CN104745588B

CN104745588B - A kind of nucleic acid aptamer of specific recognition streptomysin and its application in streptomysin detection

Info

Publication number: CN104745588B
Application number: CN201510106215.6A
Authority: CN
Inventors: 刘中成; 樊武舫; 张艳芬; 解瑶; 赵丽君; 赵丽健; 王向欢
Original assignee: Hebei University
Current assignee: Tianjin Xiju Pharmaceutical Co.,Ltd.
Priority date: 2015-03-11
Filing date: 2015-03-11
Publication date: 2017-12-12
Anticipated expiration: 2035-03-11
Also published as: CN104745588A

Abstract

The invention discloses a kind of nucleic acid aptamer of specific recognition streptomysin, the nucleotide sequence such as SEQ ID NO of the aptamer:Shown in 1；Meanwhile the invention also discloses using nucleic acid aptamer it is qualitative and quantitative determination streptomysin method and the application in food inspection.The present invention is using streptomysin as target substance, the nucleic acid aptamer of high-affinity, high specific recognition streptomysin has been screened through affinity chromatography using SELEX technologies, and the aptamer is combined with collaurum colorimetric method, establish the streptomysin novel detection method based on oligonucleotide aptamer, this method can simply, it is quick, accurate, economical, quantitative or qualitative detection is specifically carried out to streptomysin, can be widely applied to the multiple fields such as food, health and inlet and outlet inspection and quarantine.

Description

A kind of nucleic acid aptamer of specific recognition streptomysin and its streptomysin detection in Using

Technical field

The present invention relates to field of biological technology detection, the nucleic acid aptamer of specifically a kind of specific recognition streptomysin and It is applied.

Background technology

Streptomysin（streptomycin）A kind of broad-spectrum aminoglycoside class antibiotic, can suppress gram-Negative bacillus and Part Gram-positive bacillus, it is widely used in medicine, agricultural and animal husbandry.But in actual use, due to using Unreasonable or illegal use, cause its a large amount of residual in the animal derived foods such as meat, liver, kidney, milk and honey, Human health has been severely compromised, can make one to produce a series of illness such as allergic reactions and renal toxicity, ototoxicity, result even in Become deaf.Therefore, strict rule have been done in many countries and regions such as FDA, European Union and China to the MRL of streptomysin It is fixed, it is seen then that whether detection streptomysin is remained in food and how much residual quantity has great importance.

At present, the detection method of Determination of Streptomycin Residues mainly has following three kinds：1st, liquid chromatograph mass spectrography detection method, should Method combines the separating capacity of chromatogram with mass spectrographic qualitative function, realizes more accurately quantitative and fixed to complex mixture Property analysis, be a kind of method of sensitive reliable detection Determination of Streptomycin Residues, its detection line in milk can as little as 10 μ g/kg, Accuracy and accuracy are all of a relatively high；But need to carry out post because streptomysin does not have UV absorption, when detecting using chromatogram Derivative afterwards or fluorescence labeling, it is expensive to need to carry out sample pre-treatment, complex operation, and device therefor before sample introduction, operating technology Property it is strong, it is bothersome laborious；2nd, immunodetection, as CN103645322 A disclose a kind of chemical illuminating reagent for detecting streptomysin Box, including box body, the ELISA Plate being located in box body and the reagent being located in box body, each hole of the ELISA Plate are coated with coating and resisted It is former；The reagent includes：Streptomysin monoclonal antibody, the sheep anti-mouse antibody of horseradish peroxidase-labeled, streptomysin series mark Quasi- solution, concentrated phosphoric acid salt buffer, concentrated cleaning solution, chemical luminescence for liquid；ELISA Plate selects the opaque polystyrene of milky 96 hole chemiluminescence ELISA Plates, each hole of ELISA Plate are coated with envelope antigen made of streptomysin and ovalbumin coupling；Should Method is simple to operate, and its special and sensitivity is also higher, and still, this method has screening small molecule anti-streptomycin antibody process more Cumbersome, different batches performance is different, elapsed time, and expense is of a relatively high；3rd, microbiological method, this method expense is relatively low, but Its sensitivity and specificity is poor, and the consuming time is longer, so practical application is relatively fewer.It can be seen that these current small point of detections The method of subchain mycin is not very perfect, so it is residual to establish a kind of new quick, accurate, sensitive, economic detection streptomysin The method stayed is the problem tried to explore in industry.

Aptamer is that utilization index enrichment Fas lignand system is evolved（SELEX）Technology screens obtain and target from nucleic acid library The oligonucleotide sequence that material is specifically bound, it can specific recognition and associated proteins, small molecule, ion, cell etc. Target substance.Because the small molecular antibodies such as streptomysin prepare more difficulty, so analysis of the aptamer as detection small-molecule substance Instrument, it will have broad application prospects.In practical application, aptamer is superior to antibody, such as chemically stable in all many-sides Property is good, is readily synthesized, not mutability, relatively low immunogenicity etc.；In addition, aptamer is controlled in gene therapy, resistant to infection and cancer Security in treatment is also confirmed.Up to the present, people have screened the specific aptamer of many small-molecule substances, And a series of detecting system of small-molecule substances is developed based on aptamer.But up to the present, grinding at home and abroad It has not been found that being carried out quickly, accurately to streptomysin on the aptamer of specific recognition streptomysin and using aptamer in studying carefully Relevant report that is qualitative and quantitatively detecting.

The content of the invention

An object of the present invention is to provide a kind of nucleic acid aptamer of specific recognition streptomysin, and is applied to and determines Property or quantitatively detect streptomysin in, it is cumbersome to solve existing streptomysin detection process, detection accuracy it is poor the problem of.

The second object of the present invention is to provide method that is a kind of qualitative and quantitatively detecting streptomysin, to solve prior art inspection Or surveyor's chain mycin exist detection tedious process, waste time and energy, cost it is higher, or accuracy and sensitivity is relatively poor asks Topic.

What the present invention was realized in：A kind of nucleic acid aptamer of specific recognition streptomysin, the nucleotides of the aptamer Sequence is：CCCGTTTAAAGTAGTTGAGAGTATTCCGTTTCTTTGTGTC（See SEQ ID NO: 1）.

Its nucleotides sequence is classified as after the nucleotide aptamer adds fixed sequence program：

5’-ACCGACCGTGCTGGACTCTGCCCGTTTAAAGTAGTTGAGAGTATTCCGTTTCTTTGTGTCCAGTAT GAGCGAGCGTTGCG- 3 ', dashed part is fixed sequence program.Its second structure characteristic is as shown in Figure 1.

The present invention is not limited to SEQ ID NO:Sequence shown in 1, the nucleic acid aptamer is modified or transformed Obtained nucleic acid aptamer derivative falls within protection scope of the present invention.

Nucleic acid aptamer derivative of the present invention can be it is following any one：Delete or increase partial nucleotide, obtain There is the nucleic acid derivative of identical function with the nucleic acid aptamer；Carry out nucleotides substitution or part modify, obtain with it is described Nucleic acid aptamer has the nucleic acid derivative of identical function；Transformed, obtained and the core using this nucleic acid aptamer as skeleton Sour aptamer has the nucleic acid derivative of identical function；The nucleic acid aptamer is changed to peptide nucleic acid, obtains fitting with the nucleic acid Gamete has the nucleic acid derivative of identical function；By the nucleic acid aptamer be marked fluorescence class material, enzyme material or its Its mark substance, obtain the nucleic acid derivative that there is identical function with the nucleic acid aptamer.

This research obtains the nucleic acid of specific recognition streptomysin using SELEX technology screenings using streptomysin as target substance Aptamer, and determine its nucleotide sequence；The nucleic acid aptamer learns that it has very high to streptomysin by fluorescence method identification Affinity and height specificity, this for further utilization aptamer detect streptomysin lay a good foundation.The present invention carries The nucleic acid aptamer of confession is smaller with molecular weight compared with the antibody of protide, can be with chemical synthesis, and cost is relatively low, stability It is good, and be easy to preserve；It directly can in vitro synthesize, be easy to mark and the mark of selectivity can be carried out in different parts；Used It is flexible in detection streptomysin method, it is easy to optimize；, can be based on the thuja acid aptamer, to design and develop in practical application A variety of streptomysin test in laboratory methods, it can be used widely in fields such as food, health and inlet and outlet detections.

Nucleic acid aptamer association colloid gold colorimetric method of the present invention is used for qualitative or/and quantitatively detects strepto- in food The application of element.

A kind of method of qualitative detection streptomysin, comprises the following steps：

（a）By the HAuCl that mass concentration ratio is 0.01%₄Solution heating is boiled, and it is 1% to add mass concentration ratio while stirring Sodium citrate, after solution changes color, boil and continue 10-15min, be cooled to room temperature, obtain collaurum；

（b）To add the ratio of the nucleic acid aptamer of 100 nmol/L specific recognition streptomysin in 45-60 μ L collaurum Example mixes both, is incubated at room temperature 1-2 h, and the collaurum of aptamer mark has been made；Wherein described specific recognition streptomysin The nucleotide sequence of nucleic acid aptamer such as SEQ ID NO:Shown in 1；

（c）Testing sample is added in the collaurum of aptamer mark, if solution colour is claret, in testing sample Streptomysin concentration is less than 200 nmol/L；If solution colour is changed into purple, the concentration of testing sample streptomycin from claret For 200 ~ 800 nmol/L；If solution colour is changed into blueness from claret, the concentration of testing sample streptomycin is more than 800 nmol/L。

A kind of method for quantitatively detecting streptomysin, comprises the following steps：

（C）In step（B）It is respectively 25 nmol/L, 50 to add concentration in the collaurum of obtained aptamer mark Nmol/L, 100 nmol/L, 200 nmol/L, 400 nmol/L, 800 nmol/L, 1600 nmol/L streptomysin, room temperature are incubated 1 h is educated, adds the NaCl that 50 μ L concentration are 200 mmol/L, is that A520 and A620 determines its light absorption value respectively in wavelength, with chain The concentration of mycin is abscissa, using the A620 and A520 ratio measured described in same concentration streptomysin as ordinate, makees strepto- Plain concentration and the curve map of A620/520 ratios, are fitted its standard curve；During determination sample, testing sample is added to aptamer In the collaurum of mark, its light absorption value in wavelength for A520 and A620 is determined, seeks A620/520 ratios, carries it into standard song Corresponding content of streptomycin value, the content of contained streptomysin as in testing sample are obtained in line.

The present invention with by the nucleic acid aptamer being combined with streptomysin of the high specific of above-mentioned screening and high-affinity with Collaurum colorimetric method is combined, and establishes the streptomysin novel detection method based on oligonucleotide aptamer, can simply, it is quick, Accurately, it is economical, quantitative or qualitative detection is specifically carried out to streptomysin, to develop new streptomysin analysis method or detection instrument Good basis is established, while also provides thinking for the detection of other small-molecule substances, can be in food, health and inlet and outlet detection It is used widely Deng field.

Brief description of the drawings

Fig. 1 is the second structure characteristic figure of nucleic acid aptamer of the present invention.

The infared spectrum of Fig. 2 epoxy-activateds gel and streptomysin-epoxy radicals gel coupled complex.Wherein a is in figure Streptomysin-epoxy radicals gel coupled complex, b are epoxy-activated gel.

The infared spectrum of Fig. 3 amino magnetic beads and Streptavidin MagneSphere.A is amino magnetic bead wherein in figure, and b is that strepto- is affine Biscuit porcelain pearl.

Fig. 4 often takes turns screening PCR primer polyacrylamide gel electrophoresis result.

Fig. 5 often takes turns the fluorescent value of screening PCR primer.

Fig. 6 is the aptamer affinity result figure of fluorescent marker method measure.

Fig. 7 is the second structure characteristic figure of aptamer A17, A25 and A15 in the embodiment of the present invention 1.

Fig. 8 is that the streptomysin of various concentrations and aptamer mark collaurum coagulation state diagram.

Fig. 9 is the spectrogram that the streptomysin of various concentrations adds the collaurum of mark aptamer.

Figure 10 is A₆₂₀/A₅₂₀Ratio and streptomysin concentration relationship curve map.

Figure 11 is A₆₂₀/A₅₂₀Ratio and the canonical plotting of streptomysin concentration.

Figure 12 is streptomysin and the qualitative detection figure of comparative example.

Embodiment

Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, it is conventional method unless otherwise specified.Test material used, reagent etc. in embodiment, unless otherwise specified, Commercially obtain.Quantitative test in following examples, it is respectively provided with and repeats to test three times, results averaged.

The acquisition of the nucleic acid aptamer of the specific recognition streptomysin of embodiment 1

（1）The coupling of epoxy radicals gel and streptomysin：Take 3 ml epoxy-activateds gels to be washed five times with distilled water, then take out It is filtered dry dry；It will be added to 0.1mol/Ls of 10 ml containing 20 mg/ml streptomysins in dried epoxy-activated gel Na₂CO₃-NaHCO₃Coupling buffer（PH value is 10.5）In, 37 DEG C of incubation 16h；After reaction terminates, product will be incubated and used 0.1mol/L PBS solution is flushed three times, and the monoethanolamine for adding 1 mol/L is closed, and is incubated at room temperature 1 h；After closing Gel conjugates contain 0.5 mol/L NaCl HAc-NaAc buffer solutions with 5 times of deionized water, 0.1 mol/L successively（PH value For 4.0）, deionized water, 0.1 mol/L contain 0.5 mol/L NaCl boric acid-sodium tetraborate buffer solution（PH value is 8.0）With go Ionized water fully washs, and filters drying, eliminates unreacted aglucon, obtain streptomysin-epoxy radicals gel coupled complex；By chain It is standby in the ethanol solution that the mass concentration ratio that mycin-epoxy radicals gel coupled complex is resuspended in 4 DEG C is 20%；By gained Streptomysin-epoxy radicals gel coupled complex carries out infrared detection with epoxy-activated gel, verifies that it is coupled result, as a result sees Shown in Fig. 2.Epoxy ring-opening forms C-O keys and C-N keys, as can be seen from Figure 2 streptomysin-epoxy radicals gel coupled complex In 1180 cm^-1There is a characteristic peak at place, and epoxy-activated gel is here without characteristic peak, and this peak is exactly by the flexible vibrations productions of C-N Raw, this explanation streptomysin is fixed on epoxy radicals gel by chemical reaction.

（2）The preparation of anode posts and cathode column：

The preparation of anode posts：3 mL streptomysins-epoxy radicals gel coupled complex is fitted into affinity column void column, used 1 mol/L NaCl solutions point 5 are eluted, every time 10 mL, elution cumulative volume 50 mL（Elution must assure that gel every time It is dipped in liquid）10 column volumes are washed with deionized water again, obtain anode posts, it is 20% to be finally stored in 10 mL mass percents In ethanol solution；

The preparation of cathode column：By 3 mL not with the epoxy-activated gel of streptomysin coupling with 10-20 times of volume go from Sub- water rinses 5 times, to remove DMSO, is drained in sand core funnel, is transferred in 10 mL affinity column, obtains cathode column.

（3）Build ssDNA random libraries：

80 bp random single chain oligonucleotides is designed using Oligo6.0 and primer premier 5.0（single Strand DNA, ssDNA）Library, centre is 40 bp random sequences, and both ends are respectively 20 bp fixed sequence programs, and particular sequence is complete It is a length of：

5’-ACCGACCGTGCTGGACTCTG-40bp-CAGTATGAGCGAGCGTTGCG-3’。

It is as follows to design pcr amplification primer thing：

Sense primer P1：5 '-ACCGACCGTGCTGGACTCTG-3 ',

The sense primer P2 of biotin labeling：5’-Biotin-ACCGACCGTGCTGGACTCTG-3’；

Anti-sense primer P3：5 '-CGCAACGC TCGCTCATACTG-3 ',

The anti-sense primer P4 of fluorescence labeling：5’-FAM-CGCAACGC TCGCTCATACTG-3’.

The ssDNA random libraries sequence and upstream and downstream primer and labeled primer give birth to work bioengineering share by Shanghai Co., Ltd synthesizes.

（4）Aptamer screens and identification：

A, it is coupled：Take step（3）The pmol of ssDNA random libraries 500 of synthesis is dissolved in 1ml combination buffers（Including 20 Mmol/L Tris-HCl, 50 mmol/L NaCl, 5 mmol/L KCl and 5 mmol/L MgCl₂, pH value 8.0）In, 100 After DEG C denaturation 5 min, 4 DEG C of 10 min of cooling, add it in cathode column, be incubated 10 min in 37 incubators, collect not with The ssDNA random libraries that epoxy radicals activated gel is combined in cathode column are added in anode posts, 37 DEG C of 1 h of incubation；Then use Washing buffer（Including 20 mmol/L Tris-HCl, 50 mmol/L NaCl, 5 mmol/L KCl, 5 mmol/L MgCl₂ With the Tween20 that mass concentration ratio is 0.01%, pH value 8.0）200 column volumes of elution, the mL/min of the rate of outflow 1, finally Add 1 mL elution buffers（Including 20 mmol/L Tris-HCl, 50 mmol/L NaCl, 5 mmol/L KCl, 5 mmol/ L MgCl₂With 10 mmol/L streptomysin, pH value 8.0）, elute five times, each elution buffer collected, in washing for collection 3 mol/L NaAc of the volume of eluent 1/10 are added in de- buffer solution, it is 0.3 mol/L to make its ultimate density, after fully mixing Isometric pre- cold isopropanol is added, -20 DEG C stand overnight, and at 4 DEG C, 12000 rpm centrifuge 15 min, abandon supernatant, use matter The ethanol solution that amount specific concentration is 70% is washed twice（12000 rpm centrifuge 15 min）, supernatant is carefully removed from, filter paper sucks pipe All drops on wall, at room temperature so that evaporating to doing for residual, obtains ssDNA precipitations, be designated as（1, mesh）；

B, non-symmetric PCR amplification：The 100 μ L ddH by ssDNA precipitations with 60 DEG C of preheatings₂O dissolves, after being dissolved with 0.5 μ L SsDNA be template, with the sense primer P of biotin labeling₂（5’-Biotin-ACCGACCGTGCTGGACTCTG-3’）, it is glimmering The anti-sense primer P of signal₄（5’-FAM-CGCAACGCTCGCTCATACTG-3’）Non-symmetric PCR amplification is carried out, its is described symmetrical PCR amplification system be：Take the sense primer P for the biotin labeling that concentration is 10 μm of ol/L₂, fluorescence labeling downstream draw Thing P₄Each 1 μ L, PCR buffer of 0.5 μ L, ddNTP 2 μ L, the μ L of Taq enzyme 0.1, the μ L of aqua sterilisa 15.4.Amplification program is： 94 DEG C of min of pre-degeneration 3,94 DEG C of 45 s of denaturation, 68 DEG C of 45 s of annealing, 72 DEG C of 45 s of extension, 6 take turns thermal cycles.It is parallel to do 5 pipes, obtain Amplified production is screened to the first round, is designated as（1, d）；

C, PCR is purified：PCR primer purification kit（Beijing CoWin Bioscience Co., Ltd.）Purified, PCR primer is added in the adsorption column balanced, 12000 rpm centrifugations, screens out 50 below bp DNA sequence dna, recovery 50 More than bp sequences, the band that cleans is removed, symmetrical PCR primer must be purified, be designated as（1, c）；

D, the preparation of secondary library：Streptavidin MagneSphere is first prepared, takes 5 mg（1 mL）Amino magnetic bead ultrasound mixes, dress In the EP pipes for entering 10 mL, with 5 mL PB（0.1 mol/L pH 7.4）It is suspended, supernatant is abandoned in Magneto separate, suction, and three are washed with PB It is secondary；The mL of glutaraldehyde 5 newly matched somebody with somebody of mass percent concentration 12% is added, 37 DEG C of shaking tables are incubated 4 h, and PB is washed three times；Add 1 mL 100 μ g/mL Streptavidin（Streptavidin is dissolved in distilled water）, 37 DEG C of shaking tables 4 h of incubation, obtain Streptavidin magnetic Pearl, Magneto separate Streptavidin MagneSphere, clean up standby；Amino magnetic bead and Streptavidin MagneSphere are subjected to infrared detection, Verify that it is coupled result, as a result see Fig. 3；A is amino magnetic bead wherein in figure, and b is Streptavidin MagneSphere.

From b in Fig. 3, infared spectrum shows Streptavidin MagneSphere in 544 cm^-1With 1606 cm^-1There is absorption at place Peak, and the characteristic peak of schiff bases is in 1650~1590 cm^-1Scope, illustrate there is the generation of C=N contractings vibration peak；Infared spectrum is different from Amino magnetic bead, it was demonstrated that Streptavidin MagneSphere is successfully coupled；

Take 6 ~ 7 × 10⁷（1 mg）Streptavidin MagneSphere, with 2 times of B＆W buffer solutions（10 mmol/L Tris-HCl, pH 7.5,1mmol/L EDTA, 2.0 mol/L NaCl）Wash magnetic bead once；Cleaning solution is abandoned in upper magnetic frame 1-2 min, suction；Take 100 1 times of B＆W buffer solution of μ L is suspended；Add the isometric symmetrical PCR primers of purifying of 100 μ L（1, c）, 37 DEG C of shaking tables are with reference to 30 min；The upper min of magnetic frame 1 ~ 2, separation has combined symmetrical PCR primer dsDNA Streptavidin MagneSphere, with 1 times of B＆W buffer solution Washing is with reference to dsDNA Streptavidin MagneSphere 2 ~ 3 times, and the dsDNA combined to Streptavidin MagneSphere unwinds, specifically For：200 μ L 150 mmol/L NaOH are added, 37 DEG C of 15 min of incubation, dsDNA is unwind；Upper magnetic frame, containing biotin One ssDNA is stayed on Streptavidin MagneSphere and adsorbed in tube wall, and the ssDNA of another fluorescence labeling being complementary to is deposited In supernatant, target product is designated as, is designated as（1, s）.Measure prepared by Streptavidin MagneSphere（1, s）Product and after purification （1, c）Fluorescence intensity, calculate its organic efficiency.Result of calculation is：By the PCR primer that fluorescence intensity is 112.67 fluorescence labelings It is 38.67 to add after Streptavidin MagneSphere unwinds fluorescence intensity in obtained supernatant, the rate of recovery 34.32%.And can basis Fluorescence intensity, calculate the affinity of its each round.

E, each round is screened：Take target product（1, s）500 pmol combination buffers are settled to 1 mL, 95 DEG C of denaturation 2 After min, 4 DEG C of min of water-bath 10 are placed immediately, add anode posts, are incubated 1 h, by elution, are afforded（2, mesh）,（2, d）, （2, c）,（2, s）.Third round is similar with the second wheel, takes（2, s）500 pmol are incubated to obtain with anode posts（3, s）, for the 4th The screening of wheel.Fourth round, it is necessary to carry out counter-selection, takes compared to third round（3, s）300 pmoL, 1 is settled to combination buffer After mL, 95 DEG C of 2 min of denaturation, 4 DEG C of min of water-bath 10 are placed immediately, add cathode column, 10 min is incubated, is transferred to anode posts and incubates 1 h is educated, by elution, elution, fourth round is carried out and screens to obtain（4, mesh）,（4, d）,（4, c）,（4, s）.

5th takes turns to the screening that the tenth wheel repeats the first round, and per three-wheel, screening carries out a counter-selection, non-specific for removing Property combine sequence.The ssDNA that tenth wheel is screened（10, mesh）Above-mentioned sense primer P1 and anti-sense primer are added as template P3 enters performing PCR amplification, and other substrates and amplification program of amplification system are same as above, by the symmetrical PCR primer polyacrylamide of every wheel Amine gel electrophoresis analysis, Fig. 4 is obtained, 1,2,3,4 be respectively the 3rd wheel, 5 wheels, 7 wheels, the PCR primer of 9 wheel screenings in figure, and M is represented Marker；As can be seen from the figure band is clear, without miscellaneous band；Its fluorescence intensity is measured with the secondary library of each round, as commenting The standard of valency each round affinity, elutes that the secondary library fluorescence intensity of collection is higher, and affinity is higher, as a result sees Fig. 5, in figure 1 ~ 10 represents that the fluorescent value of PCR primer is often taken turns in SELEX screenings respectively.

It is connection pUCM-T loads after the product purification that template non-symmetric PCR amplification obtains by the ssDNA that the tenth wheel screening obtains Body, Escherichia coli are transferred to, picking monoclonal containing ssDNA is sequenced, and 31 positive colonies are sequenced altogether, and 13 are obtained after sequencing Not homotactic aptamer, the as ssDNA higher with streptomysin compatibility；Pass through Mfold program software analysis ssDNA Secondary structure, obtained aptamer is classified according to the similitude of primary sequence homology and secondary structure, is shown in Table 1.

The primary sequence in the random areas of the ssDNA of table 1

（5）Fluorometric assay screens and streptomysin affinity highest aptamer：

Take the μ L of 13 kinds of transformed bacterias 30 of the ssDNA higher with streptomysin compatibility after sequencing identification to be inoculated in 3 mL to contain Amp LB fluid nutrient mediums, shake bacterium and stay overnight, and add 1.5 mL EP pipes, and 12000 rmp centrifuge 1 min, abandon supernatant.Using plasmid Extraction agent box（Give birth to work in Shanghai）Carry out that plasmid is small carries；Using the plasmid as template with biotin labeling sense primer P2 and glimmering The anti-sense primer P of signal₄Non-symmetric PCR amplification is carried out, the volume of each material and amplification program are same as above in amplification system, are purified, Purified product is combined with Streptavidin MagneSphere, Magneto separate, unwind, the aptamer of 13 kinds of fluorescence labelings will be obtained.

13 kinds of different sequence adaptation are incubated with cathode column anode posts respectively, is eluted, washed by above-mentioned technique De- step, determines the fluorescence intensity of anode posts eluent, and every 300 μ L survey first order fluorescence intensity.Record highest peak in anode posts Intensity, compare 13 different sub- peak heights of sequence adaptation, do column diagram, as the standard of affinity measure, see Fig. 6.Due to adaptation Son is incubated with cathode column, adds leacheate, and with the increase of addition, fluorescence intensity gradually decreases, and adds eluent, and fluorescence is strong Degree no longer changes, it was demonstrated that aptamer will not be adsorbed on cathode column, and with the addition of leacheate, aptamer can gradually flow out；It is suitable Gamete is incubated with anode posts, adds leacheate, and with the increase of addition, fluorescence intensity is constant, adds eluent, fluorescence intensity Change from small to big, it was demonstrated that aptamer generates specific binding with anode posts, and leacheate will not elute aptamer, work as addition During eluent, aptamer is gradually eluted.Its Anodic, which is incubated, adds eluent, and the solution fluorescence intensity eluted is higher, Prove that aptamer and anode posts affinity are higher.According to the height of anode posts peak value, affinity size is judged.Obtained aptamer Fluorescent value pole be significantly higher than negative control（P<0.01）, show that the aptamer that screening obtains can be with streptomysin stable bond. As can be seen from Fig. 6, A15 is higher than aptamer in other two families with A31 affinity in the 3rd family, chooses affine in each family Power highest aptamer is compared, and A15 affinity is significantly higher than in the A17 in the first family and the second family in the 3rd family A25.

（6）One aptamer of affinity highest in each family may be selected according to affinity column diagram to seek its Kd value and do Secondary structure prediction.Using the aptamer selected in each family as template, anti-sense primer and biomarker with fluorescence labeling Sense primer carry out non-symmetric PCR amplification, unwind the fluorescence labeling aptamer purified with paramagnetic particle method, is diluted to difference Concentration（0.02、0.04、0.08、0.1、0.15 μg）It is incubated with 1 mg bead complexes, measurement is different dense before and after being incubated The fluorescence intensity of aptamer is spent, the fluorescence intensity of calculations incorporated is as ordinate.According to origin mapping softwares, make Nonlinear Quasi Close.According to Michaelis-Menten equation：y/2=y_max[ssDNA]/(Kd+ [ssDNA]), calculates Kd values, and wherein y is the glimmering of absorption aptamer Luminous intensity, ordinate；y_maxAdsorb the maximum fluorescence intensity of aptamer；[ssDNA] is aptamer concentration, abscissa；Kd values are solution From constant, the smaller then affinity of Kd values is higher.By measure, the Kd values for as a result showing aptamer A15, A17, A25 are respectively 6.07nmol/L, 8.56nmol/L and 10.31nmol/L, its secondary structure and Kd values are shown in Fig. 7, and wherein A15 aptamers Kd values show Write less than other adaptations, illustrate No. A15 and streptomysin affinity highest, i.e., such as SEQ ID NO:Shown in 1.

Embodiment 2 is qualitative and quantitatively detect streptomysin using aptamer

（1）It is prepared by collaurum：By 20 mL, the HAuCl that mass concentration ratio is 0.01%₄Heating is boiled, and is added while stirring 500 μ L mass concentration ratios are 1% sodium citrate, and after color change, solution persistently boils 10min, remove thermal source stirring until Room temperature, obtain collaurum；Collaurum can be stored in the sodium azide that mass concentration ratio is 0.05%, it is standby；

（2）Qualitative detection：The nucleic acid adaptation of 100 nmol/L specific recognition streptomysin is added in 50 μ L collaurum Son, 1 h is incubated at room temperature, the collaurum of aptamer mark has been made；It is respectively 25 nmol/L, 50 nmol/L, 100 final concentration Nmol/L, 200 nmol/L, 400 nmol/L, 800 nmol/L, 1600 nmol/L streptomysin are added to aptamer mark In collaurum, 1 h is incubated at room temperature；The NaCl that 50 μ L concentration are 200 mmol/L is eventually adding, color change is observed, such as Fig. 8 institutes Show.

Fig. 8 shows that colloidal gold solution is purple or blueness by wine red change, is said when streptomysin concentration is more than 200 nmol/L Bright color change is related to streptomysin concentration.It is red when streptomysin concentration is less than 200 nmol/L, shows there is a small amount of glue Body golden hair gives birth to coagulation, and bore hole cannot distinguish between color change situation, but can change detection streptomysin concentration by absorbance value.When Streptomysin concentration is 200 ~ 800 nmol/L, and color is changed into purple, shows that coagulation occurs for most collaurum.When streptomysin is dense Degree is more than 800 nmol/L, and color is blueness, shows that coagulation occurs for whole collaurums., can be with 50 μ L with this experimental result Collaurum in add 100 nmol/L aptamer ratio be made aptamer mark collaurum, as test card The test fluid of substrate or kit, whether contain streptomysin in sample for detecting, concrete operations are：In the glue of aptamer mark Testing sample, the color of naked eye solution are added in body gold, if the color of solution is still claret, strepto- in testing sample The concentration of element is less than 200 nmol/L；If solution colour is changed into purple from claret, the concentration of testing sample streptomycin is 200~800 nmol/L；If solution colour is changed into blueness from claret, the concentration of testing sample streptomycin is more than 800 nmol/L.The content range of testing sample streptomycin can be so determined with initial characterization.

When containing streptomysin in testing sample, but when its concentration is less than 200 nmol/L, solution is claret, shows to have few Coagulation occurs for the collaurum of amount, and bore hole cannot distinguish between color change situation, but can change detection streptomysin by absorbance value Concentration；When testing sample streptomycin concentration is 200 ~ 800 nmol/L, solution colour is changed into purple, shows most colloid Golden hair gives birth to coagulation；When streptomysin concentration is more than 800 nmol/L, solution colour is blueness, and it is poly- to show that whole collaurums occurs It is heavy；Transmission electron microscope results show, the collaurum coagulation degree of aptamer mark and streptomysin concentration positive correlation, with color change and Light absorbs result of variations is consistent.

（3）Quantitative detection：To step（2）Middle collaurum coagulation degree is scanned using ultraviolet-uisible spectrophotometer, such as Fig. 9 Shown, when collaurum coagulation degree increases as streptomysin concentration increases, A520 has declined, and A620 is gradually increasing, Extinction value changes at two have obvious correlation with streptomysin change in concentration, find A620/A520 ratio after analysis Change with streptomysin concentration is closer linearly related, therefore, selects A620/520 quantitatively to detect streptomysin concentration than value changes, Its measurement result is shown in Figure 10.Shown from Figure 10, when streptomysin concentration is 25-800nmol/L, its A620/A520 ratio It is substantially linear with streptomysin concentration；It is fitted, gained standard curve is as shown in figure 11, its R²For 0.998； During practical measurement sample, testing sample is added in the collaurum of aptamer mark, it is A520 and A620 to determine it in wavelength Light absorption value, A620/520 ratios are sought, by it in standard curve is brought into, you can learn containing for contained streptomysin in testing sample Amount；

（4）The checking of aptamer high special identification：In order to determine the specificity of streptomysin aptamer, selection and streptomysin Of a sort aminoglycoside antibiotics and other non-amino glycoside antibiotic（Kanamycin sulfate, G418, erythromycin, chlorine Mycin and hydrochloric acid tobramycin）Reacted as negative control and the aptamer A15 collaurums marked.As a result such as Figure 12 institutes Show, visually can direct observing colloid gold color change.Wherein testing sample 1 is positive control, 2 is 800 nmol/L streptomysins, 3 It is kanamycin sulfate for 200 nmol/L streptomysins, 4,5 be G418,6 be erythromycin, 7 be chloramphenicol, 8 is that hydrochloric acid Top is mould Element.From Figure 12, only adding streptomysin can cause collaurum color by red change to be purple or blueness, and other antibiotic can not With aptamer A15 with reference to and collaurum can not be made to change colour.Although streptomysin, kanamycin sulfate and G418 belong to aminoglycoside Class antibiotic, there is similar structure, but aptamer A15 is only combined with streptomysin, is demonstrated by the specificity of height.Pass through light splitting Photometer detection A620/A520 shading values are inhaled, as a result consistent with collaurum colorimetric method, show that aptamer A15 can be to special Property identifies and combines streptomysin.

The quantitative detection of the milk of embodiment 3 and honey Determination of streptomycin residues

From honey and milk sample of the buying of local supermarket without streptomysin, streptomysin is carried out using recovery testu Quantitative detection, concrete operations are as follows：

Milk sample processing：3 mL ethyl acetate and 3 mL water are added in 1 mL milk samples, whirlpool mixes 15 min； Then at 4 DEG C, 8000 rpm/min centrifugations 15min；Mixture is divided into three layers, collects water layer as detection sample in next step；

Honey sample processing：Honey distilled water dilutes five times and is diluted, as detection sample；

By series of standards concentration streptomysin：25nmol/L、50nmol/L、100nmol/L、200nmol/L、400 Nmol/L is separately added into the milk and honey sample after processing, and strepto- in sample is detected using the quantitative detecting method of embodiment 2 Plain concentration, it is detected, and result is consistent with addition streptomysin concentration, and its qualitative detection result is consistent with quantitatively detecting.This explanation is originally Invention is higher using aptamer detection streptomysin accuracy, and from table data it is known that milk sample streptomycin The rate of recovery is 70 ~ 90%, between being 76 ~ 98% in honey, the relative standard deviation of the two detection（RSD）Average is less than 4.58 %. The result shows that the present invention obtains nucleic acid aptamer and can be successfully applied to the detection of actual sample streptomycin, and accuracy with Accuracy is all of a relatively high.

Testing result is shown in Table 2.

The milk of table 2 and honey sample streptomycin testing result

SEQUENCE LISTING

<110>University Of Hebei

<120>A kind of nucleic acid aptamer of specific recognition streptomysin and its application in streptomysin detection

<130>

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 40

<212> DNA

<213>Adjust aptamer

<400> 1

cccgtttaaa gtagttgaga gtattccgtt tctttgtgtc 40

Claims

1. a kind of nucleic acid aptamer of specific recognition streptomysin, it is characterised in that the nucleotides sequence of the nucleic acid aptamer is classified as：

2. a kind of nucleic acid aptamer as described in claim 1 be used for collaurum colorimetric method it is qualitative and quantitatively detect food in The application of streptomysin.

A kind of 3. method of qualitative detection streptomysin, it is characterised in that comprise the following steps：

（b）To add the ratio of the nucleic acid aptamer of 100 nmol/L specific recognition streptomysin in 45-60 μ L collaurum Both are mixed, is incubated at room temperature 1-2 h, the collaurum of aptamer mark has been made；The core of wherein described specific recognition streptomysin The nucleotides sequence of sour aptamer is classified as：

（c）Testing sample is added in the collaurum of aptamer mark, if solution colour is claret, strepto- in testing sample Plain concentration is less than 200 nmol/L；If solution colour is changed into purple from claret, the concentration of testing sample streptomycin is 200~800 nmol/L ；If solution colour is changed into blueness from claret, the concentration of testing sample streptomycin be more than 800nmol/L。

A kind of 4. method for quantitatively detecting streptomysin, it is characterised in that comprise the following steps：

（C）In step（B）Added in the collaurum of obtained aptamer mark concentration be respectively 25 nmol/L, 50 nmol/L, 100 nmol/L, 200 nmol/L, 400 nmol/L, 800 nmol/L, 1600 nmol/L streptomysin, 1 h is incubated at room temperature, The NaCl that 50 μ L concentration are 200 mmol/L is added, is that A520 and A620 determines its light absorption value respectively in wavelength, with strepto- The concentration of element is abscissa, using the A620 and A520 ratio measured described in same concentration streptomysin as ordinate, makees strepto- Plain concentration and the curve map of A620/520 ratios, are fitted its standard curve；During determination sample, testing sample is added to adaptation In the collaurum of son mark, its light absorption value in wavelength for A520 and A620 is determined, A620/520 ratios is sought, carries it into Corresponding content of streptomycin value, the content of contained streptomysin as in testing sample are obtained in standard curve.