CN104745588A - Specific nucleic acid aptamer for recognizing streptomycin and application of nucleic acid aptamer to streptomycin detection - Google Patents
Specific nucleic acid aptamer for recognizing streptomycin and application of nucleic acid aptamer to streptomycin detection Download PDFInfo
- Publication number
- CN104745588A CN104745588A CN201510106215.6A CN201510106215A CN104745588A CN 104745588 A CN104745588 A CN 104745588A CN 201510106215 A CN201510106215 A CN 201510106215A CN 104745588 A CN104745588 A CN 104745588A
- Authority
- CN
- China
- Prior art keywords
- streptomycin
- aptamer
- streptomycin sulphate
- concentration
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific nucleic acid aptamer for recognizing streptomycin. The nucleotide sequence of the aptamer is shown as SEQ ID NO: 1. Meanwhile, the invention further discloses a method for qualitatively and quantitatively determining streptomycin by using the nucleic acid aptamer and application of the nucleic acid aptamer to food inspection. According to the invention, streptomycin is taken as a target substance, and a high-affinity and high-specificity nucleic acid aptamer for recognizing streptomycin is screened by an SELEX technology through affinity chromatography and is combined with colloidal gold colorimetry, so that a novel streptomycin detection method based on the aptamer is built. The method can be used for qualitative or quantitative detection of streptomycin simply, quickly, accurately, economically and specifically, and can be widely applied to the fields of food, sanitation, import and export inspection and quarantine, and the like.
Description
Technical field
The present invention relates to field of biological technology detection, specifically a kind of nucleic acid aptamer of specific recognition Streptomycin sulphate and application thereof.
Background technology
Streptomycin sulphate (streptomycin) is a kind of broad-spectrum aminoglycoside class microbiotic, can suppress gram negative bacillus and part Gram-positive bacillus, be widely used in medicine, agricultural and livestock industry.But, in actual use, owing to using unreasonable or illegal use, cause its remaining in a large number in the animal derived foods such as meat, liver, kidney, milk and honey, seriously compromise human health, people can be made to produce a series of anaphylaxis and the illness such as renal toxicity, ototoxicity, even can cause becoming deaf.Therefore, strict regulation has all been done to the maximum residue limit of Streptomycin sulphate in many countries and regions such as FDA, European Union and China, visible, and whether detection Streptomycin sulphate remains in food and how many residual quantities has great importance.
At present, the detection method of Determination of Streptomycin Residues mainly contains following three kinds: 1, liquid chromatograph mass spectrography detection method, the separating power of chromatogram combines with mass spectrographic qualitative function by the method, realize complex mixture quantitative and qualitative analysis more accurately, it is a kind of method of sensitive reliable detection Determination of Streptomycin Residues, its detection line in milk can be low to moderate 10 μ g/kg, and accuracy and tolerance range are all relatively high; But because Streptomycin sulphate does not have uv-absorbing, need to carry out post-column derivation or fluorescent mark when adopting chromatogram to detect, need to carry out pre-treatment, complicated operation to sample before sample introduction, and equipment used is expensive, operative technique is strong, bothersome effort; 2, immunodetection, as CN103645322 A discloses a kind of chemical luminescence reagent kit detecting Streptomycin sulphate, the reagent comprising box body, be located at the enzyme plate in box body and be located in box body, each hole of described enzyme plate is coated with envelope antigen; Described reagent comprises: the sheep anti-mouse antibody of Streptomycin sulphate monoclonal antibody, horseradish peroxidase-labeled, Streptomycin sulphate series standard solution, concentrated phosphoric acid salt buffer, concentrated cleaning solution, chemical luminescence for liquid; Enzyme plate selects oyster white opaque polystyrene 96 hole chemoluminescence enzyme plate, and each hole of enzyme plate is coated with the envelope antigen made with Streptomycin sulphate and ovalbumin coupling; The method is simple to operate, and it is special and sensitivity is also higher, but it is comparatively loaded down with trivial details that the method exists screening small molecules anti-streptomycin antibody process, and different batches performance is different, elapsed time, and expense is relatively high; 3, microbiological method, the method expense is lower, but its sensitivity and specificity poor, expend time in longer, so practical application is relatively less.Visible, the current method that these detect small molecules Streptomycin sulphate is very imperfect, so a kind of method setting up quick, accurate, sensitive, economic detection Determination of Streptomycin Residues is newly the problem tried to explore in industry.
Aptamer is that utilization index enrichment Fas lignand system (SELEX) technology of evolving is screened that obtain with oligonucleotide sequence that is target material generation specific binding from nucleic acid library, and it can specific recognition the target materials such as associated proteins, small molecules, ion, cell.Due to small molecular antibody preparation comparatively difficulties such as Streptomycin sulphates, so aptamer is as the analysis tool detecting small-molecule substance, will have broad application prospects.In practical application, aptamer is all better than antibody in all many-sides, as good in chemical stability, be easy to synthesis, not volatility, lower immunogenicity etc.; In addition, aptamer is in gene therapy, and the security in infection and cancer therapy have also been obtained confirmation.Up to the present, people have screened the specificity aptamer of many small-molecule substances, and based on aptamer, develop the detection system of a series of small-molecule substance.But, up to the present, also do not find in research at home and abroad about specific recognition Streptomycin sulphate aptamer and utilize aptamer to carry out fast Streptomycin sulphate, the relevant report of accurate qualitative and detection by quantitative.
Summary of the invention
An object of the present invention is to provide a kind of nucleic acid aptamer of specific recognition Streptomycin sulphate, and is applied in qualitative or detection by quantitative Streptomycin sulphate, loaded down with trivial details to solve existing Streptomycin sulphate testing process, detects the problem that accuracy is poor.
Two of object of the present invention is to provide a kind of method of qualitative and detection by quantitative Streptomycin sulphate, with solve prior art detect Streptomycin sulphate exist otherwise detect operation loaded down with trivial details, waste time and energy, cost is higher, or tolerance range poor problem relative to susceptibility.
The present invention is achieved in that a kind of nucleic acid aptamer of specific recognition Streptomycin sulphate, and the nucleotides sequence of described aptamer is classified as: CCCGTTTAAAGTAGTTGAGAGTATTCCGTTTCTTTGTGTC(is shown in SEQ ID NO: 1).
After described nucleotide aptamer adds fixed sequence program, its nucleotides sequence is classified as:
5 '-
aCCGACCGTGCTGGACTCTGcCCGTTTAAAGTAGTTGAGAGTATTCCGTTTCTTTGTGTC
cAGTATGAGCGAGCGTTGCG-3 ', dashed part is fixed sequence program.Its second structure characteristic as shown in Figure 1.
The present invention is not limited to the sequence shown in SEQ ID NO: 1, described nucleic acid aptamer is carried out modify or transform the nucleic acid aptamer derivative obtained and also belongs to protection scope of the present invention.
Nucleic acid aptamer derivative of the present invention can be following any one: delete or increase partial nucleotide, obtain the nucleic acid derivative with described nucleic acid aptamer with identical function; Carry out Nucleotide replacement or part modification, obtain the nucleic acid derivative with described nucleic acid aptamer with identical function; With this nucleic acid aptamer for skeleton is transformed, obtain the nucleic acid derivative with described nucleic acid aptamer with identical function; Change described nucleic acid aptamer into peptide nucleic acid(PNA), obtain the nucleic acid derivative with described nucleic acid aptamer with identical function; Described nucleic acid aptamer is carried out mark fluorescent class material, enzyme material or other mark substance, obtain the nucleic acid derivative with described nucleic acid aptamer with identical function.
This research take Streptomycin sulphate as target material, utilizes SELEX technology screening to obtain the nucleic acid aptamer of specific recognition Streptomycin sulphate, and determines its nucleotide sequence; This nucleic acid aptamer is learnt by fluorescent method qualification, and it has very high avidity and specificity highly to Streptomycin sulphate, and this lays a good foundation for developing aptamer detection Streptomycin sulphate further.Nucleic acid aptamer provided by the invention has molecular weight compared with the antibody of protein, can chemosynthesis, and cost is lower, good stability, and is easy to preserve; Can direct external synthesis, be convenient to mark and optionally can mark at different sites; Use it for and detect Streptomycin sulphate method flexibly, be easy to optimize; In practical application, based on this thuja acid aptamer, multiple Streptomycin sulphate test in laboratory method can be designed and developed, can be used widely in fields such as food, health and import and export detections.
Nucleic acid aptamer association colloid gold colorimetry of the present invention is used for qualitative or/and the application of detection by quantitative food streptomycin.
A method for qualitative detection Streptomycin sulphate, comprises the following steps:
A quality is the HAuCl of 0.01% than concentration by ()
4solution heated and boiled, adding quality while stirring than concentration is the Trisodium Citrate of 1%, after solution changes color, boils and continues 10-15min, being cooled to room temperature, obtaining Radioactive colloidal gold;
B both mix with the ratio of the nucleic acid aptamer adding the specific recognition Streptomycin sulphate of 100 nmol/L in the Radioactive colloidal gold of 45-60 μ L by (), incubated at room 1-2 h, have obtained the Radioactive colloidal gold of aptamer mark; The nucleotide sequence of the nucleic acid aptamer of wherein said specific recognition Streptomycin sulphate is as shown in SEQ ID NO: 1;
Add testing sample in c Radioactive colloidal gold that () marks at aptamer, if solution colour is burgundy, then testing sample streptomycin concentration is less than 200 nmol/L; If solution colour becomes purple from burgundy, then the concentration of testing sample streptomycin is 200 ~ 800 nmol/L; If solution colour becomes blueness from burgundy, then the concentration of testing sample streptomycin is for being greater than 800 nmol/L.
A method for detection by quantitative Streptomycin sulphate, comprises the following steps:
(A) be the HAuCl of 0.01% by quality than concentration
4solution heated and boiled, adding quality while stirring than concentration is the Trisodium Citrate of 1%, after solution changes color, boils and continues 10-15min, being cooled to room temperature, obtaining Radioactive colloidal gold;
(B) with the ratio of the nucleic acid aptamer adding the specific recognition Streptomycin sulphate of 100 nmol/L in the Radioactive colloidal gold of 45-60 μ L, both are mixed, incubated at room 1-2 h, obtained the Radioactive colloidal gold of aptamer mark; The nucleotide sequence of the nucleic acid aptamer of wherein said specific recognition Streptomycin sulphate is as shown in SEQ ID NO: 1;
(C) add concentration and be respectively 25 nmol/L in the Radioactive colloidal gold of the obtained aptamer mark of step (B), 50 nmol/L, 100 nmol/L, 200 nmol/L, 400 nmol/L, 800 nmol/L, the Streptomycin sulphate of 1600 nmol/L, incubated at room 1 h, add the NaCl that 50 μ L concentration are 200 mmol/L, be that A520 and A620 measures its light absorption value respectively at wavelength, with the concentration of Streptomycin sulphate for X-coordinate, with the ratio of A620 and A520 recorded described in same concentration Streptomycin sulphate for ordinate zou, make the graphic representation of Streptomycin sulphate concentration and A620/520 ratio, its typical curve of matching, during working sample, joined by testing sample in the Radioactive colloidal gold of aptamer mark, measuring it at wavelength is the light absorption value of A520 and A620, asks A620/520 ratio, carry it in typical curve and obtain corresponding content of streptomycin value, be the content of contained Streptomycin sulphate in testing sample.
The present invention is to combine the nucleic acid aptamer combined with Streptomycin sulphate of the high specific of above-mentioned screening and high-affinity with Radioactive colloidal gold colorimetry, establish the Streptomycin sulphate novel detection method based on oligonucleotide aptamer, can simply, fast, accurately, economical, specifically Streptomycin sulphate is carried out quantitatively or qualitative detection, for development of new Streptomycin sulphate analytical procedure or testing tool establish good basis, simultaneously also for the detection of other small-molecule substances provides thinking, can be used widely in fields such as food, health and import and export detections.
Accompanying drawing explanation
Fig. 1 is the second structure characteristic figure of nucleic acid aptamer of the present invention.
The infared spectrum of Fig. 2 epoxy-activated gel and Streptomycin sulphate-epoxy group(ing) gel coupled complex.Wherein in figure, a is Streptomycin sulphate-epoxy group(ing) gel coupled complex, and b is epoxy-activated gel.
The infared spectrum of Fig. 3 amino magnetic bead and Streptavidin MagneSphere.Wherein in figure, a is amino magnetic bead, and b is Streptavidin MagneSphere.
Fig. 4 often takes turns screening PCR primer polyacrylamide gel electrophoresis result.
Fig. 5 often takes turns the fluorescent value of screening PCR primer.
Fig. 6 is the aptamer avidity result figure that fluorescent marker method measures.
Fig. 7 is the second structure characteristic figure of aptamer A17, A25 and A15 in the embodiment of the present invention 1.
Fig. 8 is that the Streptomycin sulphate of different concns and aptamer mark the state graph of Radioactive colloidal gold coagulation.
Fig. 9 is the spectrogram that the Streptomycin sulphate of different concns adds the Radioactive colloidal gold of mark aptamer.
Figure 10 is A
620/ A
520ratio and Streptomycin sulphate concentration relationship graphic representation.
Figure 11 is A
620/ A
520the canonical plotting of ratio and Streptomycin sulphate concentration.
Figure 12 is the qualitative detection figure of Streptomycin sulphate and comparative example.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.Quantitative test in following examples, all arranges and repeats experiment for three times, results averaged.
The acquisition of the nucleic acid aptamer of embodiment 1 specific recognition Streptomycin sulphate
(1) coupling of epoxy group(ing) gel and Streptomycin sulphate: get 3 ml epoxy-activated gel distilled waters and wash five times, then suction filtration is dry; The Na of 10 ml containing the 0.1mol/L of 20 mg/ml Streptomycin sulphates will be joined in dried epoxy-activated gel
2cO
3-NaHCO
3in coupling buffer (pH value is 10.5), hatch 16h for 37 DEG C; After reaction terminates, the PBS solution of hatching product 0.1mol/L is rinsed three times, then the thanomin adding 1 mol/L is closed, incubated at room 1 h; Gel conjugates after closing contains the boric acid-sodium tetraborate damping fluid (pH value is 8.0) of 0.5 mol/L NaCl with the deionized water of 5 times, 0.1 mol/L containing the HAc-NaAc damping fluid (pH value is 4.0) of 0.5 mol/L NaCl, deionized water, 0.1 mol/L successively and deionized water fully washs, suction filtration is dry, eliminate unreacted aglucon, obtain Streptomycin sulphate-epoxy group(ing) gel coupled complex; Quality Streptomycin sulphate-epoxy group(ing) gel coupled complex being resuspended in 4 DEG C is for subsequent use in the ethanolic soln of 20% than concentration; The Streptomycin sulphate of gained-epoxy group(ing) gel coupled complex and epoxy-activated gel are carried out infrared detection, verifies its coupling result, the results are shown in Figure shown in 2.Epoxy ring-opening forms C-O key and C-N key, and as can be seen from Figure 2 Streptomycin sulphate-epoxy group(ing) gel coupled complex is at 1180 cm
-1there is a characteristic peak at place, epoxy-activated gel herein without characteristic peak, and this peak by C-N stretch vibrations produce, this illustrate Streptomycin sulphate be fixed on epoxy group(ing) gel by chemical reaction.
(2) preparation of anode posts and cathode column:
The preparation of anode posts: 3 mL Streptomycin sulphates-epoxy group(ing) gel coupled complex is loaded in affinity column void column, divide 5 to wash by 1 mol/L NaCl solution and carry out wash-out, each 10 mL, the each wash-out of wash-out cumulative volume 50 mL(must ensure that gel is dipped in liquid) wash 10 column volumes with deionized water again, obtain anode posts, being finally stored in 10 mL mass percents is in the ethanolic soln of 20%;
The preparation of cathode column: by 3 mL not with the epoxy-activated gel of the Streptomycin sulphate coupling deionized water rinsing 5 times with 10-20 times of volume, to remove DMSO, drain in sand core funnel, be transferred in the affinity column of 10 mL, obtain cathode column.
(3) ssDNA random library is built:
Utilize Oligo6.0 and primer premier 5.0 to design random single chain oligonucleotide (single strand DNA, the ssDNA) library of 80 bp, centre is 40 bp stochastic sequences, and two ends are respectively 20 bp fixed sequence programs, and concrete sequence is:
5’-ACCGACCGTGCTGGACTCTG-40bp-CAGTATGAGCGAGCGTTGCG-3’。
Design pcr amplification primer is as follows:
Upstream primer P1:5 '-ACCGACCGTGCTGGACTCTG-3 ',
Biotin labeled upstream primer P2:5 '-Biotin-ACCGACCGTGCTGGACTCTG-3 ';
Downstream primer P3:5 '-CGCAACGC TCGCTCATACTG-3 ',
Fluorescently-labeled downstream primer P4:5 '-FAM-CGCAACGC TCGCTCATACTG-3 '.
Described ssDNA random library sequence and upstream and downstream primer and labeled primer synthesize by Shanghai Sheng Gong biotechnology limited-liability company.
(4) aptamer selection systems:
A, coupling: get ssDNA random library 500 pmol that step (3) synthesizes and be dissolved in 1ml binding buffer liquid and (comprise 20 mmol/L Tris-HCl, 50 mmol/L NaCl, 5 mmol/L KCl and 5 mmol/L MgCl
2, pH value is 8.0) in, 100 DEG C of sex change 5 min, after 4 DEG C of cooling 10 min, joined in cathode column, in 37 incubators, hatched 10 min, collecting the ssDNA random library do not combined with epoxy group(ing) activated gel in cathode column joins in anode posts, hatches 1 h for 37 DEG C, then washing buffer is used (to comprise 20 mmol/L Tris-HCl, 50 mmol/L NaCl, 5 mmol/L KCl, 5 mmol/L MgCl
2be the Tween20 of 0.01% with quality than concentration, pH value is 8.0) drip washing 200 column volumes, take-off rate 1 mL/min, finally add 1 mL elution buffer and (comprise 20 mmol/L Tris-HCl, 50 mmol/L NaCl, 5 mmol/L KCl, 5 mmol/L MgCl
2with the Streptomycin sulphate of 10 mmol/L, pH value is 8.0), wash-out five times, collect each elution buffer, 3 mol/L NaAc of elutriant 1/10 volume are added in the elution buffer collected, its ultimate density is made to be 0.3 mol/L, isopyknic pre-cold isopropanol is added after abundant mixing,-20 DEG C of hold over night, at 4 DEG C, centrifugal 15 min of 12000 rpm, abandon supernatant, wash twice (12000 rpm centrifugal 15 min) than the ethanolic soln that concentration is 70% by quality, carefully shift out supernatant liquor, filter paper sucks drops all on tube wall, evaporate to dry with what make to remain under room temperature, obtain ssDNA precipitation, be designated as (1, order),
B, non-symmetric PCR amplification: by the 100 μ L ddHs of ssDNA precipitation with 60 DEG C of preheatings
2o dissolves, with the ssDNA after 0.5 μ L dissolving for template, with biotin labeled upstream primer P
2(5 '-Biotin-ACCGACCGTGCTGGACTCTG-3 '), fluorescently-labeled downstream primer P
4(5 '-FAM-CGCAACGCTCGCTCATACTG-3 ') carry out non-symmetric PCR amplification, the system of non-symmetric PCR amplification described in it is: get the biotin labeled upstream primer P that concentration is 10 μm of ol/L
2, fluorescently-labeled downstream primer P
4each 0.5 μ L, ddNTP 1 μ L, PCR buffer 2 μ L, Taq enzyme 0.1 μ L, aqua sterilisa 15.4 μ L.Amplification program is: 94 DEG C of denaturation 3 min, 94 DEG C of sex change 45 s, and 68 DEG C of annealing 45 s, 72 DEG C extend 45 s, and 6 take turns thermal cycling.Parallelly do 5 pipes, obtain first round screening amplified production, be designated as (1, d);
C, PCR purifying: PCR primer purification kit (Beijing CoWin Bioscience Co., Ltd.) carries out purifying, PCR primer is joined in the adsorption column balanced, 12000 rpm are centrifugal, screen out the DNA sequence dna of 50 below bp, reclaim 50 more than bp sequences, remove assorted band, obtain the symmetrical PCR primer of purifying, be designated as (1, c);
The preparation in d, secondary library: first prepare Streptavidin MagneSphere, gets 5 mg(1 mL) the ultrasonic mixing of amino magnetic bead, load in the EP pipe of 10 mL, the PB(0.1 mol/L pH 7.4 with 5 mL) suspendible, Magneto separate, inhales and abandons supernatant liquor, wash three times with PB; Add glutaraldehyde 5 mL newly joined of mass percent concentration 12%, 37 DEG C of shaking tables hatch 4 h, and PB washes three times; Add the Streptavidin (Streptavidin is dissolved in distilled water) of 1 mL 100 μ g/mL, 37 DEG C of shaking tables hatch 4 h, obtain Streptavidin MagneSphere, and Magneto separate Streptavidin MagneSphere cleans up for subsequent use; Amino magnetic bead and Streptavidin MagneSphere are carried out infrared detection, verifies its coupling result, the results are shown in Figure 3; Wherein in figure, a is amino magnetic bead, and b is Streptavidin MagneSphere.
From b in Fig. 3, infared spectrum display Streptavidin MagneSphere is at 544 cm
-1with 1606 cm
-1there is absorption peak at place, and the characteristic peak of Schiff's base is at 1650 ~ 1590 cm
-1scope, has illustrated that C=N contracting vibration peak produces; Infared spectrum is different from amino magnetic bead, proves Streptavidin MagneSphere success coupling;
Get 6 ~ 7 × 10
7(1 mg) Streptavidin MagneSphere, washs magnetic bead once with 2 times of B & W damping fluids (10 mmol/L Tris-HCl, pH 7.5,1mmol/L EDTA, 2.0 mol/L NaCl); Upper magnetic frame 1-2 min, inhales and abandons washings; Get 100 μ L, 1 times of B & W damping fluid suspendible; (1, c), 37 DEG C of shaking tables are in conjunction with 30 min to add the symmetrical PCR primer of the isopyknic purifying of 100 μ L; Upper magnetic frame 1 ~ 2 min, be separated in conjunction with the Streptavidin MagneSphere of symmetrical PCR primer dsDNA, with the Streptavidin MagneSphere 2 ~ 3 time of 1 times of B & W buffer solution in conjunction with dsDNA, the dsDNA that Streptavidin MagneSphere combines is unwind, be specially: the 150 mmol/L NaOH adding 200 μ L, hatch 15 min for 37 DEG C, dsDNA is unwind; Upper magnetic frame, a ssDNA containing vitamin H to stay on Streptavidin MagneSphere and is adsorbed on tube wall, and another and the fluorescently-labeled ssDNA of its complementation are present in supernatant, are designated as target product, be designated as (1, s).Measure Streptavidin MagneSphere prepare (1, s) after product and purifying, (1, fluorescence intensity c), calculates its organic efficiency.Calculation result is: be that to add fluorescence intensity in the supernatant liquor obtained after Streptavidin MagneSphere unwinds be 38.67 to 112.67 fluorescently-labeled PCR primer by fluorescence intensity, the rate of recovery is 34.32%.And according to fluorescence intensity, its each avidity of taking turns can be calculated.
E, each takes turns screening: (1, s) 500 pmol binding buffer liquid are settled to 1 mL, after 95 DEG C of sex change 2 min, place 4 DEG C of water-bath 10 min immediately, add anode posts to get target product, hatch 1 h, by drip washing, wash-out obtains (2, order), (2, d), (2, c), (2, s).Third round is taken turns similar with second, get (2, s) 500 pmol and anode posts hatch and obtain (3, s), for the screening of fourth round.Fourth round, compared to third round, needs anti-sieve, gets (3, s) 300 pmoL, be settled to 1 mL with binding buffer liquid, after 95 DEG C of sex change 2 min, place 4 DEG C of water-bath 10 min immediately, add cathode column, hatch 10 min, proceed to anode posts and hatch 1 h, pass through drip washing, wash-out, carries out fourth round screening and obtains (4, order), (4, d), (4, c), (4, s).
5th takes turns to the screening that the tenth takes turns the repetition first round, and every three-wheel screening is once counter sieves, for removing the sequence of non-specific binding.The ssDNA(10 screened is taken turns by the tenth, order) add above-mentioned upstream primer P1 and downstream primer P3 as template and carry out pcr amplification, other substrates of amplification system and amplification program the same, by the symmetrical PCR primer Polyacrylamide Gel Electrophoresis of often taking turns, obtain Fig. 4, in figure 1,2,3,4 be respectively the 3rd to take turns, 5 to take turns, 7 to take turns, 9 PCR primer of taking turns screening, M represents Marker; As can be seen from the figure band is clear, without assorted band; Measure its fluorescence intensity with the secondary library that each is taken turns, take turns the standard of avidity as evaluating each, the secondary library fluorescence intensity that wash-out is collected is higher, and avidity is higher, to the results are shown in Figure in 5, figure 1 ~ 10 and represents that the fluorescent value of PCR primer is often taken turns in SELEX screening respectively.
Taking turns the tenth and screening the ssDNA that obtains is after the product purification that obtains of template non-symmetric PCR amplification, connect pUCM-T carrier, proceed to intestinal bacteria, picking checks order containing ssDNA mono-clonal, check order 31 positive colonies altogether, after order-checking, obtain 13 not homotactic aptamers, be the ssDNA higher with Streptomycin sulphate affinity; By Mfold program software analysis ssDNA secondary structure, the similarity according to primary sequence homology and secondary structure is classified, in table 1 to obtained aptamer.
The primary sequence in the random district of table 1 ssDNA
(5) aptamer that Fluorometric assay screening is the highest with Streptomycin sulphate avidity:
The 13 kinds of transformed bacteria 30 μ L getting the ssDNA higher with Streptomycin sulphate affinity after order-checking qualification are inoculated in the LB liquid nutrient medium of 3 mL containing Amp, and shake bacterium and spend the night, add 1.5 mL EP and manage, centrifugal 1 min of 12000 rmp, abandons supernatant.Plasmid is little to be carried to adopt plasmid extraction test kit (the raw work in Shanghai) to carry out; Using described plasmid as template and biotin labeling upstream primer P2 and fluorescently-labeled downstream primer P
4carry out non-symmetric PCR amplification, in amplification system the volume of each material and amplification program the same, purifying, combines purified product Streptavidin MagneSphere, Magneto separate, unwinds, and will obtain 13 kinds of fluorescently-labeled aptamers.
Hatched with cathode column anode posts respectively by 13 kinds of different sequence adaptation, carry out drip washing, elution step by above-mentioned technique, measure the fluorescence intensity of anode posts elutriant, every 300 μ L survey first order fluorescence intensity.In record anode posts, the intensity of highest peak, compares 13 sub-peak heights of different sequence adaptation, does column diagram, as the standard that avidity measures, sees Fig. 6.Because aptamer and cathode column are hatched, add leacheate, along with the increase of add-on, fluorescence intensity reduces gradually, adds elutriant, and fluorescence intensity no longer changes, prove that aptamer can not be adsorbed on cathode column, along with adding of leacheate, aptamer can flow out gradually; Aptamer and anode posts are hatched, add leacheate, along with the increase of add-on, fluorescence intensity is constant, adds elutriant, and fluorescence intensity is changed from small to big, prove that aptamer and anode posts create specific binding, aptamer drip washing can not be got off by leacheate, and when adding elutriant, aptamer is by wash-out gradually.Its Anodic is hatched and is added elutriant, and the solution fluorescence intensity eluted is higher, prove aptamer and anode posts avidity higher.According to the height of anode posts peak value, judge avidity size.Obtain aptamer fluorescent value be all significantly higher than negative control (P<0.01) in pole, show to screen the aptamer that obtains all can with Streptomycin sulphate stable bond.As can be seen from Fig. 6, in 3rd family, A15 and A31 avidity is higher than aptamer in other two families, choose the aptamer that in each family, avidity is the highest to compare, in the 3rd family, A15 avidity is significantly higher than the A17 in the first family and the A25 in the second family.
(6) a highest aptamer of avidity in each family can be selected to ask its Kd value and do secondary structure prediction according to avidity column diagram.Using the aptamer selected in each family as template, non-symmetric PCR amplification is carried out with the upstream primer of fluorescently-labeled downstream primer and biomarker, carry out unwinding with paramagnetic particle method and obtain the fluorescent mark aptamer of purifying, be diluted to different concns (0.02,0.04,0.08,0.1,0.15 μ g) to hatch with the bead complexes of 1 mg, measure the fluorescence intensity of hatching front and back different concns aptamer, the fluorescence intensity of calculations incorporated is as ordinate zou.According to origin mapping software, make nonlinear fitting.According to Michaelis-Menton equation: y/2=y
max[ssDNA]/(Kd+ [ssDNA]), calculates Kd value, and wherein y is the fluorescence intensity of absorption aptamer, ordinate zou; y
maxthe fluorescence intensity that absorption aptamer is maximum; [ssDNA] is aptamer concentration, X-coordinate; Kd value is dissociation constant, and the less then avidity of Kd value is higher.By measuring, the Kd value of result display aptamer A15, A17, A25 is respectively 6.07nmol/L, 8.56nmol/L and 10.31nmol/L, its secondary structure and Kd value are shown in Fig. 7, wherein A15 aptamer Kd value is significantly adaptive lower than other, illustrate No. A15 with Streptomycin sulphate avidity the highest, namely as shown in SEQ ID NO:1.
Embodiment 2 utilizes the qualitative and detection by quantitative Streptomycin sulphate of aptamer
(1) Radioactive colloidal gold preparation: be the HAuCl of 0.01% than concentration by 20 mL, quality
4heated and boiled, adding 500 μ L quality is while stirring the Trisodium Citrate of 1% than concentration, and after colour-change, solution continues to boil 10min, removes thermal source and stirs until room temperature, obtain Radioactive colloidal gold; Radioactive colloidal gold can be stored in quality is in the sodiumazide of 0.05% than concentration, for subsequent use;
(2) qualitative detection: the nucleic acid aptamer adding the specific recognition Streptomycin sulphate of 100 nmol/L in the Radioactive colloidal gold of 50 μ L, incubated at room 1 h, has obtained the Radioactive colloidal gold of aptamer mark; Final concentration be respectively 25 nmol/L, 50 nmol/L, 100 nmol/L, 200 nmol/L, 400 nmol/L, 800 nmol/L, 1600 nmol/L Streptomycin sulphate join aptamer mark Radioactive colloidal gold in, incubated at room 1 h; Finally add the NaCl that 50 μ L concentration are 200 mmol/L, observe colour-change, as shown in Figure 8.
Fig. 8 display is when Streptomycin sulphate concentration is greater than 200 nmol/L, and colloidal gold solution is purple or blueness by wine red stain, and account for color change is relevant to Streptomycin sulphate concentration.When Streptomycin sulphate concentration is less than 200 nmol/L for red, show there is a small amount of Radioactive colloidal gold generation coagulation, bore hole can not distinguish colour-change situation, but can detect Streptomycin sulphate concentration by absorbance value change.When Streptomycin sulphate concentration is 200 ~ 800 nmol/L, color becomes purple, shows most Radioactive colloidal gold generation coagulation.When Streptomycin sulphate concentration is greater than 800 nmol/L, color is blue, shows whole Radioactive colloidal gold generation coagulations.With this experimental result, the Radioactive colloidal gold of aptamer mark can be made with the ratio adding the aptamer of 100 nmol/L in the Radioactive colloidal gold of 50 μ L, it can be used as the substrate of test card or the test fluid of test kit, whether be used for detecting in sample containing Streptomycin sulphate, concrete operations are: in the Radioactive colloidal gold of aptamer mark, add testing sample, the color of naked eye solution, if the color of solution is still burgundy, then the concentration of testing sample streptomycin is less than 200 nmol/L; If solution colour becomes purple from burgundy, then the concentration of testing sample streptomycin is 200 ~ 800 nmol/L; If solution colour becomes blueness from burgundy, then the concentration of testing sample streptomycin is for being greater than 800 nmol/L.The content range of testing sample streptomycin can be measured by initial characterization like this.
When containing Streptomycin sulphate in testing sample, but when its concentration is less than 200 nmol/L, solution is burgundy, and show there is a small amount of Radioactive colloidal gold generation coagulation, bore hole can not distinguish colour-change situation, but can detect Streptomycin sulphate concentration by absorbance value change; When testing sample streptomycin concentration is 200 ~ 800 nmol/L, solution colour becomes purple, shows most Radioactive colloidal gold generation coagulation; When Streptomycin sulphate concentration is greater than 800 nmol/L, solution colour is blue, shows whole Radioactive colloidal gold generation coagulations; Transmission electron microscope results shows, the Radioactive colloidal gold coagulation degree of aptamer mark and the positive correlation of Streptomycin sulphate concentration, consistent with colour-change and photoabsorption result of variations.
(3) detection by quantitative: utilize ultraviolet-visible pectrophotometer to scan to Radioactive colloidal gold coagulation degree in step (2), as shown in Figure 9, when Radioactive colloidal gold coagulation degree increases along with Streptomycin sulphate concentration and strengthens, A520 declines to some extent, and A620 rises gradually, the light absorption value change at two places has obvious dependency with Streptomycin sulphate change in concentration, find that the change of the ratio of A620/A520 and Streptomycin sulphate concentration is closer to linear dependence by analysis afterwards, therefore, select A620/520 ratio change detection by quantitative Streptomycin sulphate concentration, its measurement result is shown in Figure 10.Show from Figure 10, when Streptomycin sulphate concentration is 25-800nmol/L, ratio and the Streptomycin sulphate concentration of its A620/A520 are substantially linear; Matching is carried out to it, gained typical curve as shown in figure 11, its R
2be 0.998; When practical measurement sample, joined by testing sample in the Radioactive colloidal gold of aptamer mark, measuring it at wavelength is the light absorption value of A520 and A620, asks A620/520 ratio, is bringing in typical curve by it, can learn the content of contained Streptomycin sulphate in testing sample;
(4) checking of aptamer high special identification: in order to measure the specificity of Streptomycin sulphate aptamer, selects the Radioactive colloidal gold marked as negative control and aptamer A15 with the of a sort aminoglycoside antibiotics of Streptomycin sulphate and other non-amino sugar tobramycin antibiotic (sulphuric acid kanamycin, G418, erythromycin, paraxin and hydrochloric acid tobramycin) to react.Result as shown in figure 12, naked eyes can directly observing colloid gold colour-change.Wherein testing sample 1 is 200 nmol/L Streptomycin sulphates, 4 for positive control, 2 is 800 nmol/L Streptomycin sulphates, 3 is sulphuric acid kanamycin, 5 be G418,6 be erythromycin, 7 be paraxin, 8 be hydrochloric acid tobramycin.From Figure 12, only add Streptomycin sulphate and Radioactive colloidal gold color can be caused to be purple or blueness by red stain, other microbiotic all can not be combined with aptamer A15 and can not make Radioactive colloidal gold variable color.Although Streptomycin sulphate, sulphuric acid kanamycin and G418 all belong to aminoglycoside antibiotics, have similar structure, and aptamer A15 is only combined with Streptomycin sulphate, have showed the specificity of height.Detect A620/A520 photometric quantity by spectrophotometer to inhale, result is consistent with Radioactive colloidal gold colorimetry, all shows that aptamer A15 can to specific recognition and marriage chain mycin.
The detection by quantitative of embodiment 3 milk and honey Determination of streptomycin residues
From the buying of local supermarket not containing honey and the milk sample of Streptomycin sulphate, adopt recovery testu to carry out detection by quantitative to Streptomycin sulphate, concrete operations are as follows:
Milk sample process: add 3 mL ethyl acetate and 3 mL water in 1 mL milk sample, whirlpool mixes 15 min; Then at 4 DEG C, the centrifugal 15min of 8000 rpm/min; Mixture is divided into three layers, collects water layer and detects sample as next step;
Honey sample process: honey distilled water dilutes five times and dilutes, as detection sample;
By series of standards concentration Streptomycin sulphate: 25nmol/L, 50nmol/L, 100nmol/L, 200nmol/L, 400 nmol/L add in the milk after process and honey sample respectively, embodiment 2 quantitative detecting method is utilized to detect sample streptomycin concentration, it is consistent with interpolation Streptomycin sulphate concentration that it detects result, and its qualitative detection result is consistent with detection by quantitative.It is higher that this illustrates that the present invention utilizes aptamer to detect Streptomycin sulphate accuracy, and data can be learnt from table, the rate of recovery of milk sample streptomycin is 70 ~ 90%, is between 76 ~ 98% in honey, and the two relative standard deviation (RSD) average detected is less than 4.58 %.This result show the present invention obtain the detection that nucleic acid aptamer can be successfully applied to actual sample streptomycin, and accuracy and tolerance range all relatively high.
Detected result is in table 2.
Table 2 milk and honey sample streptomycin detected result
SEQUENCE LISTING
<110> University Of Hebei
The nucleic acid aptamer of a <120> specific recognition Streptomycin sulphate and the application in Streptomycin sulphate detects thereof
<130>
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 40
<212> DNA
<213> adjusts aptamer
<400> 1
cccgtttaaa gtagttgaga gtattccgtt tctttgtgtc 40
Claims (4)
1. a nucleic acid aptamer for specific recognition Streptomycin sulphate, is characterized in that, the nucleotide sequence of described aptamer is as shown in SEQ ID NO: 1.
2. a nucleic acid aptamer as claimed in claim 1 is used for Radioactive colloidal gold colorimetry in application that is qualitative and detection by quantitative food streptomycin.
3. a method for qualitative detection Streptomycin sulphate, is characterized in that, comprises the following steps:
A quality is the HAuCl of 0.01% than concentration by ()
4solution heated and boiled, adding quality while stirring than concentration is the Trisodium Citrate of 1%, after solution changes color, boils and continues 10-15min, being cooled to room temperature, obtaining Radioactive colloidal gold;
B both mix with the ratio of the nucleic acid aptamer adding the specific recognition Streptomycin sulphate of 100 nmol/L in the Radioactive colloidal gold of 45-60 μ L by (), incubated at room 1-2 h, have obtained the Radioactive colloidal gold of aptamer mark; The nucleotide sequence of the nucleic acid aptamer of wherein said specific recognition Streptomycin sulphate is as shown in SEQ ID NO: 1;
Add testing sample in c Radioactive colloidal gold that () marks at aptamer, if solution colour is burgundy, then testing sample streptomycin concentration is less than 200 nmol/L; If solution colour becomes purple from burgundy, then the concentration of testing sample streptomycin is 200 ~ 800 nmol/L; If solution colour becomes blueness from burgundy, then the concentration of testing sample streptomycin is for being greater than 800 nmol/L.
4. a method for detection by quantitative Streptomycin sulphate, is characterized in that, comprises the following steps:
(A) be the HAuCl of 0.01% by quality than concentration
4solution heated and boiled, adding quality while stirring than concentration is the Trisodium Citrate of 1%, after solution changes color, boils and continues 10-15min, being cooled to room temperature, obtaining Radioactive colloidal gold;
(B) with the ratio of the nucleic acid aptamer adding the specific recognition Streptomycin sulphate of 100 nmol/L in the Radioactive colloidal gold of 45-60 μ L, both are mixed, incubated at room 1-2 h, obtained the Radioactive colloidal gold of aptamer mark; The nucleotide sequence of the nucleic acid aptamer of wherein said specific recognition Streptomycin sulphate is as shown in SEQ ID NO: 1;
(C) add concentration and be respectively 25 nmol/L in the Radioactive colloidal gold of the obtained aptamer mark of step (B), 50 nmol/L, 100 nmol/L, 200 nmol/L, 400 nmol/L, 800 nmol/L, the Streptomycin sulphate of 1600 nmol/L, incubated at room 1 h, add the NaCl that 50 μ L concentration are 200 mmol/L, be that A520 and A620 measures its light absorption value respectively at wavelength, with the concentration of Streptomycin sulphate for X-coordinate, with the ratio of A620 and A520 recorded described in same concentration Streptomycin sulphate for ordinate zou, make the graphic representation of Streptomycin sulphate concentration and A620/520 ratio, its typical curve of matching, during working sample, joined by testing sample in the Radioactive colloidal gold of aptamer mark, measuring it at wavelength is the light absorption value of A520 and A620, asks A620/520 ratio, carry it in typical curve and obtain corresponding content of streptomycin value, be the content of contained Streptomycin sulphate in testing sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510106215.6A CN104745588B (en) | 2015-03-11 | 2015-03-11 | A kind of nucleic acid aptamer of specific recognition streptomysin and its application in streptomysin detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510106215.6A CN104745588B (en) | 2015-03-11 | 2015-03-11 | A kind of nucleic acid aptamer of specific recognition streptomysin and its application in streptomysin detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104745588A true CN104745588A (en) | 2015-07-01 |
| CN104745588B CN104745588B (en) | 2017-12-12 |
Family
ID=53585847
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510106215.6A Active CN104745588B (en) | 2015-03-11 | 2015-03-11 | A kind of nucleic acid aptamer of specific recognition streptomysin and its application in streptomysin detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104745588B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105255899A (en) * | 2015-11-05 | 2016-01-20 | 中国农业大学 | Set of sulfamethazine specifically-bound aptamers and screening method and applications thereof |
| CN105572393A (en) * | 2016-01-21 | 2016-05-11 | 武汉慧禹信息科技有限公司 | Nucleic acid aptamer based on estradiol in saliva and gold mark test strip for detection |
| CN106525945A (en) * | 2016-11-15 | 2017-03-22 | 河南省农业科学院 | Aptamer screening method based on localized surface plasma resonance technology |
| CN106636104A (en) * | 2016-11-15 | 2017-05-10 | 河南省农业科学院 | Aptamer sequence specifically combined with streptavidin by screening through LSPR-SELEX (Localized Surface Plasmon Resonance-Systematic Evolution of Ligands by Exponential Enrichment) method and application of aptamer |
| CN110423756A (en) * | 2019-08-05 | 2019-11-08 | 江南大学 | The short chain DNA aptamers sequence of specific recognition streptomysin and its application |
| CN113281315A (en) * | 2021-05-16 | 2021-08-20 | 长沙市食品药品检验所 | Method for rapidly and quantitatively detecting streptomycin in solution by using copper nano-cluster fluorescent probe based on hairpin structure DNA as template |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009039502A1 (en) * | 2007-09-21 | 2009-03-26 | Cytimmune Sciences, Inc. | Nanotherapeutic colloidal metal compositions and methods |
| CN102703453A (en) * | 2012-06-13 | 2012-10-03 | 江南大学 | DNA aptamer specifically recognizing streptomycin and application of DNA aptamer |
-
2015
- 2015-03-11 CN CN201510106215.6A patent/CN104745588B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009039502A1 (en) * | 2007-09-21 | 2009-03-26 | Cytimmune Sciences, Inc. | Nanotherapeutic colloidal metal compositions and methods |
| CN102703453A (en) * | 2012-06-13 | 2012-10-03 | 江南大学 | DNA aptamer specifically recognizing streptomycin and application of DNA aptamer |
Non-Patent Citations (2)
| Title |
|---|
| 王靖元: "链霉素特异性单链DNA适配体的筛选及其在检测中的应用", 《中国优秀硕士学位论文全文数据库（电子期刊）工程科技I辑》 * |
| 解瑶 等: "适于标记核酸适配子胶体金的制备及性能", 《河北大学学报（自然科学版）》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105255899A (en) * | 2015-11-05 | 2016-01-20 | 中国农业大学 | Set of sulfamethazine specifically-bound aptamers and screening method and applications thereof |
| CN105572393A (en) * | 2016-01-21 | 2016-05-11 | 武汉慧禹信息科技有限公司 | Nucleic acid aptamer based on estradiol in saliva and gold mark test strip for detection |
| CN105572393B (en) * | 2016-01-21 | 2017-11-17 | 武汉慧禹信息科技有限公司 | The aptamer and detection gold label test strip of a kind of estradiol based in saliva |
| CN106525945A (en) * | 2016-11-15 | 2017-03-22 | 河南省农业科学院 | Aptamer screening method based on localized surface plasma resonance technology |
| CN106636104A (en) * | 2016-11-15 | 2017-05-10 | 河南省农业科学院 | Aptamer sequence specifically combined with streptavidin by screening through LSPR-SELEX (Localized Surface Plasmon Resonance-Systematic Evolution of Ligands by Exponential Enrichment) method and application of aptamer |
| CN110423756A (en) * | 2019-08-05 | 2019-11-08 | 江南大学 | The short chain DNA aptamers sequence of specific recognition streptomysin and its application |
| CN113281315A (en) * | 2021-05-16 | 2021-08-20 | 长沙市食品药品检验所 | Method for rapidly and quantitatively detecting streptomycin in solution by using copper nano-cluster fluorescent probe based on hairpin structure DNA as template |
| CN113281315B (en) * | 2021-05-16 | 2024-02-13 | 长沙市食品药品检验所 | Method for rapidly and quantitatively detecting streptomycin in solution by using copper nanocluster fluorescent probe based on hairpin structure DNA as template |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104745588B (en) | 2017-12-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104745589B (en) | A kind of screening technique of nucleic acid aptamer of specific recognition streptomysin and application | |
| CN104745588A (en) | Specific nucleic acid aptamer for recognizing streptomycin and application of nucleic acid aptamer to streptomycin detection | |
| CN105548109B (en) | A kind of fluorescent detection system and detection method of heavy metal cadmium | |
| Wang et al. | M13 phage-based nanoprobe for SERS detection and inactivation of Staphylococcus aureus | |
| CN103852460B (en) | Based on the method that how residual the magnetic nano fluorescent sensor detection of antibiotics of aptamers is | |
| CN107119054B (en) | Biosensor probe kit for specifically detecting sulfadiazine based on aptamer and application thereof | |
| CN104630230B (en) | The aptamer of one group of specific recognition okadaic acid | |
| US6350578B1 (en) | Method of quantitating dsDNA | |
| CN107937391A (en) | Cast-off cells nucleic acid extraction lysate and its preparation method and application in human faecal mass | |
| CN106268707A (en) | A kind of phosphoeptide based on novel magnetic porous material enrichment new method | |
| Boiteau et al. | Siderophore profiling of co-habitating soil bacteria by ultra-high resolution mass spectrometry | |
| Doud et al. | Novel approaches in function-driven single-cell genomics | |
| CN112961861B (en) | Metamitron aptamer, screening method and application of metamitron aptamer to metamitron detection | |
| CN108315390A (en) | Visualization mixed dye for LAMP detections | |
| Guo et al. | Development of cadmium multiple-signal biosensing and bioadsorption systems based on artificial cad operons | |
| CN106565966A (en) | Europium-based coordination polymer nanosphere and preparation method and application thereof | |
| CN106929510A (en) | A kind of specific nucleic acid aptamers and application | |
| Zhang et al. | Silicon quantum dots and MOFs hybrid multicolor fluorescent nanosensor for ultrasensitive and visual intelligent sensing of tetracycline | |
| CN108333343A (en) | Immune magnetic compound, preparation method including its antigen capture agent, kit, system and application | |
| CN102220417A (en) | Method for detecting food pathogen by electrochemical luminescence gene sensor on basis of magnetic in-situ amplification | |
| CN113340863A (en) | Enzyme-free circulating amplification aptamer sensor and preparation method and application thereof | |
| CN104297220B (en) | A kind of mercury ion detecting method and detection device | |
| CN109797154B (en) | Aptamer PQ-15 specifically bound with paraquat and application thereof | |
| CN106353377A (en) | Method for preparing nanometer composite material ZnO-CdS-GO and method for constructing sensors from same and detecting mercury ions | |
| WO2007140571A1 (en) | Quantitation of cellular dna and cell numbers using element labeling |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230808 Address after: No. 4010, 4011, No. 2 Huatian Road, Huayuan Industrial Zone, Binhai High tech Zone, Tianjin, 300000 (Depository No. 1943 of Sanqianke (Tianjin) Business Secretary Service Co., Ltd.) Patentee after: Tianjin Xiju Pharmaceutical Co.,Ltd. Address before: 071002 No. 54 East 180 Road, Hebei, Baoding Patentee before: HEBEI University |