into a collection tube.
(8) 600. Mu.L of the rinse PW was added to the adsorption column CB3, centrifuged at 12,000rpm for 30 seconds, the waste liquid was poured off, and the adsorption column CB3 was placed in a collection tube.
(9) The operation 8 is repeated.
The adsorption column CB3 was returned to the collection tube and centrifuged at 12,000rpm for 2 minutes to discard the waste liquid. The adsorption column CB3 was left at room temperature for several minutes to thoroughly dry the residual rinse solution in the adsorption material.
1.4.2RPA amplification System
The DNA set forth above was taken for RPA reaction. The 20 μl reagent system comprises: 10. Mu.L 2x Reaction Buffer, 2. Mu.L 10 XBasic E-mix,1.8mM dNTPs, 1. Mu.L 10mM forward/reverse primer, 1. Mu.L 20x Core Reaction Mix,1. Mu.L 280mM MgOAc and 5. Mu.L template DNA. Reaction conditions: amplifying for 10min at 38 ℃.
Example 3: method for establishing IMB-RPA-CRISPR/Cas12a digestion
1.1 establishing an RPA-CRISPR/Cas12a identification System
Optimization of 1.1.1CRISPR/Cas12a detection System
4 sgRNA sequences for the hypothesis protein genes were designed, and the specific sequences were as follows:
sgRNA1：GAAUUUCUACUGUUGUAGAUUGCGGAGAGCAGUACUUCAGCGGA
sgRNA2：GAAUUUCUACUGUUGUAGAUUGGUCCGGGUUAUUGUCACCAGAA
sgRNA3：GAAUUUCUACUGUUGUAGAUCCUGACAACGCUUGAGCAGGAUCC
sgRNA4：GAAUUUCUACUGUUGUAGAUAGCAUCAUAUAACGCUUACCGCCA
to be captured by IMB 5X 10 3 CFU/mL of the DNA released by shigella flexneri is used as a template for RPA amplification, and RPA amplification reaction occurs at the bottom of the tube. A total of 20. Mu.LRPA reaction products are used as cleavage substrates, and 20. Mu.L of CRISPR/Cas12a reaction system is used for screening the sgRNA cleavage activity. To avoid aerosol propagation caused by uncapping operation after RPA amplification, a CRISPR/Cas12a reaction system was preset at the PCR tube cap, containing 150nM
Lba Cas12a, 0.625. Mu.M sgRNA, 4U/. Mu.L RNase inhibitor, 2. Mu.L NEBuffer 2.1,1. Mu.M FAM-BHQ1 labeled ssDNA probe (FAM-TTTTTT-BHQ 1) and DEPC water. After the RPA reaction for 10min was completed, the PCR reaction tube was inverted and subjected to digestion at 38℃for 40 min. The fluorescence signal is collected by a CFX96 Touch Real-Time PCR detection system, and the visual result is realized by a transmission light source with excitation wavelength of 485 nm.
As shown in fig. 2, the screening results of sgrnas of the crispr/Cas12a detection system showed that in the present invention, sgrnas 1 and 2 were fluorescent, and that sgRNA2 could generate brighter fluorescence under a transmission light source with excitation wavelength of 485nm, and that sgRNA2 was used as the detection for the subsequent experiments.
In order to further shorten the detection Time, the fluorescence generation process is collected by a CFX96 Touch Real-Time PCR detection system for Real-Time monitoring, and the fluorescence intensities at different Time points are recorded by mobile phone photographing.
As shown in FIG. 3, in the present invention, the fluorescence intensity was increased with the increase of the incubation time, and reached the maximum value in about 20 minutes. According to the fluorescence intensity at different time points, the enzyme digestion result can be visually judged in 10 minutes.
Sensitivity analysis of 1.1.2IMB-RPA-CRISPR/Cas12a detection method
The shigella flexneri after 10-time gradient dilution is enriched by using immune capture-free magnetic beads, DNA is released through heating after magnetic separation, and RPA-CRISPR/Cas12a detection is carried out, wherein the reaction system and the reaction procedure are as described above.
As shown in FIG. 4, the sensitivity detection result of the IMB-RPA-CRISPR/Cas12a identification system shows that the sensitivity of the IMB-RPA-CRISPR/Cas12a identification system in the invention is 5 multiplied by 10 0 CFU/mL bacterial liquid.
1.1.3IMB-RPA-CRISPR/Cas12a detection method specificity analysis
And detecting shigella flexneri, enterococcus faecalis, salmonella enteritidis, klebsiella pneumoniae, proteus mirabilis, escherichia coli and staphylococcus aureus according to the optimal reaction condition of the RPA reaction system and the optimal CRISPR/Cas12a cleavage reaction condition, and verifying the specificity detection of the method on the shigella flexneri.
As shown in FIG. 5, according to the detection of the IMB-RPA-CRISPR/Cas12a identification system, only shigella flexneri is detected to generate fluorescence to be positive, and enterococcus faecalis, salmonella enteritidis, klebsiella pneumoniae, proteus mirabilis, escherichia coli and Staphylococcus aureus are all negative and non-fluorescent.
Detection of clinical strain isolates by 1.1.4IMB-RPA-CRISPR/Cas12a detection method
For 20 clinical isolates of clinically identified shigella flexneri, shigella flexneri was enriched by IMB, DNA was released by heating after magnetic separation, and samples were then tested using RPA-CRISPR/Cas12a of the present invention to verify the ability of IMB-RPA-CRISPR/Cas12a to detect clinical isolates.
As shown in FIG. 6, the IMB-RPA-CRISPR/Cas12a identification system of the present invention was validated in 20 clinically identified clinical isolates of Shigella flexneri. The IMB-RPA-CRISPR/Cas12a detection method can be applied to detection of clinical isolates, and the IMB-RPA-CRISPR/Cas12a detection is more convenient and faster, has higher sensitivity and specificity, and can visually observe the detection result with naked eyes.
Sequence listing
<110> institute of blood transfusion at national academy of medical science
<120> method and kit for rapid visual detection of shigella flexneri
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
tttgaccaag cctatcgttg ttaataatac 30
<210> 2
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
aaactttcag tttatggtcc gggttattg 29
<210> 3
<211> 44
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gaauuucuac uguuguagau ugcggagagc aguacuucag cgga 44
<210> 4
<211> 44
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gaauuucuac uguuguagau ugguccgggu uauugucacc agaa 44
Claims (8)
1. The method for rapidly and visually detecting shigella flexneri based on IMB-RPA-CRISPR/Cas12a for the purpose of non-disease diagnosis is characterized by comprising the following steps:
(1) Enriching a sample to be detected by using immunomagnetic beads (IMB);
(2) Extracting total DNA of the solution obtained after the immunomagnetic bead separation in the step (1);
(3) Taking the total DNA obtained in the step (2) as a template, and taking RPA-F and RPA-R as primers to carry out Recombinase Polymerase Amplification (RPA) amplification, wherein the sequence of the RPA-F is shown as SEQ ID No.1, and the sequence of the RPA-R is shown as SEQ ID No. 2;
(4) And (3) performing enzyme digestion and fluorescence detection on the amplification product in the step (3) in a CRISPR/Cas12a detection system, wherein the sequence of the sgRNA in the CRISPR/Cas12a detection system is shown as SEQ ID No.3 or SEQ ID No. 4.
2. The method of claim 1, wherein in step (3), the reaction system for Recombinase Polymerase Amplification (RPA) amplification is: 20. mu.L of the reagent system comprises: 10. mu.L 2x Reaction Buffer,2. Mu.L 10 Xbasic E-mix,1.8mM dNTPs, 1. Mu.L 10mM forward/reverse primer, 1. Mu.L 20x Core Reaction Mix,1. Mu.L 280mM MgOAc and 5. Mu.L template DNA, reaction conditions: 38. amplifying for 10min at the temperature.
3. The method of claim 1, wherein in step (4), the CRISPR/Cas12a detection system comprises 150nM of Lba Cas12a,0.625 μΜ sgRNA,4U/μl rnase inhibitor, 2 μl of NEBuffer 2.1,1 μΜ fluorescent-quench labeled ssDNA probe and DEPC water.
4. The method of claim 1, wherein the fluorescence detection employs 485nm light source transmission.
5. The kit for rapidly and visually detecting shigella flexneri based on IMB-RPA-CRISPR/Cas12a comprises an RPA amplification reagent and a CRISPR/Cas12a detection reagent, wherein the RPA amplification reagent contains an RPA amplification primer pair, the nucleotide sequence of the RPA amplification primer pair is shown as SEQ ID No.1 and SEQ ID No.2, the CRISPR/Cas12a detection reagent contains an sgRNA primer, and the nucleotide sequence of the sgRNA primer is shown as SEQ ID No.3 or SEQ ID No. 4.
6. The kit of claim 5, wherein the RPA amplification reagents comprise: 10. mu.L 2x Reaction Buffer,2. Mu.L 10 Xbasic E-mix,1.8mM dNTPs, 1. Mu.L 10mM RPA amplification primer pair, 1. Mu.L 20x Core Reaction Mix,1. Mu.L 280mM MgOAc.
7. The kit of claim 5, wherein the CRISPR/Cas12a detection reagent comprises: 150nM Lba Cas12a, 0.625. Mu.M sgRNA, 4. 4U/. Mu.L RNase inhibitor, 2. Mu.L NEBuffer 2.1,1. Mu.M fluorescence-quenched labeled ssDNA probe and DEPC water.
8. The kit according to any one of claims 5 to 7, wherein the nucleotide sequence of the sgRNA primer is shown in SEQ id No. 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111393446.1A CN113999921B (en) | 2021-11-23 | 2021-11-23 | Method and kit for rapidly and visually detecting shigella flexneri |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111393446.1A CN113999921B (en) | 2021-11-23 | 2021-11-23 | Method and kit for rapidly and visually detecting shigella flexneri |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113999921A CN113999921A (en) | 2022-02-01 |
| CN113999921B true CN113999921B (en) | 2023-06-27 |
Family
ID=79929966
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111393446.1A Active CN113999921B (en) | 2021-11-23 | 2021-11-23 | Method and kit for rapidly and visually detecting shigella flexneri |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113999921B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114262707B (en) * | 2021-12-30 | 2023-04-28 | 四川大学 | sgRNA for detecting campylobacter jejuni gene, CRISPR/Cas12a system, kit, detection method and application |
| CN116516058A (en) * | 2023-06-28 | 2023-08-01 | 海南大学三亚南繁研究院 | Method and kit for visually detecting phytophthora sojae |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107488710A (en) * | 2017-07-14 | 2017-12-19 | 上海吐露港生物科技有限公司 | A kind of purposes of Cas albumen and the detection method and kit of target nucleic acids molecule |
| CN110684823A (en) * | 2019-10-23 | 2020-01-14 | 海南大学 | Test strip-based microorganism rapid diagnosis technology for Cas12a enzyme |
| CN111448311A (en) * | 2017-09-09 | 2020-07-24 | 博德研究所 | Multi-effector CRISPR-based diagnostic systems |
| CN111690717A (en) * | 2020-04-30 | 2020-09-22 | 山东舜丰生物科技有限公司 | Method and system for detecting target nucleic acid based on CRISPR technology |
| WO2021216868A1 (en) * | 2020-04-22 | 2021-10-28 | The Regents Of The University Of California | Methods for detecting and sequencing a target nucleic acid |
| CN113621717A (en) * | 2021-07-29 | 2021-11-09 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Streptococcus suis rapid visualization RPA detection kit based on CRISPR-Cas12a and application thereof |
-
2021
- 2021-11-23 CN CN202111393446.1A patent/CN113999921B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107488710A (en) * | 2017-07-14 | 2017-12-19 | 上海吐露港生物科技有限公司 | A kind of purposes of Cas albumen and the detection method and kit of target nucleic acids molecule |
| CN112501254A (en) * | 2017-07-14 | 2021-03-16 | 上海吐露港生物科技有限公司 | Application of Cas protein, and detection method and kit of target nucleic acid molecule |
| CN111448311A (en) * | 2017-09-09 | 2020-07-24 | 博德研究所 | Multi-effector CRISPR-based diagnostic systems |
| CN110684823A (en) * | 2019-10-23 | 2020-01-14 | 海南大学 | Test strip-based microorganism rapid diagnosis technology for Cas12a enzyme |
| WO2021216868A1 (en) * | 2020-04-22 | 2021-10-28 | The Regents Of The University Of California | Methods for detecting and sequencing a target nucleic acid |
| CN111690717A (en) * | 2020-04-30 | 2020-09-22 | 山东舜丰生物科技有限公司 | Method and system for detecting target nucleic acid based on CRISPR technology |
| CN113621717A (en) * | 2021-07-29 | 2021-11-09 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Streptococcus suis rapid visualization RPA detection kit based on CRISPR-Cas12a and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| CRISPR-Cas12a-assisted nucleic acid detection;Shi-Yuan Li等;《Cell Discovery》;第4卷(第20期);1-4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113999921A (en) | 2022-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110938676B (en) | Method, primer group and kit for rapidly detecting yersinia pseudotuberculosis at constant temperature | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN113999921B (en) | Method and kit for rapidly and visually detecting shigella flexneri | |
| Jin et al. | A real-time LAMP-based dual-sample microfluidic chip for rapid and simultaneous detection of multiple waterborne pathogenic bacteria from coastal waters | |
| CN103361429A (en) | LAMP detection primer, kit and detection method for staphylococcus aureus containing internal standard | |
| CN113801920A (en) | Kit and method for rapidly detecting salmonella based on CRSIPR-Cas system | |
| CN106967816A (en) | Detect the RPA specific primers of vibrio parahaemolytious and kit and application in food | |
| CN102586438A (en) | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms | |
| CN104263838B (en) | Listeria monocytogenes LAMP-LFD detection kit and detection method thereof | |
| CN101660005A (en) | Rapid diagnostic kit based on loop-mediated isothermal amplification technique for hepatitis A virus genes and detection method thereof | |
| CN104726581A (en) | Vibrio parahaemolyticus constant-temperature detection primer set, detection kit and detection method capable of avoiding false negative detection result | |
| CN107574261B (en) | Detection primer, detection kit and detection method for detecting hantavirus | |
| CN104846078A (en) | Campylobacter jejuni constant-temperature fluorescence detection primer group, kit, and detection method which are capable of avoiding false negative | |
| CN103937884A (en) | Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit | |
| Fernandez-Cassi et al. | Viral concentration and amplification from human serum samples prior to application of next-generation sequencing analysis | |
| CN106929510A (en) | A kind of specific nucleic acid aptamers and application | |
| CN104450930B (en) | A kind of molecular detecting method of vibrio parahemolyticus and its application | |
| CN101565753A (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN103160603A (en) | LAMP (loop-mediated isothermal amplification) detection kit of vibrio parahaemolyticus and detection method thereof | |
| CN114085917B (en) | Method and kit for rapid visual detection of shigella flexneri based on CRISPR/Cas12a-LAMP | |
| CN104531860B (en) | A kind of molecular detecting method of Shigella and its application | |
| Liao et al. | A dual RPA-LFD assay for the simultaneous detection of Salmonella typhimurium and Salmonella enteritidis | |
| CN106636474A (en) | Primer group, kit and method for detecting six mouse viruses by multiple immunity fluorescence | |
| CN113817854B (en) | Method for visually detecting salmonella genes by single-label ssDNA probe | |
| CN102605069B (en) | Enterohemorrhagic Escherichia coli O104: H4 detection kit and use method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |