CN106929510A - A kind of specific nucleic acid aptamers and application - Google Patents
A kind of specific nucleic acid aptamers and application Download PDFInfo
- Publication number
- CN106929510A CN106929510A CN201710247214.2A CN201710247214A CN106929510A CN 106929510 A CN106929510 A CN 106929510A CN 201710247214 A CN201710247214 A CN 201710247214A CN 106929510 A CN106929510 A CN 106929510A
- Authority
- CN
- China
- Prior art keywords
- aptamers
- fluorescence
- escherichia coli
- aptamer
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/24—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- G01N2333/245—Escherichia (G)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Hematology (AREA)
- Virology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides specific nucleic acid aptamers, its nucleotides sequence is classified as sequence table<400>Sequence shown in 1, the aptamer is cut down SELEX technology screenings and is obtained using full bacterium, and molecular weight is smaller, it is easy to synthesis and modification, being capable of high specific identification and high-affinity combination enterorrhagia Bacillus coil 0157:H7, occurrence features are not combined with other bacteriums, can be used to detect enterorrhagia Bacillus coil 0157:H7, for effectively preventing and controlling Escherichia coli O 157:H7 infection is significant.
Description
Technical field
The present invention relates to biological technical field, especially a kind of specific nucleic acid aptamers and application.
Background technology
(Enterohemorrhagic Escherichia coli, EHEC are a kind of to E.coli O157∶H7
Amphitrichous, without gemma, movable Gram-negative bacteria, it is a main bacterial type of EHEC.From 1982
Year has worldwide caused wide-scale distribution since the U.S. is identified and separates first.Escherichia coli O 157:H7 can mainly draw
Mankind's diarrhoea, hemorrhagic colitis, hemolytic uremic syndrome and thrombocytopenic purpura,thrombotic etc. are played, it is dead
Rate is up to 30%.Escherichia coli O 157:H7 is relatively wide respectively in nature, and pathogenicity is stronger after infection, and only dozens of viable bacteria is just
Alimentary infection can be triggered.In China, Escherichia coli O 157:H7 is the existing pathogenic original caused a significant threat to national health
One of.Therefore, efficiently, enzyme rapidly and sensitively detect Escherichia coli O 157:The method of H7 urgently needs.
Traditional Escherichia coli O157 detection method mainly includes selective medium isolated culture, biochemical method
Deng, the most complex operation step of these methods, and it is time-consuming more long.With the development of science and technology, some emerging detections are occurred in that
Method, the molecular biology method such as based on PCR, immunological method, Flow cytometry and gene chips etc., these sides
Method equally there is also expensive equipment, complex operation, the shortcomings of time-consuming.
Aptamer is phyletic evolution technology (the Systematic evolution of by exponential enrichment part
Ligands by exponential enrichment, SELEX), screening is obtained from external artificial synthesized nucleic acid library
The single stranded oligonucleotide of high-affinity, high specific binding target molecule, including ssDNA, RNA and modification RNA.Aptamers are because of its list
Chain structure, the three-D space structure that can form abundant self adaptation is combined with target molecule, expands the scope of target molecule.This
Outward, aptamer also have good stability, be easy to modify and preserve, non-immunogenicity the characteristics of.With reference to the advantage of aptamers,
In numerous detection fields, aptamers as a kind of new recognition component have become efficiently, Fast Detection Technique research
Focus.Therefore, Escherichia coli O 157 is screened:The Escherichia coli of specific nucleic acid aptamers and foundation based on aptamers of H7
O157:The Fast Detection Technique of H7 has important application value.
The content of the invention
The technical problems to be solved by the invention are to provide a kind of specific nucleic acid aptamers, can be specifically bound big
Enterobacteria O157:H7.
Another technical problem to be solved by this invention is to provide the application of above-mentioned specific nucleic acid aptamers.
In order to solve the above technical problems, the technical scheme is that：
A kind of specific nucleic acid aptamers, can be with enterorrhagia Bacillus coil 0157:H7 specifically binds, the nucleic acid
The nucleotides sequence of aptamers (A46) is classified as sequence table<400>Sequence shown in 1.
Preferably, above-mentioned aptamer A46, described aptamer is returned for artificial synthesized or PCR expands or cut glue
Receive single stranded DNA to obtain after purification, the aptamer is single stranded DNA, is made up of 88 nucleotides, its primary structure is straight chain
Shape；Secondary structure is stem ring, and minimum free energy is 11.96kcal/mol.
Preferably, above-mentioned aptamer (A46), can be modified the aptamer A46, institute with decorative material
Decorative material is stated for functional group, nano material and/or protide material.
Above-mentioned aptamer (A46) is being prepared to enterorrhagia Bacillus coil 0157:H7 is qualitative and quantitative detecting reagent
In application, for example, in can be widely applied to fluorescence detection method, enzyme-linked immunoassay method and biology sensor.
Preferably, the application of above-mentioned aptamer (A46), the enterorrhagia Bacillus coil 0157:H7 is pure sample
Or EHEC in food.
The beneficial effects of the invention are as follows：
The aptamer is cut down SELEX technology screenings and is obtained using full bacterium, and molecular weight is smaller, it is easy to synthesizes and repaiies
Decorations, being capable of high specific identification and high-affinity combination enterorrhagia Bacillus coil 0157:H7, does not occur with other bacteriums
Characteristic is combined, and can be used to detect enterorrhagia Bacillus coil 0157:H7, for effectively preventing and controlling Escherichia coli O 157:
H7 infection is significant.
Brief description of the drawings
Fig. 1 is each round library and EHEC in fluorescence Percentage bound experimental monitoring aptamers screening process
O157:H7 joint efficiency figures.
Fig. 2 is enterorrhagia Bacillus coil 0157:The secondary structure prediction figure of H7 aptamers.
Fig. 3 is enterorrhagia Bacillus coil 0157:The dissociation constant matched curve figure of H7 and its aptamer.
Fig. 4 is that fluorescence chemical analysis method detects enterorrhagia Bacillus coil 0157:The specificity figure of H7 aptamers.
Fig. 5 is Flow cytometry enterorrhagia Bacillus coil 0157:The specificity figure of H7 aptamers.
Fig. 6 is laser confocal microscrope method detection detection enterorrhagia Bacillus coil 0157:H7 aptamers it is special
Property figure, for observing aptamers A46 specific outcomes analysis (a~e) under laser confocal microscope in, L- represents white light and swashs
Hair；F- represents fluorescence excitation；M- represents white light and fluorescence excitation overlapping results.
Fig. 7 is the canonical plotting of the nanometer magnetic bead-aptamers fluorescence detection method built based on aptamers.
Specific embodiment
In order that those skilled in the art is better understood from technical scheme, it is below in conjunction with the accompanying drawings and specific real
Example is applied to be described in further detail technical scheme of the present invention.Experimental technique used in embodiment is such as without special theory
Bright to be conventional method, reagent, the consumptive material for using non-conventional commercial reagent or are prepared according to a conventional method unless otherwise specified
Reagent.
Embodiment 1
Full bacterium abatement SELEX technology screenings and enterorrhagia Bacillus coil 0157:The aptamer of H7 specific bonds
(1) synthesis of random single chain DNA (ssDNA) library and primer
SsDNA pool is as follows with reference to pertinent literature：
5 '-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3 ', middle random areas are
45 nucleotides, two ends are FX, and sequence overall length is 88 nucleotides, and storage capacity is 445.Screening primer sequence used
Respectively：
Primer Ⅰ：5’-GCAATGGTACGGTACTTCC-3’
Primer Ⅱ：5’-TTAGCAAAGTAGCGTGCACTTTTG-3’
Primer Ⅲ：5’-GCTAAGCGGGTGGGACTTCCTAGTCCCACCCGCTTAGCAAAGTAGCGTGCACTTTT
G-3’
Wherein Primer I needs FITC fluorophors to be modified in the preparation process of secondary library.It is glimmering what is built
Aptamers A46 needs to carry out biotin modification in light detection method.
Above-mentioned nucleotide sequence is completed by Shanghai life work biology Co., Ltd.
(2) screening bacterial strain uses therefor and its culture and collection
Above-mentioned all strains examined is provided by Hygiene ＆ Environmental Medical Science Inst., Academy of Military Medical Scien.
It is E.coli O157 to test the target bacteria chosen:H7(CICC 21530)；The abatement bacterium of selection is Escherichia coli
(ATCC 25922), Shigella (CICC 21534), salmonella (CMCC 50115).Concrete operation method is as follows：First
Superclean bench ultraviolet irradiation sterilizing 30min, seeded process are carried out into sterile working, the strain by 4 plants of preservations respectively takes 50 μ respectively
L is inoculated into four LB broth bouillons of autoclave sterilization, is cultivated in 37 DEG C of constant-temperature table incubators to bacterial concentration
107cfu/ml.4 1.5ml centrifuge tubes of autoclave sterilization are taken respectively, do corresponding mark；In an aseptic environment, liquid relief is used
Device respectively takes out 1ml bacterium solutions and is added in corresponding centrifuge tube, 5000r/min centrifugation 5min, supernatant culture medium is discarded, with 1 × PBS
Buffer solution is resuspended by bacterial sediment, again 5000r/min centrifugations 5min.Washed 3 times using PBS, finally thalline sinks
Form sediment using 100 μ l PBSs it is resuspended, be stored in 4 DEG C it is standby.
(3) SELEX screening processes are cut down
The first run screening method be：
1) the ssDNA libraries of external artificial synthesized 1.5nmol are dissolved in 100 μ l combination buffers
In, it is extremely sufficiently cool on ice in being immediately placed in after 95 DEG C of thermal denaturation 10min；
2) then with 1 × 10 for preparing7E.coli O157:H7 and the combination buffering in suitable volumes
Mixed in solution, 37 DEG C of shaking table 180r/min are incubated 1h, ssDNA libraries is fully acted on bacterium；
3) 8000r/min centrifugations 10min, abandons supernatant, is washed (in order to increase knot using lavation buffer solution
Intensity is closed, the increase washing times with wheel number accordingly increase)；
4) bacterial precipitation after washing with reference to ssDNA is dissolved in 100 μ l distilled waters, as template, uses primer
Primer I and Primer III carry out asymmetric PCR amplification；
5) amplification system is respectively sense primer Primer I (10 μM) and anti-sense primer Primer III (10 μM) with condition
Each 1.5 μ l, Premix Taq enzyme 25 μ L, template target bacteria-ssDNA compound 5 μ l, the μ l of sterile deionized water (dd H2O) 17.
PCR amplification programs：Global cycle number is 35, and denaturation temperature is 95 DEG C, and the time continues 5min；Denaturation temperature is 95 DEG C, when continuing
Between be 1min, annealing temperature is 37 DEG C, and the duration is 30s, and elongating temperature is 58 DEG C, and the duration is 40s.Circulation terminates
Afterwards, last elongating temperature is 58 DEG C, and the duration is 2min.
It is prepared by secondary library：
1) pcr amplification product carries out electrophoresis using the polyacrylamide gel (PAGE) of 7M urea 10%；
2) blob of viscose is put into gel imaging instrument, opens uviol lamp, cut purpose fragment is careful using scalpel；
3) blob of viscose with target DNA that will be cut is placed in 1.5ml centrifuge tubes, and centrifuge tube weighs weight and marks in advance
Note, the purpose fragment that each round is cut in 2 pieces of 9ml gel pieces carries out DNA recovery, with the amount of DNA for ensureing to reclaim；
4) extracted using raw work PAGE glue DNA QIAquick Gel Extraction Kits and reclaim DNA；
5) ssDNA for obtaining recovery purifying carries out concentration and purity testing, to ensure that next round screens the purity in library
Requirement is reached with usage amount.
In order to shorten screening time, increase screening efficiency, improve the specificity of screening aptamers, disappear in the 2nd to 7 wheel addition
Subtracting bacterium carries out abatement screening.By the upper ssDNA libraries for preparing of taking turns through nucleic acid-protein analyzer measure concentration, calculate down
The volume of one wheel Select to use ssDNA solution.In screening process is cut down, ssDNA libraries are mixed with abatement bacterium first and is incubated
1h is educated, is then incorporated into cutting down the ssDNA on bacterium and is got rid of through centrifugation, using the ssDNA of uncombined abatement bacterium as disappearing
Subtract library to be incubated with target bacteria again, screened, the screening step same first round afterwards.Reciprocal with this, this experiment has carried out altogether 7 wheels
Screening.Each of which wheel is related to hatching combination, the operation of washing, and all thalline re-suspension liquid is transferred in a new centrifuge tube,
The non-specific adsorption of ssDNA is disturbed with eliminating tube wall.Each round screening is respectively provided with negative control, i.e., except experimental group is added
The ssDNA for entering is substituted for beyond isometric 1 × PBS screening buffer solutions, and other operations are all identical with experimental group.Each round
Screening conditions are shown in Table 1.
Table 1 respectively takes turns screening conditions
Embodiment 2
Fluorescence chemical analysis method monitors screening process
(1) preparation of fluorescence initial libraries and secondary library
1) the initial random ssDNA libraries of FITC fluorescence labelings are directly synthesized by Shanghai life work biology Co., Ltd；
2) the secondary ssDNA libraries of FITC fluorescence labelings are obtained by gel extraction purification experiment, are comprised the following steps that：
1. the ssDAN- target bacterias for obtaining are screened as template with every wheel, the Primer I of Sheng Gong companies synthesis FITC marks is
Sense primer, other primers and PCR conditions are constant, with reference to the PCR amplification system and condition of first run screening in embodiment 1；
2. amplified production is kept in dark place, the ssDNA libraries of FITC marks are prepared with reference to the secondary library system in embodiment 1
Standby step；
The ssDNA libraries lucifuge of the FITC fluorescence labelings for 3. being prepared by each round is in -20 DEG C of preservations.
(2) fluorescence intensity detection
1) ssDNA of each round fluorescence labeling respectively takes out 25pmol, and its fluorescent value F0 is determined using fluorescence chemical analysis instrument,
Then respectively with 107The target bacteria mixing of cfu/ml is incubated 1h；
2) will be combined with the bacterium of ssDNA centrifugation, washing after it is resuspended with 300 μ 1 × PBS solutions of l；
3) the ssDNA solution of FITC fluorescence labelings and then 95 DEG C of heating make ssDNA- target bacteria complex dissociations, is obtained, it is glimmering
CLA Chemilumineceut Analyzer determines its fluorescent value F1；
4) calculate it is each wheel Percentage bound R=F1/F0 × 100%, with this monitor it is each wheel screening effect and with target bacteria knot
The enrichment condition of the ssDNA of conjunction.
Each round ssDNA libraries and target bacteria Escherichia coli O 157:The joint efficiency of H7 is shown in accompanying drawing 1, with screening round
Gradually increase, ssDNA libraries gradually increase with the Percentage bound of target bacteria, whole although 7th round has declined compared with the 6th wheel
Body trend tends towards stability, therefore screening carries out seven wheels altogether.
Embodiment 3
Clone and sequencing
(1) screened by 7 wheels, chosen with the wheel screening product of target bacteria joint efficiency highest the 6th as template, utilized
Primer sense primer Primer I and anti-sense primer Primer II enter performing PCR amplification, and amplification system is with condition with reference to embodiment 1
Middle PCR programs；
(2) PCR primer is connected to cloning vector pMD19-T, carries out blue hickie and select, plasmid is extracted after thalline culture,
Plasmid is sent to the sequencing of Shanghai life work biology Co., Ltd；
(3) homology and secondary structure prediction are carried out to sequencing result using Chromas and DNAMAN softwares, it is final to obtain
To with Escherichia coli O 157:The sequence of the aptamer (being named as A46) of H7 specific bonds (is sequence table<400>Sequence shown in 1
Row) and prediction secondary structure figure (see Fig. 2).With Escherichia coli O 157:The aptamers A46 sequence lengths of H7 specific bonds：88
Base；Sequence type：Nucleic acid, it is single-stranded；Sequence species：ssDNA.Its secondary structure prognostic chart shows that aptamers contain prominent
Loop-stem structure, its minimum free energy is 11.96kcal/mol, and the structure has stability higher.
Embodiment 4
Fluorescence chemical analysis method determines the compatibility of aptamer
(1) aptamers A46 is carried out into FITC fluorescence labelings, the aptamers for being configured to various concentrations gradient using confining liquid are molten
Liquid, concentration is respectively 10,20,50,100,200,400,600,800,1000nM；
(2) respectively with 107The Escherichia coli O 157 of cfu/ml:H7 37 DEG C of shaking tables in 300 μ l confining liquids are incubated 1h, from
Supernatant is abandoned in the heart, washing；
(3) bacterial sediment that will combine aptamers uses 300 μ l ddH2O is resuspended, 95 DEG C of heating 5min, is immediately placed on
Cooled on ice to room temperature, 10000r/min centrifugation 10min, reservation supernatant keeps in dark place in new centrifuge tube；
(4) its fluorescent value is determined using fluorescence chemical analysis instrument, uses OriginPro8.0 Software on Drawing nonlinear fittings
Binding curve, and the dissociation constant Kd values of aptamers A46 are calculated, computing formula is Y=Bmax/X+Kd.(wherein Y is measure
Fluorescent value, Bmax is maximum fluorescence value in system, and X is adaptation bulk concentration).
As shown in figure 3, having obtained the saturation binding curve of aptamer A46, and it is calculated the solution of aptamers A46
It is 82.45 ± 18.46nM from constant Kd values, illustrates aptamer A46 and Escherichia coli O 157:The affinity of H7 is preferable.
Embodiment 4
The specificity analysis of aptamer A46
By the preferable aptamers A46 flag Fs ITC fluorophors of affinity, respectively take 25pmol aptamers A46 then respectively with
106The Escherichia coli O 157 of cfu/ml:H7, Escherichia coli ATCC 25922, shigella flexneri CICC 21534, mouse typhus are husky
Door Salmonella CMCC 50115, enterococcus faecalis ATCC 29212 is mixed in confining liquid, and 37 DEG C of lucifuges are incubated 1h, and each sample is set
3 groups of experimental groups and control group (be not added with FITC fluorescence aptamers, add 1 isometric × PBS, other with experiment
Group is identical), thalline-adaptor complex is obtained by steps such as wash-out, centrifugations, 1 × PBS is added by thalline-adaptation
Body precipitation is resuspended.Re-suspension liquid is applied into three kinds of fluorescence chemical analysis instrument, flow cytometer and laser confocal microscope respectively
Method, specificity of the detection aptamers A46 to target bacteria.
(1) fluorescence chemical analysis method detects the specificity of aptamers
1) fluorescence chemical analysis instrument is connected with computer first, after opening instrument, detection parameter is set, choose excitation wave
Long and launch wavelength is respectively 485nm and 535nm；
2) the black ELISA Plate of blank is scanned detection, to determine blank value；
3) the 200 μ l of sample suspension for taking each group respectively are added to upper machine testing in black ELISA Plate,
Measure system fluorescent value.
Fluorescence chemical analysis instrument detection bacterium combined with aptamers after fluorescence intensity, as a result as shown in Figure 4.Respectively with not
Add the group of fluorescence aptamers A46 as a control group, represented with green in fig. 4；To add the group of fluorescence aptamers as reality
Group is tested, is represented with red in fig. 4.According to result figure as can be seen that the substrate fluorescent value of five kinds of bacteriums is very low, respectively less than 0.7,
It is considered that substrate value will not have significant impact to result.Escherichia coli reference culture, good fortune formula Shigella, enterococcus faecalis and
The experimental group of salmonella and its corresponding control group fluorescence intensity do not have difference or difference smaller substantially, and Escherichia coli
O157:After H7 and aptamers hatching combination, fluorescence intensity reaches more than 14.With Escherichia coli O 157:H7 control groups are compared, experiment
The fluorescent value of group system is increased substantially, and illustrates the aptamers A46 and Escherichia coli O 157 of mark fluorescent:H7 Percentage bounds are higher,
And it is very low with other 4 kinds of bacterium Percentage bounds or be not bound with.It is possible thereby to judge that aptamers A46 has certain specific recognition
And combine Escherichia coli O 157:The ability of H7.
(2) the special opposite sex of Flow cytometry aptamers
1) it is added in flow cytometer detection pipe after the μ l suspension of thalline 300 is filtered using cell sieve；
2) exciting light is set and transmitting optical parameter is respectively 485nm and 535nm, select FL1 passages；
3) upper machine testing cell fluorescence intensity is connected.
Fig. 5 is that aptamers A46 is combined rear flow cytometer showed comparison result with 5 kinds of bacterial incubations respectively.Each color in Fig. 5
Curve correspond to a kind of flow cytometer showed result of bacterium respectively, as can be seen from the figure the combination situation of aptamers and bacterium, will
Overall fluorescence intensity is concentrated on after Hayes bacterium, Escherichia coli, salmonella and enterococcus faecalis and aptamers A46 hatching combinations
100Left and right；Escherichia coli O 157:After H7 and aptamers A46 hatching combinations, cell integral fluorescence intensity peak there occurs to the right bright
Aobvious skew, peak value is close to 101, show aptamers A46 to Escherichia coli O 157:H7 has specific binding capacity higher.
(3) laser confocal microscope detects the specificity of aptamers
1) 20 μ l thallus suspension liquids are applied and is downloaded on clean slide；
2) dry under rear slide is placed in confocal microscope and observe；
3) confocal laser scanning microscope multiple selection 80 ×, select FITC fluorescence parameters；
4) after observing fluorescence under eyepiece, using white light and the common overlapping scan of fluorescence, Taking Pictures recording.
Confocal laser scanning microscope result is as shown in Figure 6.Use 80 × multiplication factor of laser confocal microscope, choosing
Taking the same visual field carries out white light and fluorescence dual wavelength while exciting, the combination situation of observation bacterium and aptamers A46.5 kinds in Fig. 6
Bacterium can observe under white light (L), illustrate that bacterium is successfully fixed on slide.Under fluorescence excitation, Escherichia coli
O157:There are a large amount of green fluorescences (a-M) in H7, illustrates that aptamers are largely combined with target bacteria；The bacterium of green fluorescent label is complete
Portion is successfully overlap with the bacterium under white light (a-F), and illustrate display fluorescence is all target bacteria, rather than impurity non-specific adsorption
Aptamers and the false positive results that produce；Can be seen that Most bacterial all shows green fluorescence by overlay chart picture, this expression
Aptamers A46 and Escherichia coli O 157:The Percentage bound of H7 is very high.And Escherichia coli reference culture, Shigella and mouse typhus are husky
Door Salmonella only finds individual green fluorescence (b-F, c-F, e-F) under fluorescence excitation, and enterococcus faecalis is glimmering without finding under fluorescence
Light (d-F), it can thus be seen that aptamers A46 hardly with except Escherichia coli O 157:Bacterium beyond H7 combines.Tie above
Fruit shows that the of a relatively high aptamers A46 of affinity is recognized to target bacteria and the specificity of combination is also stronger.
Analyzed by affinity and specificity, find to screen the aptamers A46 for obtaining to target bacteria Escherichia coli O 157:H7
Can be combined with special, high-affinity high.Therefore, herein on basis, detection Escherichia coli O 157 is built with reference to nanometer magnetic bead:H7
Fluorescence detection method.
Embodiment 5
The standard curve of the nanometer magnetic bead-aptamers fluorescence detection method built based on aptamers
(1) with reference to M-280 magnetic bead operation instructions steps, the preservative of magnetic bead surfaces is washed first；(2) according to
(1mg Streptavidin MagneSpheres can combine the oligonucleotides point of 200pmol to the amount that the magnetic bead of checking is combined with DNA oligonucleotides
Son), to the excessive 5 ' aptamers for holding biotinylation to modify are added in the magnetic bead of equally distributed 1mg/ml, make at a temperature of 37 DEG C
Slow vibration is carried out with rotary mixer and is incubated 30min；
(3) reaction terminate after by magnetic separator reclaim magnetic bead, 1 × PBS wash 3 times, remove not with magnetic bead knot
The aptamers of conjunction, the amount for being initially added aptamers subtracts uncombined aptamers, and what is obtained is exactly the aptamers combined with magnetic bead
Total amount；
(4) 200 μ l magnetic beads-aptamers are taken as capture probe, there is 10 in capture reaction system7The target of cfu/ml is thin
Bacterium, must be incubated volume for 300 μ l, use rotary mixer incubation time 30min；
(5) magnetic bead aptamers-target bacteria is reclaimed by magnetic separator, each Magneto separate time is 3min, answers magnetic particle
Compound is recovered completely, is washed three times using 1 × PBS, to remove the bacterium not combined with capture probe；
(6) aptamers of FITC fluorescence labelings are added thereto to, with 37 DEG C of hatching combination 1h, magnetic are enriched with magnetic fields
Pearl, removes the fluorescence aptamers not combined with target bacteria for three times using the washing of 1 × PBS；
(7) precipitation is resuspended in 300 μ 1 × PBSs of l uses fluorescence chemical analysis instrument measure fluorescence intensity (to swash
Hair wavelength 485nm, launch wavelength 535nm).
(8) Escherichia coli O 157 of 100 μ l various concentrations gradients is taken respectively:H7 bacterium solutions carry out flat board culture counting；
(9) bacterium solution of various concentrations is added in reaction system respectively with reference to the method for (1) to (7), using Fluoresceinated
Credit analyzer measures corresponding fluorescence intensity level.
(10) using the analysis of fluorescence values of software Origin 8.0 and the relation of plate culture clump count, and related song is drawn
Line, determines LDL.
Under optimal experiment condition, Escherichia coli O 157 is explored:Relation between H7 clump counts and fluorescence intensity.As a result
As shown in fig. 7, the fluorescent value that experiment is measured counts linear with corresponding bacteria plate culture, and correlation is good
It is good.Escherichia coli O 157:H7 fluoroscopic examinations are IF=0.006x+4.992 (R with plate count linear correlation equation2=
0.982), linear detection range is 90~5 × 104Cfu/ml, detection is limited to 90cfu/ml.
Above-mentioned reference specific embodiment is to the enterorrhagia Bacillus coil 0157:The aptamer of H7 specific bonds and
It is illustrative rather than limited using the detailed description for carrying out, several implementations can be included according to limited scope
Example, therefore changing and modifications in the case where present general inventive concept is not departed from, should belong within protection scope of the present invention.
SEQUENCE LISTING
<110>Inst. of Hygienics and Environmental Medical Science, Academy of Military Medici
<120>A kind of specific nucleic acid aptamers and application
<130> 2017
<141> 2017-03-08
<150> 2016112034807
<151> 2016-12-23
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 88
<212> DNA
<213>Bacterium
<220>
<221>Specific nucleic acid aptamers A46
<222> (1)..(88)
<400> 1
gcaatggtac ggtacttccc gcagtttggg aagggtgatc gcactatcag aggattccgt 60
tcggcaaaag tgcacgctac tttgctaa 88
<210> 2
<211> 19
<212> DNA
<213>Primer
<220>
<221> PrimerⅠ
<222> (1)..(19)
<400> 2
gcaatggtac ggtacttcc 19
<210> 3
<211> 24
<212> DNA
<213>Primer
<220>
<221> PrimerⅡ
<222> (1)..(24)
<400> 3
ttagcaaagt agcgtgcact tttg 24
<210> 4
<211> 57
<212> DNA
<213>Primer
<220>
<221> PrimerⅢ
<222> (1)..(57)
<400> 4
gctaagcggg tgggacttcc tagtcccacc cgcttagcaa agtagcgtgc acttttg 57
Claims (4)
1. a kind of specific nucleic acid aptamers, it is characterised in that：Nucleotides sequence is classified as sequence table<400>Sequence shown in 1.
2. aptamer according to claim 1, it is characterised in that：With enterorrhagia Bacillus coil 0157:H7 is special
Property combine.
3. aptamer according to claim 1, it is characterised in that：Can be with decorative material to the aptamer
A46 is modified, and the decorative material is functional group, nano material and/or protide material.
4. aptamer described in claim 1 is being prepared to enterorrhagia Bacillus coil 0157:H7 is qualitative and quantitative determination is tried
Application in agent.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2016112034807 | 2016-12-23 | ||
| CN201611203480 | 2016-12-23 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106929510A true CN106929510A (en) | 2017-07-07 |
Family
ID=59436810
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710247214.2A Pending CN106929510A (en) | 2016-12-23 | 2017-04-17 | A kind of specific nucleic acid aptamers and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106929510A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108396029A (en) * | 2018-03-08 | 2018-08-14 | 江南大学 | One group-specific identifies different growing stage Escherichia coli O 157:The oligonucleotides aptamers of H7 |
| CN108753789A (en) * | 2018-05-25 | 2018-11-06 | 中国海洋大学 | The screening technique of aptamer and the aptamer for specifically binding pseudomonas aeruginosa |
| CN110261608A (en) * | 2019-05-29 | 2019-09-20 | 江苏大学 | Food E. coli clones Visual retrieval and automated enumeration method based on magnetic fluorescence probe |
| CN114149941A (en) * | 2021-10-29 | 2022-03-08 | 上海交通大学医学院附属仁济医院 | Bacterium with surface combined with targeting ligand and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013064818A1 (en) * | 2011-10-31 | 2013-05-10 | Dupont Nutrition Biosciences Aps | Aptamers |
| CN105925661A (en) * | 2016-06-27 | 2016-09-07 | 杨国林 | Kit for detecting EHEC (enterohemorrhagic escherichia coli) in foods |
-
2017
- 2017-04-17 CN CN201710247214.2A patent/CN106929510A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013064818A1 (en) * | 2011-10-31 | 2013-05-10 | Dupont Nutrition Biosciences Aps | Aptamers |
| CN105925661A (en) * | 2016-06-27 | 2016-09-07 | 杨国林 | Kit for detecting EHEC (enterohemorrhagic escherichia coli) in foods |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108396029A (en) * | 2018-03-08 | 2018-08-14 | 江南大学 | One group-specific identifies different growing stage Escherichia coli O 157:The oligonucleotides aptamers of H7 |
| CN108396029B (en) * | 2018-03-08 | 2021-03-23 | 江南大学 | A group of oligonucleotide aptamers capable of specifically recognizing Escherichia coli O157H 7 in different growth stages |
| CN108753789A (en) * | 2018-05-25 | 2018-11-06 | 中国海洋大学 | The screening technique of aptamer and the aptamer for specifically binding pseudomonas aeruginosa |
| CN108753789B (en) * | 2018-05-25 | 2021-02-19 | 中国海洋大学 | Screening method of aptamer and aptamer specifically binding to pseudomonas aeruginosa |
| CN110261608A (en) * | 2019-05-29 | 2019-09-20 | 江苏大学 | Food E. coli clones Visual retrieval and automated enumeration method based on magnetic fluorescence probe |
| CN110261608B (en) * | 2019-05-29 | 2022-03-22 | 江苏大学 | Visual detection and automatic counting method for food escherichia coli colony based on magnetic fluorescent probe |
| CN114149941A (en) * | 2021-10-29 | 2022-03-08 | 上海交通大学医学院附属仁济医院 | Bacterium with surface combined with targeting ligand and application thereof |
| CN114149941B (en) * | 2021-10-29 | 2023-09-19 | 上海交通大学医学院附属仁济医院 | Bacteria with surface combined with targeting ligand and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Past, present and future applications of flow cytometry in aquatic microbiology | |
| Jasson et al. | Alternative microbial methods: An overview and selection criteria | |
| Li et al. | Development of a magnetic nanoparticles microarray for simultaneous and simple detection of foodborne pathogens | |
| Kennedy et al. | Application of flow cytometry to the detection of pathogenic bacteria | |
| CN106929510A (en) | A kind of specific nucleic acid aptamers and application | |
| Köster et al. | Analytical methods for microbiological water quality testing | |
| CN101570783A (en) | Detection kit and detection method for 9 species of pathogenic organisms in marine products | |
| CN106967816A (en) | Detect the RPA specific primers of vibrio parahaemolytious and kit and application in food | |
| CN106755358B (en) | Method for detecting vibrio parahaemolyticus by combining multi-cross amplification with gold nano biosensing | |
| CN109161547B (en) | Nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus | |
| CN112111494B (en) | DNAzymes for identifying pseudomonas aeruginosa, screening and detecting method and application | |
| Fuhrman et al. | Prokaryotic and viral diversity patterns in marine plankton | |
| CN104745588A (en) | Specific nucleic acid aptamer for recognizing streptomycin and application of nucleic acid aptamer to streptomycin detection | |
| CN113999921B (en) | Method and kit for rapidly and visually detecting shigella flexneri | |
| Rohde et al. | Detection of foodborne bacterial zoonoses by fluorescence in situ hybridization | |
| Alegbeleye et al. | Microbiological quality of irrigation water for cultivation of fruits and vegetables: An overview of available guidelines, water testing strategies and some factors that influence compliance. | |
| Cronin et al. | The potential of flow cytometry in the study of Bacillus cereus | |
| CN106636474B (en) | Six kinds of viral primer sets of Multiple immunizations fluoroscopic examination mouse, kit and method | |
| CN108624653A (en) | A kind of kit of quantum dot detection of nucleic acids for bloodstream infection pathogen | |
| CN108251429A (en) | A kind of aptamer Met-G02 and its application with acephatemet specific binding | |
| Tarh | A Review on Diagnostic Methods for the Identification of Vibrio cholerae | |
| CN106544447B (en) | A kind of Multiple immunizations fluorescence analysis primer, kit and method for detecting chicken Marek's disease virus and chicken infectious anemia virus | |
| CN112175958B (en) | Optimized aptamer sequence for specifically recognizing Listeria monocytogenes and application thereof | |
| CN108504756A (en) | Aeromonas veronii detection primer, kit, detection method and its development approach based on specific sequence | |
| Du et al. | Rapid detection and differentiation of Legionella pneumophila and non-Legionella pneumophila species by using recombinase polymerase amplification combined with EuNPs-based lateral flow immunochromatography |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170707 |
|
| RJ01 | Rejection of invention patent application after publication |