CN105548109B - A kind of fluorescent detection system and detection method of heavy metal cadmium - Google Patents
A kind of fluorescent detection system and detection method of heavy metal cadmium Download PDFInfo
- Publication number
- CN105548109B CN105548109B CN201510970031.4A CN201510970031A CN105548109B CN 105548109 B CN105548109 B CN 105548109B CN 201510970031 A CN201510970031 A CN 201510970031A CN 105548109 B CN105548109 B CN 105548109B
- Authority
- CN
- China
- Prior art keywords
- cadmium
- solution
- concentration
- detection
- measured
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Physics & Mathematics (AREA)
- Chemical & Material Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of fluorescent detection system of heavy metal cadmium, in the detection architecture include can specific recognition heavy metal cadmium non-marked aptamer and fluorescent dye.The invention further relates to a kind of fluorescence detection method of heavy metal cadmium, specific recognition molecules of the method using the aptamer of non-marked as cadmium, using fluorescent dye as medium, using the concentration of Fluorescence density analysis assay detection cadmium ion.Technical solution provided by the invention avoid conventional method to Specimen eliminating requirement height, expensive equipment, it is complicated for operation, be unable to the shortcomings that real time on-line monitoring, can satisfy the demand of daily water quality and Food Monitoring, have a good application prospect.
Description
Technical field
The present invention relates to heavy metal analysis fields, more particularly to one kind can be with the fluorescence detection of specific recognition heavy metal cadmium
System.
Background technique
Cadmium is one of strongest heavy metal element of toxicity as human body unessential element, due to industrial waste discharges, sewage
The reasons such as irrigation, atmospheric sedimentation and long-term application of P fertilizer become most serious and the generaI investigation highest pollution of exceeding standard rate in farm environment
Object, the cadmium in farm environment enter food chain by crops or other approach, are enriched in human body by food chain, to human body
Tissue and brain have very strong toxicity.Therefore, domestic and international associated mechanisms have formulated stringent limit standard, this is to Determination of Trace Amount Cadmium
Detection propose very high requirement, especially quickly, low cost, high sensitivity and the good heavy metal cadmium detection side of selectivity
Method seems particularly important.
Currently, both at home and abroad cadmium analysis method mainly include atomic absorption spectrography (AAS), inductively coupled plasma mass spectrometry,
Inductive coupling plasma emission spectrum method, high performance liquid chromatography, enzyme assay, biosensor, is exempted from anodic stripping voltammetry
Epidemic disease analytic approach, aptamer method, test paper method.Atomic absorption spectrography (AAS) is that current heavy metal element cadmium is surveyed in traditional detection method
Determine one of most common method, wherein flame method atomic absorption method one or two order of magnitude low compared with graphite furnace method detection limit, compared with
It is properly applied to the higher sample of cadmium content (such as waste water and contaminated water sample), and sample lower for cadmium content, it needs to increase
Add extraction preenrichment pre-treatment；Graphite furnace method detection limit is low, high sensitivity, but Matrix effects are serious, and compared with being suitable for, background value is low
Sample analysis, be not suitable for difficult resolution and the high sample of matrix background value；Inductive coupling plasma emission spectrum method, which has, divides
It is fast to analyse speed, high sensitivity, accuracy precision is high, the wide advantage of measurement range, but is disadvantageous in that equipment and operating cost
It is easy to pollute with higher；High performance liquid chromatography can realize multielement simultaneous determination, but complexing agent selection is limited, give this method
Bring limitation.And instrument price needed for conventional method is expensive, has to operator, experimental situation, pre-treatment higher
It is required that being not suitable for detecting in base's scene real-time online.Currently, being directed to the quick online detection rapid detection method of heavy metal cadmium
There is faster development, wherein with enzyme assay sensitivity highest, but selectivity is poor, deposits to the detection of single heavy metal ion
In certain difficulty, and detection limit is higher, is unsuitable for the detection of Determination of Trace Amount Cadmium；The method development that biosensor detects heavy metal is fast
Speed, sensitivity, high degree of automation can be applied to online environment monitoring, but sensor manufacturing process is more difficult, and cost is relatively
It is high；Test paper method compared with detection pipe, kit, because it is cheap, it is easy in chemical quickly detection using more, but test paper or its
His carrier all has that carrying reaction reagent amount is limited, and detection limit is relatively high.
Aptamer (aptamer), also known as aptamer are to be using novel compositions chemical technology-index concentration aglucon
System evolution technology (systematic evolution of ligands by exponential enrichment, SELEX) body
Outer screening obtains single-stranded oligo DNA or RNA molecule.Its special and stable three-dimensional structure, can be complementary high by steric configuration
In conjunction with different target substances, this combination is similar with antibody and antigen binding for affinity, high specific, but is different from anti-
Body avoids disadvantage of the protein in preparation and storage, is a kind of spy with very high selectivity, specificity, compatibility
Very " chemical antibody ", can be with specification configuration and its similar substance, therefore the very big concern by numerous domestic and foreign scholars.Nucleic acid
Aptamers detection heavy metal low, high sensitivity with preferably detection stability, testing cost, it is with a wide range of applications.By
It is smaller in its molecular weight, can chemical synthesis, stability is good, does not have the advantages that toxicity, using aptamer detection heavy metal be
The hot spot of Recent study.And aptamer is applied at present most or in Hg in heavy metal analysis2+And Pb2+'s
Detection, Cu2+、K+Aptamer sensor there are also document reports, and by aptamer be applied to Cd2+Detection need into
One step research.
Summary of the invention
The present invention overcomes the deficiencies of existing technologies, provide it is a kind of can specific recognition heavy metal cadmium fluorescence detection body
System.
Specifically, in detection architecture provided by the invention, comprising can specific recognition heavy metal cadmium aptamer
And fluorescent dye.
The specific aptamers of the heavy metal cadmium are one section of oligonucleotide, sequence are as follows: 5 '-
ACCGACCGTGCTGGACTCTGGACTGTTGTGGTATTATTTTTGGTTGTGCAGTATGAGCGAGCGTTGCG-3'；The core
Thuja acid can form hair clip type structure, specifically bind with heavy metal cadmium, and both ends are not necessarily to other flags sequence, purify through HPLC
DNA it is single-stranded, with MgCl containing 1mM2PBS (pH 7.4) solution of the 10mmol/L of (pH 8.5) dilutes, further according to required dense
Degree is diluted with pure water to be used.
Same method obtains the complementary strand of aptamers sequence, and sequence is as follows: 5 '-
CGCAACGCTCGCTCATACTGCACAACCAAAAATAATACCACAACAGTCCAGAGTCCAGCACGGTCGGT-3’。
Fluorescence method is a kind of with higher sensitivity detection method；However, the present invention is had found by largely practice, for this hair
For the specific aptamers of bright test object cadmium and selection, if using will be on fluorochrome label to recognition ligand
Conventional detection means may cause the change of aptamers DNA space structure and specific binding site, identify target in aptamers
When heavy metal cadmium, the specificity of detection and sensitivity can be made to be affected, accuracy decline.
In order to realize sensitivity and accuracy expected from the present invention, the present invention utilizes the aptamer of non-marked and dissociates
Fluorescent dye under state constructs detection architecture jointly, and the fluorescent dye is independently present in system, without being tagged to nucleic acid
In aptamers, therefore interference of the marking type fluorescent dye to aptamers structure and binding performance is avoided, makes the core of high specific
Sour aptamers and highly sensitive fluorescence detection play synergistic effect.
Meanwhile the present invention incites somebody to action in order to avoid the latent defect that sequestered fluorescent dye accuracy is bad, resultant error is bigger than normal
Fluorescent dye is preferably embedded dsDNA fluorescent dye Picogreen.
The present invention is by largely practice discovery, using by the non-marked aptamer and sequestered fluorescent dye
The system of Picogreen building detects heavy metal cadmium, and high sensitivity, specificity is good, and result precision is high,
Picogreen fluorescent dye can successfully be embedded in the duplex structure that aptamer and its complementary strand of the present invention are constituted, from
And the fluorescence intensity caused is sharply increased, effect is better than other common fluorescent dyes；The present invention has found simultaneously, the detection
System can be resistant to certain density salt, urea, ethyl alcohol, chloroform, detergent, albumen etc. in environment to be measured and interfere, and have very strong
Environmental suitability.
On the basis of the aptamer, invention further provides a kind of fluorescence detection sides of heavy metal cadmium
Method, specific recognition molecules of the method using aptamer as cadmium, using fluorescent dye as medium, using fluorescence intensity
The concentration of analytic approach detection cadmium ion.
The principle of the detection method as shown in Figure 1, when in solution there are when the object cadmium ion of aptamers DNA, cadmium
The conformation of aptamers changes, and the region single stranded DNA " stem-loop " forms specific stereochemical structure, specific high-affinity
Ground is in conjunction with cadmium；Then, the complementary strand and Picogreen of aptamers DNA is added, complementary strand will be with set target no in solution
The free aptamers of object combine, and form double-stranded DNA, and Picogreen is embedded in the minor groove of double-stranded DNA, and launches fluorescence
Signal, so that by the concentration for measuring object cadmium to the analysis of fluorescence intensity, concentration and the fluorescence intensity of cadmium are inversely proportional.Benefit
Absorbance measurement is carried out with to solution, linear relationship can be established by target concentration and absorbance.
The Detection wavelength of the fluorescence intensity is preferably Ex/Em=480nm/530nm.
Specifically, detection method of the present invention comprising the following specific steps
It is separately added into aptamers DNA in the contrast solution that the standard solution and cadmium concentration of multiple known cadmium concentrations are 0, is mixed
The complementary chain dna of the aptamers is respectively added after even hatching, then is separately added into fluorescent dye, sufficiently after reaction, detects respectively
Fluorescence intensity；
Using the cadmium concentration logarithm of standard solution as abscissa, with the fluorescence intensity of each standard solution and contrast solution it
Than obtaining equation of linear regression for ordinate；
(2) solution to be measured is taken, using detection method fluorescence intensity identical with step (1)；
(3) fluorescence intensity level of solution to be measured obtained by step (2) is substituted into equation of linear regression obtained by step (1), meter
Calculation obtains the cadmium concentration in solution to be measured.
Since Cadmium In The Water Body ion concentration to be measured under actual conditions is lower, the concentration of cadmium ion becomes during real-time monitoring
Change amplitude is smaller, and in order to ensure the sensitivity and accuracy of detection, the standard that cadmium is added in the present invention preferably in solution to be measured is molten
Liquid is obtained mark-on solution to be measured, is detected using external standard method.The cadmium concentration of the preferably described mark-on solution to be measured of the present invention is 10
~500ng/mL；The cadmium concentration of the further preferred mark-on solution to be measured is 20~200ng/mL.
The present invention filters out reasonable aptamers DNA concentration and Picogreen extension rate by many experiments, thus really
Protecting concentration, conformation and the signal strength of fluorescent dye in conjunction with DNA are suitable with aptamers nucleotide itself sequence signature, object
It answers, so that it is guaranteed that final detection limit can reach 0.40ng/mL.As a preferred solution of the present invention, containing cadmium, aptamers
In the reaction solution of DNA and its complementary chain dna and Picogreen, final concentration of 10~100ng/mL of cadmium ion, aptamers DNA
And its final concentration of complementary chain dna is respectively 0.2~0.3 μm of ol/L.
The fluorescence detection time is preferably further 5min by the present invention, in specific system provided by the invention, when detection
Between 5 minutes fluorescence intensities obtained it is sufficiently strong and stablize, while may insure fluorescence intensity level only to specific object and suitable
Interaction between ligand, to realize accurate detection.
As a preferred solution of the present invention, the detection method comprising the following specific steps
(1) taking concentration respectively is the cadmium mark of 2ng/mL, 20ng/mL, 200ng/mL, 2 μ g/mL, 20 μ g/mL, 200 μ g/mL
Each 100 μ L of contrast solution that quasi- solution and concentration are 0ng/mL, is separately added into the aptamers DNA of 1 μm of ol/L of 50uL concentration, mixes
After hatching 20min, it is separately added into the complementary chain dna of the aptamers of 1 μm of ol/L of 50uL concentration, then it is separately added into 5 ×
Picogreen fluorescent dye, after reacting 5min, each standard solution of detection and contrast solution Ex/Em=480nm/530nm at
Fluorescence intensity；It is as abscissa, with the ratio between standard solution and the fluorescence intensity of contrast solution using cadmium concentration logarithm in standard solution
Ordinate obtains equation of linear regression；
(2) taking volume is the solution to be measured of 10~100mL, and the cadmium standard solution 0.1mL of concentration 20ug/mL is added, must add
Mark solution to be measured；
Mark-on solution to be measured described in 100 μ L is taken, the aptamers DNA of 1 μm of ol/L of volume 50uL concentration is added, mixes hatching
After 20min, the complementary chain dna of the aptamers of 1 μm of ol/L of 50uL concentration is added, adds 5 × Picogreen fluorescence dye
Material after reacting 5min, detects the fluorescence intensity of mark-on solution to be measured at Ex/Em=480nm/530nm；
(3) fluorescence intensity level of mark-on solution to be measured obtained by step (2) is substituted into equation of linear regression obtained by step (1)
In, the concentration of cadmium ions in solution to be measured is calculated.
5 × the Picogreen refers to the fluorescent dye Picogreen for being concentrated into 5 times of working concentrations.In practical application
When, the concentration of Pcicogreen is diluted 5 times.
The concentration of cadmium of the present invention by cadmium element in the quality in unit volume liquid in terms of.
The present invention further protects the detection architecture and the detection method in the real-time monitoring or trace of heavy metal cadmium
Measure the application in heavy metal analysis.
The detection of system and the method for the present invention heavy metal cadmium suitable for environmental sample and life sample.It can specifically answer
Detection for heavy metal cadmium in industrial water, agricultural water, domestic water, drinking water and food.
System and method provided by the invention have extremely strong environmental suitability, can be to avoid the dry of a large amount of environmental factors
It disturbs, conducive to the real-time monitoring containing trace heavy metal cadmium sample.
Method provided by the invention has excellent cadmium ion specificity, and high sensitivity.The present invention is by selecting other
Heavy metal ion or chemical substance investigate aptamers to cadmium and other heavy metals as potential interference object under same detection system
Ion selects specificity and sensitivity in different gold concentration gradients.Only have the blank of aptamers DNA molten using with no object
Liquid control is compared, and whether comparative analysis fluorescence spectrum is decreased obviously at 530nm and the solution spectrum spectral line containing chaff interferent
Situation of change.The result shows that the change in fluorescence rate that object cadmium is added is significantly higher than other heavy metal ion, illustrate institute of the present invention
The aptamers sequence that the method for stating uses has preferable selectivity, the fluorescence detection method tool for detecting cadmium established based on this
There is preferable specificity.
The fluorescent detection system and method for heavy metal cadmium provided by the invention based on non-marked aptamer, utilization are glimmering
The characteristic that photoinitiator dye Picogreen sharply increases the fluorescence intensity caused after pg grades of double-stranded DNA of sensitivity and insertion double-strand
It is detected, by the way that the design parameter in detection process is in optimized selection, realizes high sensitivity, detects with high specificity
Cadmium ion, minimum detectability can achieve 0.40ng/mL, lower than the World Health Organization (WHO) to the limitation mark of cadmium in drinking water
Cadmium limit standard in rice is provided in quasi- 3ng/mL and China's national standard " pollutants in food limitation GB2762-2012 "
0.2mg/kg (200ng/mL), can satisfy the demand of daily water quality and Food Monitoring.System and method provided by the invention are kept away
Exempted from conventional method to Specimen eliminating requirement height, expensive equipment, it is complicated for operation, be unable to the shortcomings that real time on-line monitoring.With it is existing
Technology is compared, and the present invention breaches antibody protein and is not easy the limitation stored, preparation cost is high, batch wise differences are big, is made using nucleic acid
Low in cost for recognition component, synthesis is convenient, and reusing is good, is that a kind of high sensitivity, specificity are good, convenient, fast,
Heavy metal cadmium analysis method with good live real-time detection prospect.
Detailed description of the invention
Fig. 1 is the schematic diagram that non-marked aptamer of the present invention detects cadmium principle；
Fig. 2 is 2 gained fluorescence intensity of embodiment with cadmium concentration variation map；
Fig. 3 is 2 gained equation of linear regression of embodiment；
Fig. 4 is that 2 gained specific detection of experimental example analyzes result.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..
The aptamer DNA sequence dna and its complementary dna sequence that each embodiment uses are the DNA through HPLC purifying mono-
Chain is synthesized by Sangon Biotech (Shanghai) Co., Ltd., respectively by MgCl containing 1mM2The 10mmol/L PBS of (pH 8.5)
- 20 DEG C are stored in after the dilution of (pH 7.4) solution.
Picogreen fluorescent dye is purchased from Sigma company.
Cadmium standard solution, Tris-HCl are purchased from Sigma company；Other reagents are purchased from Solution on Chemical Reagents in Shanghai company, institute
It is that analysis is pure with reagent.
Fluorescence Spectrometer LS-55 is purchased from U.S. PE company；Table-type high-speed refrigerated centrifuge device is purchased from Sigma company；
Millipore water purification machine is purchased from U.S. Bedford company.
Embodiment 1
Present embodiments provide can specific recognition heavy metal cadmium detection architecture, including aptamer DNA sequence dna, core
Sour aptamers complementary dna sequence and fluorescent dye Picogreen, remaining is buffer；
The aptamer DNA sequence dna are as follows: 5 '-ACCGACCGTGCTGGACTCTGGACTGTTGTGGTATTATTTTTG
GTTGTGCAGTATGAGCGAGCGTTGCG-3'；
The aptamer complementary dna sequence are as follows: 5 '-CGCAACGCTCGCTCATACTGCACAACCAAAAATAATAC
CACAACAGTCCAGAGTCCAGCACGGTCGGT-3’。
Embodiment 2
The present embodiment utilize embodiment 1 provide detection architecture, with Beijing Suburban somewhere agricultural irrigation water water sample be to
Sample (content of the sample to be tested through graphite furnace atomic absorption spectrometry Cd, be not detected), follows the steps below detection:
(1) the aptamers DNA for taking 1 μm of 7 parts of volume 50uL, concentration ol/L is separately added into 100 μ L of volume, concentration is respectively
2ng/mL, 20ng/mL, 200ng/mL, 2 μ g/mL, 20 μ g/mL, the cadmium ion standard solution of 200 μ g/mL and concentration are 0ng/mL
Contrast solution；After mixing hatching 20min, it is separately added into the complementary strand of the aptamers of 1 μm of volume 50uL, concentration ol/L
DNA is (at this point, cadmium is respectively 0ng/mL, 1ng/mL, 10ng/mL, 100ng/mL, 1 as the ultimate density of object from low to high
μ g/mL, 10 μ g/mL, 100 μ g/mL), then it is separately added into 5 × Picogreen fluorescent dye, after reacting 5min, in Ex/Em=
The fluorescence intensity of each standard solution and contrast solution is detected at 480nm/530nm；With concentration of cadmium ions logarithm lg in standard solution
(Cd2+) it is abscissa, with the ratio between the fluorescence intensity of standard solution and contrast solution F/F0For ordinate, equation of linear regression is obtained；
Fluorescent absorption intensity changes map as shown in Fig. 2, as shown in Figure 2 with cadmium concentration, with the raising of concentration of cadmium ions,
Absorption peak at 530nm gradually decreases；
The equation of linear regression as shown in figure 3, from the figure 3, it may be seen that be between the logarithm and fluorescence ratio of concentration of cadmium ions
Good linear relationship, regression equation R2It can achieve 0.9929；
(2) taking volume is the solution to be measured of 10mL and 100mL, is separately added into the cadmium ion standard solution of concentration 20ug/mL
0.1mL obtains mark-on 1 (Cd of solution to be measured2+Concentration is 200ng/mL) and mark-on 2 (Cd of solution to be measured2+Concentration is 20ng/mL)；
Mark-on solution to be measured 1 and mark-on solution 2 to be measured are detected respectively according to the following steps: taking volume 50uL, dense
The aptamers DNA of 1 μm of ol/L is spent, mark-on solution to be measured described in 100 μ L is added, after mixing hatching 20min, 1 μ of 50uL concentration is added
The complementary chain dna of the aptamers of mol/L, the liquor capacity of system is 200uL at this time, the Cd in mark-on solution to be measured2+Most
Final concentration is respectively 100ng/mL and 10ng/mL；5 × Picogreen fluorescent dye is added, after reacting 5min, in Ex/Em=
The fluorescence intensity of mark-on solution to be measured is detected at 480nm/530nm；
(3) fluorescence intensity level of mark-on solution to be measured obtained by step (2) is substituted into equation of linear regression obtained by step (1)
In, the concentration of cadmium ions in solution to be measured is calculated, and calculate recovery of standard addition, the results are shown in Table 1.
Concentration of cadmium ions and recovery of standard addition in 1. sample to be tested of table
The above result shows that method provided by the invention can be adapted for the detection of cadmium in farmland irrigating water, the rate of recovery
It can achieve 90.3%, detection limit can reach 0.40ng/mL, before the real-time online context of detection of water quality has good application
Scape.
Experimental example
In order to study the specificity of heavy metal Cd aptamers, this experimental example passes through selection heavy metal ion Cu2+、Na+、Mg2+、
K+、As+、Ca2+、Hg2+、Zn2+As potential interference object, aptamers are detected under the conditions of same as Example 2 to Cd and other are heavy
Metal ion Cu2+、Na+、Mg2+、K+、As+、Ca2+、Hg2+、Zn2+(concentration of metal ions gradient is 0ng/mL, 1ng/mL, 10ng/
ML, 1ug/mL, 100ug/mL) select specificity and sensitivity.
Compared with blank control (solution that i.e. no object only has aptamers DNA), blank control fluorescence spectrum exists
It decreased significantly at 530nm, and with Cu2+、Na+、Mg2+、K+、As+、Ca2+、Hg2+、Zn2+Solution spectrum of the ion as object
Spectral line varies less, and the change in fluorescence rate that Cd object is added is significantly higher than other heavy metal ion, result above such as Fig. 4 institute
Show.
Result is it is found that the aptamers sequence that the present invention uses has preferable selectivity, based on this foundation as shown in Figure 4
Method for visualizing for detecting cadmium has preferable specificity.
Although above having used general explanation, specific embodiment and test, the present invention is made to retouch in detail
It states, but on the basis of the present invention, it can be made some modifications or improvements, this is apparent to those skilled in the art
's.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to claimed
Range.
Claims (9)
1. a kind of fluorescent detection system of heavy metal cadmium, which is characterized in that including in the detection architecture can specific recognition weight
The aptamer and sequestered fluorescent dye of cadmium metal；
The sequence of the aptamer are as follows: 5 '-ACCGACCGTGCTGGACTCTGGACTGTTGTGGTATTATTTTTGGTTGT
GCAGTATGAGCGAGCGTTGCG-3'；
The sequence of the complementary strand of the aptamers are as follows: 5 '-CGCAACGCTCGCTCATACTGCACAACCAAAAATAATACCACAA
CAGTCCAGAGTCCAGCACGGTCGGT-3'；
The fluorescent dye is Picogreen fluorescent dye.
2. a kind of fluorescence detection method of heavy metal cadmium, which is characterized in that the method is using aptamer as the special of cadmium
Property identification molecule, using sequestered fluorescent dye as medium, using Fluorescence density analysis assay detect cadmium ion concentration；
The sequence of the aptamer are as follows: 5 '-ACCGACCGTGCTGGACTCTGGACTGTTGTGGTATTATTTTTGGTTGT
GCAGTATGAGCGAGCGTTGCG-3'；
The sequence of the complementary strand of the aptamers are as follows: 5 '-CGCAACGCTCGCTCATACTGCACAACCAAAAATAATACCACAA
CAGTCCAGAGTCCAGCACGGTCGGT-3'；
The fluorescent dye is Picogreen fluorescent dye.
3. according to the method described in claim 2, characterized by comprising the following steps:
(1) it is separately added into aptamers DNA in the contrast solution that the standard solution and cadmium concentration of multiple known cadmium concentrations are 0, mixed
The complementary chain dna of the aptamers is respectively added after even hatching, then is separately added into fluorescent dye, sufficiently after reaction, detects respectively
Fluorescence intensity；
Using the cadmium concentration logarithm of standard solution as abscissa, it is with the ratio between each standard solution and fluorescence intensity of contrast solution
Ordinate obtains equation of linear regression；
(2) solution to be measured is taken, using detection method fluorescence intensity identical with step (1)；
(3) fluorescence intensity level of solution to be measured obtained by step (2) is substituted into equation of linear regression obtained by step (1), is calculated
To the cadmium concentration in solution to be measured.
4. according to the method described in claim 3, it is characterized in that, the mark of cadmium is added in solution to be measured in the step (2)
Quasi- solution obtains mark-on solution to be measured, and the fluorescence using detection method identical with step (1) detection mark-on solution to be measured is strong
Degree；It is preferred that the cadmium concentration of the mark-on solution to be measured is 10~500ng/mL；The cadmium of the further preferred mark-on solution to be measured
Concentration is 20~200ng/mL.
5. the method according to claim 3 or 4, which is characterized in that in the step (2), containing cadmium, aptamers DNA
And its in the reaction solution of complementary chain dna and Picogreen, final concentration of 10~100ng/mL of cadmium ion, aptamers DNA and its
The final concentration of complementary chain dna is respectively 0.2~0.3 μm of ol/L.
6. the method according to claim 3 or 4, which is characterized in that after the addition fluorescent dye, react 5min, detection
Fluorescence intensity.
7. according to the method described in claim 5, it is characterized in that, reacting 5min, detection fluorescence after the addition fluorescent dye
Intensity.
8. a kind of fluorescence detection method of heavy metal cadmium, which comprises the following steps:
(1) take concentration molten for 2ng/mL, 20ng/mL, 200ng/mL, 2 μ g/mL, 20 μ g/mL, the cadmium standard of 200 μ g/mL respectively
Each 100 μ L of contrast solution that liquid and concentration are 0ng/mL, is separately added into the aptamers DNA of 1 μm of ol/L of 50uL concentration, mixes hatching
After 20min, it is separately added into the complementary chain dna of the aptamers of 1 μm of ol/L of 50uL concentration, then is separately added into 5 × Picogreen
Fluorescent dye after reacting 5min, detects the fluorescence intensity of each standard solution and contrast solution at Ex/Em=480nm/530nm；
Using cadmium concentration logarithm in standard solution as abscissa, with the ratio between fluorescence intensity of standard solution and contrast solution for ordinate, obtain
Obtain equation of linear regression；
(2) taking volume is the solution to be measured of 10~100mL, and the cadmium standard solution 0.1mL of concentration 20ug/mL is added, obtains mark-on and waits for
Survey solution；
Mark-on solution to be measured described in 100 μ L is taken, the aptamers DNA of 1 μm of ol/L of volume 50uL concentration is added, mixes hatching 20min
Afterwards, the complementary chain dna of the aptamers of 1 μm of ol/L of 50uL concentration is added, adds 5 × Picogreen fluorescent dye, reacts
After 5min, the fluorescence intensity of mark-on solution to be measured is detected at Ex/Em=480nm/530nm；
(3) fluorescence intensity level of mark-on solution to be measured obtained by step (2) is substituted into equation of linear regression obtained by step (1), meter
Calculation obtains the concentration of cadmium ions in solution to be measured.
9. detection method described in detection architecture described in claim 1 or claim 2~8 any one is in real-time monitoring heavy metal
Application in cadmium or detection trace heavy metal cadmium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510970031.4A CN105548109B (en) | 2015-12-22 | 2015-12-22 | A kind of fluorescent detection system and detection method of heavy metal cadmium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510970031.4A CN105548109B (en) | 2015-12-22 | 2015-12-22 | A kind of fluorescent detection system and detection method of heavy metal cadmium |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105548109A CN105548109A (en) | 2016-05-04 |
| CN105548109B true CN105548109B (en) | 2018-12-28 |
Family
ID=55827448
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510970031.4A Active CN105548109B (en) | 2015-12-22 | 2015-12-22 | A kind of fluorescent detection system and detection method of heavy metal cadmium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105548109B (en) |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106443003A (en) * | 2016-09-18 | 2017-02-22 | 暨南大学 | Fluorescent quenching test paper strip based on aptamer specific recognition and preparation method and application thereof |
| CN106841130A (en) * | 2016-12-28 | 2017-06-13 | 成都理工大学 | A kind of method of uranyl ion content in unmarked fluoroscopic examination water sample |
| CN107340279B (en) * | 2017-06-30 | 2019-11-08 | 中国农业科学院农业质量标准与检测技术研究所 | A kind of aptamer, kit and method that can detect mercury and silver ion simultaneously |
| CN108020532B (en) * | 2017-10-27 | 2020-10-02 | 中国农业大学 | Colorimetric sensor based on cadmium functional nucleic acid and application thereof |
| CN108387621B (en) * | 2018-01-10 | 2019-11-26 | 暨南大学 | Cadmium ion aptamer and screen printing electrode electrochemica biological sensor |
| CN108760706B (en) * | 2018-06-08 | 2021-08-06 | 农业部环境保护科研监测所 | Method for rapidly screening rice varieties with low cadmium accumulation |
| CN110823846A (en) * | 2018-08-09 | 2020-02-21 | 河北农业大学 | Application of novel fluorescent dye AccuBlue in detection of aptamer |
| CN109975257B (en) * | 2019-01-18 | 2022-01-14 | 中国农业科学院北京畜牧兽医研究所 | Fluorescence detection method for heavy metal cadmium |
| CN110849853B (en) * | 2019-11-27 | 2022-08-23 | 徐州百世松岗环保科技发展有限公司 | Sewage pipeline detection sewage discharge water outlet cover based on Internet of things and using method thereof |
| CN113267475A (en) * | 2020-02-17 | 2021-08-17 | 上海交通大学 | Method for fluorescence detection of cadmium ions by one-step quenching method |
| CN111504932A (en) * | 2020-03-23 | 2020-08-07 | 天津师范大学 | Cadmium ion detection method based on graphene oxide ultraviolet absorption aptamer sensor |
| CN113355400B (en) * | 2021-04-06 | 2023-08-22 | 南京师范大学 | Cadmium ion detection method based on T3 DNA ligase |
| KR102328488B1 (en) * | 2021-06-24 | 2021-11-17 | 세종대학교산학협력단 | Aptamer specifically binding to at least one of a nickel ion and a cobalt ion |
| CN113866115A (en) * | 2021-10-25 | 2021-12-31 | 重庆食品工业研究所有限公司 | Method for detecting cadmium in food |
| CN114438091B (en) * | 2022-02-08 | 2023-12-01 | 中国科学院生态环境研究中心 | DNA fluorescent probe and method for detecting cadmium ions by using same |
| CN114457084B (en) * | 2022-03-10 | 2023-06-23 | 宜宾五粮液股份有限公司 | Aptamer specifically combined with ethyl carbamate and preparation method and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160504A (en) * | 2013-03-01 | 2013-06-19 | 上海交通大学 | Nucleic acid fluorescent probe used for rapidly detecting heavy metal lead and detection method thereof |
| KR101460450B1 (en) * | 2013-09-05 | 2014-11-12 | 충북대학교 산학협력단 | DNA aptamer specifically binding to cadmium and uses thereof |
-
2015
- 2015-12-22 CN CN201510970031.4A patent/CN105548109B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105548109A (en) | 2016-05-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105548109B (en) | A kind of fluorescent detection system and detection method of heavy metal cadmium | |
| Sun et al. | Label-free fluorescent sensor based on aptamer and thiazole orange for the detection of tetracycline | |
| Chen et al. | Random dsDNA-templated formation of copper nanoparticles as novel fluorescence probes for label-free lead ions detection | |
| Liu et al. | Label-free and fluorescence turn-on aptasensor for protein detection via target-induced silver nanoclusters formation | |
| Xu et al. | Label-free fluorescence detection of mercury (II) and glutathione based on Hg2+-DNA complexes stimulating aggregation-induced emission of a tetraphenylethene derivative | |
| CN105510420B (en) | A kind of method based on Beads enrichment and DNA marker gold nanoparticle probe detection ATP contents | |
| Wu et al. | Metal-induced G-quadruplex polymorphism for ratiometric and label-free detection of lead pollution in tea | |
| Cheng et al. | Determination of saxitoxin by aptamer-based surface-enhanced raman scattering | |
| Zhou et al. | Target-initiated autonomous synthesis of metal-ion dependent DNAzymes for label-free and amplified fluorescence detection of kanamycin in milk samples | |
| Huang et al. | Sensitive turn-on fluorescent detection of tartrazine based on fluorescence resonance energy transfer | |
| CN104178568A (en) | Method for detecting target substance in to-be-detected sample based on fluorescent sensing analysis of aptamer probe | |
| Li et al. | A rhodamine-benzimidazole based chemosensor for Fe 3+ and its application in living cells | |
| Li et al. | Label-free fluorescence “turn-on” strategy for mercury (II) detection based on the T-Hg2+-T configuration and the DNA-sensitized luminescence of terbium (III) | |
| CN102735662A (en) | High sensitivity and high selectivity fluorescence emission spectrum analysis method for zinc ions | |
| Fadhel et al. | Selective nano-sensing approach for the determination of inorganic phosphate in human urine samples | |
| CN105884806A (en) | Preparation method of fluorescent probe and oxytetracycline detection method based on same | |
| Zhang et al. | A novel, label-free fluorescent aptasensor for cocaine detection based on a G-quadruplex and ruthenium polypyridyl complex molecular light switch | |
| Chen et al. | Microchip electrophoresis based multiplexed assay for silver and mercury ions simultaneous detection in complex samples using a stirring bar modified with encoded hairpin probes for specific extraction | |
| Chen et al. | Superior fluorescent probe for detection of potassium ion | |
| Liu et al. | A novel SERS biosensor for ultrasensitive detection of mercury (II) in complex biological samples | |
| Qiu et al. | Aptamer-based detection of melamine in milk using an evanescent wave fiber sensor | |
| Wei et al. | Label-free and homogeneous aptamer proximity binding assay for fluorescent detection of protein biomarkers in human serum | |
| Sheng et al. | A rapid quantitative method for humic substances determination in natural waters | |
| CN107677651A (en) | A kind of Single wavelength excites the Hg that dual signal strengthens2+Ratio fluorescent method | |
| Li et al. | Dual dye-labeled G-quadruplex aptasensor for detection of thallium (I) using ratiometric fluorescence resonance energy transfer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220728 Address after: 100097 No. 9 middle garden, Shuguang garden, Beijing, Haidian District Patentee after: BEIJING ACADEMY OF AGRICULTURE AND FORESTRY SCIENCES Address before: 1005, experimental building, Beijing Academy of agriculture and Forestry Sciences, 9 Shuguang Huayuan Middle Road, Haidian District, Beijing 100097 Patentee before: BEIJING RESEARCH CENTER FOR AGRICULTURAL STANDARDS AND TESTING |