CN105255899A - Set of sulfamethazine specifically-bound aptamers and screening method and applications thereof - Google Patents

Abstract

The invention discloses a set of sulfamethazine specifically-bound aptamers and a screening method and applications thereof. The aptamer for identifying sulfamethazine, disclosed by the invention, is a single-stranded DNA molecule shown in any one of formulas (1)-(4): (1) a single-stranded DNA molecule shown in a sequence 3 in a sequence table; (2) a single-stranded DNA molecule shown in a sequence 1 in the sequence table; (3) a single-stranded DNA molecule shown in a sequence 2 in the sequence table; and (4) a single-stranded DNA molecule shown in a sequence 4 in the sequence table. Experiments show that a directly competitive chemiluminescence analysis method established based on biotinylated aptamers and used for detecting sulfamethazine provides a basis for the practical application of the aptamers of sulfamethazine, and provides technical support for more efficient and extensive monitoring of antimicrobial drug residues.

Description

One group-specific is in conjunction with the aptamer of sulfamethazine and screening method thereof and application

Technical field

The invention belongs to biological technical field, be specifically related to a group-specific in conjunction with the aptamer of sulfamethazine and screening method thereof and application.

Background technology

Sulfamethazine (Sulfamethazine, SM ₂) be broad spectrum antimicrobicide, to most of gram positive organism and gram-negative bacteria all inhibited, be mainly used in treating suis etc. clinically and infect the bacteriosis and coccidiosis of chicken that cause, thus widely use in livestock breeding industry.At present, the residual phenomena of sulfamethazine in animal food is comparatively serious, is the object that livestock product safety is supervised emphatically.The country such as China, European Union and mechanism all in regulation animal food the maximum residue limit(MRL) of the single medicine such as sulfa drugs total amount and sulfamethazine be 100 μ g/kg.

The immune analysis method being mainly binding member foundation with antibody to the quick residue detection research of this medicine is at present master.But the preparation of antibody be unable to do without and uses laboratory animal, and is difficult to duplication of production, add it and preservation condition is required strict, cause the use of antibody to be restricted.

Aptamer (Aptamer) is the phyletic evolution technology (SELEX by exponential amplification part, Systematicevolutionofligandsbyexponentialenrichment) screening obtains, and with many target molecules (albumen, medicine, inorganic or organic molecule), a class single-stranded nucleotide (DNA or RNA) of high-affinity and specific binding can occur.Compared with antibody, the sharpest edges of aptamer are not need to use laboratory animal, and available in vitro method is separated preparation, and it is easier to modify, also more stable.Therefore, a new situation has been started in the analyzing and testing field that appears as of aptamer.Aptamer is as the surrogate of antibody, and applying it in detection of veterinary drugs in food technology is an important content of current detection technique research.

Summary of the invention

An object of the present invention is to provide a kind of aptamer.

Aptamer provided by the invention is the arbitrary shown single strand dnas in following (1)-(4):

(1) single strand dna as shown in sequence in sequence table 3;

(2) single strand dna as shown in sequence in sequence table 1;

(3) single strand dna as shown in sequence in sequence table 2;

(4) single strand dna as shown in sequence in sequence table 4.

Another object of the present invention is to provide a kind of derivative of aptamer.

The derivative of aptamer provided by the invention be in following (1)-(8) any one:

(1) with the nucleotide sequence of above-mentioned aptamer, there is more than 60% or 60% identity, and there is with described aptamer the derivative of the aptamer of identical function;

(2) hybridize with the nucleotide sequence of above-mentioned aptamer, and there is with described aptamer the derivative of the aptamer of identical function;

(3) RNA molecule of being transcribed by the nucleotide sequence of above-mentioned aptamer, and the derivative with described aptamer with the aptamer of identical function;

(4) peptide nucleic acid(PNA) of being encoded by above-mentioned aptamer, obtains the derivative of the aptamer with described aptamer with identical function;

(5) above-mentioned aptamer is lacked, replaces or increase one or several Nucleotide, obtain the derivative of the aptamer with described aptamer with identical function;

(6) above-mentioned aptamer is carried out Nucleotide replacement or modification, obtain the derivative of the aptamer with described aptamer with identical function;

(7) transform the skeleton of above-mentioned aptamer as phosphorothioate ester skeleton, obtain the derivative of the aptamer with described aptamer with identical function;

(8) by one end of above-mentioned aptamer or middle connection signal molecule and/or bioactive molecule and/or functional group, the derivative of the aptamer with described aptamer with identical function is obtained.

In said derivative, being modified to phosphorylation, amination, methylating in described (6), sulfhydrylation or isotopologue; Functional group in described (8) is vitamin H, fluorescent substance, radioactive substance, nano material, albumen or enzyme labelling.

A further object of the invention is to provide a kind of test kit for identifying sulphamethazine.

Provided by the invention for identifying that the test kit of sulphamethazine comprises the derivative of above-mentioned aptamer or above-mentioned aptamer.

Test kit provided by the invention also comprises sulfamethazine-spacerarm-HRP.

Test kit provided by the invention also comprises sulfamethazine standard solution and binding buffer liquid; Described sulfamethazine standard solution concentration is 0.1ng/mL, 0.4ng/mL, 1.1ng/mL, 3.3ng/mL, 9.9ng/mL, 29.6ng/mL, 88.9ng/mL, 266.7ng/mL and 800ng/mL.

Last object of the present invention is to provide the derivative of above-mentioned aptamer or above-mentioned aptamer or the novelty teabag of mentioned reagent box.

The invention provides the application in following (1)-(6) in any one of the derivative of above-mentioned aptamer or above-mentioned aptamer or mentioned reagent box:

(1) identification or aid identification sulphamethazine;

(2) product of preparation identification or aid identification sulphamethazine;

(3) detect or whether contain sulphamethazine in auxiliary detection testing sample;

(4) detect or auxiliary detection testing sample in sulphamethazine concentration;

(5) separation or auxiliary separating are from sulphamethazine;

(6) enrichment or auxiliary enrichment sulphamethazine.

In above-mentioned application, described testing sample is milk.

Compared with existing antibody technique, the invention has the advantages that: screen the aptamer obtained, relative to conventional antibodies, there are easier screening conditions, nontoxicity, molecular weight is little, can externally synthesize, stable in properties, be easy to chemically modified and mark, and the avidity of aptamer provided by the invention and sulfamethazine is high, dissociation constant (Dissociationconstant, Kd) nM level is reached, can specific recognition sulfamethazine.

The present invention utilizes SELEX technology, using sulfamethazine as target molecule, screening obtains the aptamer of high specific, high-affinity, and establishes the direct competitive chemiluminescence analysis method for detecting sulfamethazine based on the aptamer that vitamin H (Biotin) is changed.Prove by experiment: method of the present invention is easy, highly sensitive and the variation coefficient is little, can be used for detecting the residual of sulfamethazine in milk.Aptamer of the present invention will become the powerful of sulfamethazine residue detection, what the aptamer changed based on vitamin H (Biotin) was set up is that the practical application of the aptamer of sulfamethazine provides the foundation for detecting the direct competitive chemiluminescence analysis method of sulfamethazine, monitors the residual of antibacterials more efficiently, widely and provides technical support.

Accompanying drawing explanation

Fig. 1 is the secondary structure prediction of sulfamethazine aptamer.Figure 1A is the secondary structure prediction of sulfamethazine aptamer SA07; Figure 1B is the secondary structure prediction of sulfamethazine aptamer SA41.

Fig. 2 is the dissociation constant matched curve of sulfamethazine and its aptamer.

Fig. 3 is the specificity analyses of sulfamethazine aptamer.

Fig. 4 is the specificity of the chemical luminescence detection method based on aptamer.Fig. 4 A is the 14 kinds of sulfa drugss comprising sulfamethazine; Fig. 4 B is 14 kinds of sulfa drugss except Fig. 4 A.

Embodiment

The experimental technique used in following embodiment if no special instructions, is ordinary method.

Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

Sulfamethazine standard substance available from Sigma in following embodiment, catalog number is S6256-25G.

Sulfamethazine analogue standard substance (Sulphamerazine in following embodiment, sulfaphenazole, sulphafurazole, sulfametoxydiazine, sulfapyridine, sulfamonomethoxine, sulfaquinoxaline, Sulphadiazine Sodium, sulfamethoxazole, madribon, methoxy pyridazine between sulfanilamide (SN), Sulfamethylthiazole, White streptocide, sulfacetamide, Sulphadoxine, sulfanitran, sulfasalazine, sulfanilamide (SN) (two) first oxazole, sulfamethylthiadiazole, sulfoamido uracil, Sulfabenzide, Sulfisomidine, Sulphaguanidine, phthalylsulfathiazole, sulfaethoxypyridazine, sulfabrom, Sulfametopyrazine) available from Sigma.

In following embodiment 5 ' marks biotin labeled aptamer (biotin-SA07) is synthesized by Invitrogen company.

Binding buffer liquid (BB, pH7.6) in following embodiment is by solute and solvent composition, and solvent is water, and solute and the concentration in binding buffer liquid thereof are: NaCl1.461g/250mL, Tris-HCl0.788g/250mL, MgCl ₂6H ₂o0.102g/250mL, KCl0.093g/250mL, CaCl ₂0.028g/250mL, Tween2050 μ L/250mL.

Elution buffer (EB, pH8.0) in following embodiment is by solute and solvent composition, and solvent is water, and solute and the concentration in elution buffer thereof are: Tris-HCl0.631g/100mL, EDTA2Na2H ₂o0.372g/100mL, Urea21.02g/100mL, Tween2020 μ L/100mL.

TE-sodium-acetate buffer (pH7.8) in following embodiment is by solute and solvent composition, and solvent is water, and solute and the concentration in TE-sodium-acetate buffer thereof are: Tris-HCl0.485g/100mL, EDTA2Na2H ₂o0.038g/100mL, sodium acetate, anhydrous 0.164g/100mL.

10% ammonium persulfate solution in following embodiment is prepared as follows: take 0.1g ammonium persulphate and be dissolved in 1mL water, and mixing, obtains 10% ammonium persulfate solution.

The preparation method of the linear polyacrylamide solution (5 μ g/ μ L) in following embodiment is as follows: (1) takes 0.5g acrylamide and is dissolved in 10mLTE-sodium-acetate buffer, fully mixes; (2) add 100 μ L10% ammonium persulfate solutions and 10 μ LTEMED, mixing, slightly shakes 30min; (3) after solution becomes thickness muddiness, add 25mL ethanol, fully mix, the centrifugal 20min of 5000rpm; (4) remove supernatant, in precipitation, add 100mL ultrapure water, be placed in shaker overnight and dissolve, obtain linear polyacrylamide solution (5 μ g/ μ L).

The preparation method of the sodium-acetate buffer (3M, pH5.2) in following embodiment: take Sodium acetate trihydrate 81.6g and be dissolved in 170mL water, be adjusted to pH5.2 with Glacial acetic acid, then add water to 200mL, obtain sodium-acetate buffer (3M, pH5.2).

CoatingBuffer (pH5.0) in following embodiment is by solute and solvent composition, and solvent is water, and solute and the concentration in CoatingBuffer thereof are: Na ₂hPO ₄12H ₂o14.33g/400mL, citric acid 1H ₂o4.2g/400mL.

10mMPBS damping fluid (pH7.0) in following embodiment is by solute and solvent composition, and solvent is water, and solute and the concentration in 10mMPBS damping fluid thereof are: NaH ₂pO ₄2H ₂o0.096g/100mL, Na ₂hPO ₄12H ₂o0.139g/100mL.

0.1MPBS damping fluid (pH7.0) in following embodiment is by solute and solvent composition, and solvent is water, and solute and the concentration in 0.1MPBS damping fluid thereof are: NaH ₂pO ₄2H ₂o0.96g/100mL, Na ₂hPO ₄12H ₂o1.39g/100mL, NaCl0.87g/100mL.

Washings in following embodiment is by solute and solvent composition, and solvent is water, and solute and the concentration in washings thereof are: NaCl320g/5L, K ₂hPO ₄10g/5L, KCl0.18g/5L, Na ₂hPO ₄12H ₂o116g/5L, Tween-20100mL/5L, Proclin3001.5mL/5L.

Antibody diluent (pH to 7.4) in following embodiment is by solute and solvent composition, and solvent is water, and solute and the concentration in antibody diluent thereof are: NaH ₂pO ₄2H ₂o0.59g/L, Na ₂hPO ₄12H ₂o2.9g/L, KCl0.2g/L, NaCl8.5g/L.

Confining liquid in following embodiment is by solute and solvent composition, and solvent is water, and solute and the concentration in confining liquid thereof are: sucrose 50g/L, casein 2.5g/L, NaH ₂pO ₄2H ₂o0.593g/L, Na ₂hPO ₄12H ₂o5.8g/L, calf serum 50mL/L, Proclin300300 μ L/L.

The screening of the aptamer of embodiment 1, specific binding sulfamethazine

The present embodiment utilizes aptamer in-vitro screening SELEX technology, by sulfamethazine (SM ₂) and Sulphamerazine (Sulfamerazine, SMR) and magnetic bead (Magneticbeads, MBs) coupling, obtain SM respectively ₂-MBs and SMR-MBs; And with SM ₂-MBs is for just to sieve target, SMR-MBs is the anti-target that sieves, establish and assist-the phyletic evolution of exponential amplification part screening system (Mag-SELEX) for the magnetic bead of sulfamethazine aptamer screening, from the random oligonucleotide storehouse of external synthesis, take turns screening through 9 obtaining the aptamer with sulphamethazine specific binding.Concrete steps are as follows:

1, the coupling of sulfamethazine, Sulphamerazine and carboxyl magnetic bead

(1) get 100 μ L carboxyl magnetic beads (about 0.6 μm of ol) in 2mL centrifuge tube, and be placed on magnetic separation rack, leave standstill 4min, carefully remove supernatant solution.Rapidly centrifuge tube is taken out from magnetic separation rack, add 100 μ L deionized waters, mixing, then put to magnetic separation rack, leave standstill 4min, get supernatant.

(2) in the supernatant in step (1), 100 μ L dimethyl formamides (DMF) are added, be placed in ultrasonic vibration instrument and fully clean 15min, clean 5 times with DMF to magnetic bead again, final step discards supernatant, obtains the carboxyl magnetic bead after washing.

(3) take 2mg2-(7-azo benzotriazole)-N, N, N', N'-tetramethyl-urea phosphofluoric acid ester (HATU) and be dissolved in 0.219mLDMF, mixing, obtains HATU solution; By 20 μ LN, N-diisopropylethylamine (DIPEA) is dissolved in 980 μ LDMF, and mixing, obtains DIPEA solution.

(4) the carboxyl magnetic bead after the washing 30 μ LHATU solution, 21.9 μ LDIPEA solution and step (2) obtained mixes, and stirring at room temperature 1.5-2 hour, obtains magnetic bead reaction solution.

(5) 2mg sulfamethazine and 0.179mLDMF are mixed, obtain sulfamethazine solution; 2mg Sulphamerazine and 0.189mLDMF are mixed, obtains Sulphamerazine solution.

(6) the magnetic bead reaction solution obtained in step (4) and 30 μ L sulfamethazine solution are mixed, be placed in shaking table, arranging rotating speed is 180rpm, and 30 DEG C of reactions are spent the night.After reaction terminates, takes out and collect supernatant, and with DMF cleaning magnetic bead 4 times, binding buffer liquid cleans 4 times, is finally suspended in 100 μ L binding buffer liquid, obtains the magnetic bead of sulfamethazine bag quilt, be placed in 4 DEG C for subsequent use.

Mixed with 30 μ L Sulphamerazine solution respectively by the magnetic bead reaction solution obtained in step (4), be placed in shaking table, arranging rotating speed is 180rpm, and 30 DEG C of reactions are spent the night.After reaction terminates, takes out and collect supernatant, and with DMF cleaning magnetic bead 4 times, binding buffer liquid cleans 4 times, is finally suspended in 100 μ L binding buffer liquid, obtains the magnetic bead of Sulphamerazine bag quilt, be placed in 4 DEG C for subsequent use.

2, the design of random single-stranded DNA banks and primer

Design two ends are the fixed sequence program of 20 bases, and centre is the random single-stranded DNA banks of 60 base stochastic sequences, that is: 5 '-CGTACGGTCGACGCTAGC-N ₆₀-CACGTGGAGCTCGGATCC-3 '.Wherein N ₆₀represent 60 random A, T, C, G.Primers F: 5 '-GGATCCGAGCTCCACGTG-3 ' and primer R:5 '-CGTACGGTCGACGCTAGC-3 '.Random single-stranded DNA banks and primer synthesize by Invitrogen company.

3, SELEX screening

The screening of sulfamethazine aptamer adopts Mag-SELEX method, utilizes the magnetic bead of Sulphamerazine bag quilt oppositely to screen, and obtains the aptamer of high specific for sulfamethazine and high-affinity.Concrete steps are as follows:

(1) get 600pmol random single-stranded DNA banks (ssDNA library) and be dissolved in 200 μ L binding buffer liquid, 95 DEG C of sex change 6min, then be placed in rapidly 10min on ice, then room temperature leaves standstill 5min.

(2) getting the anti-magnetic bead (first round Select to use carboxyl magnetic bead, all the other are taken turns and all use the magnetic bead of Sulphamerazine bag quilt) that sieves of 100 μ L is placed on magnetic separation rack, leaves standstill 4min, takes out supernatant.Add 200 μ L binding buffer liquid, clean 5 times.After last cleaning terminates, discard supernatant, and add rapidly the good ssDNA library of pre-treatment.After appropriateness mixing, be placed in shaking table 25 DEG C, 160rpm, hatches 30min.

(3), after hatching end, take out supernatant, and full dose adds to the magnetic bead (about 7 × 10 of 100 μ L sulfamethazine bag quilts ⁸individual).After appropriateness mixing, be placed in shaking table 25 DEG C, 160rpm, hatches 30min.Take out supernatant, with 200 μ L binding buffer liquid cleaning magnetic beads, repeat 6 times.Discard binding buffer liquid, add 200 μ L elution buffers, 80 DEG C of water-bath wash-out 10min, repeat 4 times, collect elutriant.

(4) ssDNA in linear polyacrylamide-ethanol precipitation concentrate eluant is adopted.In the combination that mensuration wash-out obtains, the concentration of the ssDNA of sulfamethazine, calculates and accounts for total per-cent dropping into the amount in storehouse.

(5) using the ssDNA after concentrated as pcr template, adopt primers F and primer R to carry out asymmetric PCR, obtain PCR primer.

PCR reaction system: 1 μ L0.02 μM template, 1 μ L0.2 μM primers F, 1 μ L20 μM primer R, 1.6 μ L2.5mMdNTP, 2 μ L10 × buffer, 0.1 μ L5unit/ μ LExTaq enzyme, 1.6 μ L25mMMg ²⁺, add deionized water to 20 μ L.

PCR reaction conditions: 95 DEG C of sex change 5min; 95 DEG C of sex change 30s, 57 DEG C of annealing 30s, 72 DEG C extend 30s (40 circulations); Last 72 DEG C extend 5min.

Get 5 μ LPCR products to identify for 4% agarose gel electrophoresis, if band is correct, this product will be used as the ssDNA library of next round screening.Last taken turns and screen the ssDNA that obtains after pcr amplification, product full dose is splined on 2% agarose, cuts object band, adopts plain agar sugar gel DNA to reclaim test kit and reclaims ssDNA.

4, choning and sequencing

Take turns screening through 9, PCR primer is connected to cloning vector pMD18-T, order-checking, obtains 4 aptamers, respectively called after SA04, SA06, SA07 and SA41.The nucleotide sequence of aptamer is as follows:

Aptamer SA04:5 '-GGCGACTAGAATCACGAATAAGTTGATTCCGACTGTATTTGAAGGGTAGCGGTAGG GAAA-3 ' (in sequence table sequence 1);

Aptamer SA06:5 '-GGGCAGTCGTCGATAACAGTAGACGCTTGTCAGTCCTACTGGAATTAATGTTTTGT TCTC-3 ' (in sequence table sequence 2);

Aptamer SA07:5 '-TTAGCTTATGCGTTGGCCGGGATAAGGATCCAGCCGTTGTAGATTTGCGTTCTAAC TCTC-3 ' (in sequence table sequence 3);

Aptamer SA41:5 '-TGTGTGATACGACATCCATTCCAGTTTCCGTCGGCAGCGATGTTAACTCACGTATC CTGA-3 ' (in sequence table sequence 4).

The homology of 4 aptamers 5, utilizing Lasergene software analysis to obtain, and utilize network tool Mfold (http://mfold.rna.albany.edu/? q=mfold/DNA-Folding-Form) carry out secondary structure prediction, result as shown in Figure 1.

Embodiment 2, ultrafiltration process measure the dissociation constant of aptamer

Adopt ultrafiltration process simulation reaction equilibrium process, measure the dissociation constant (Kd) of every bar aptamer SA04, SA06, SA07 and SA41 that embodiment 1 obtains.Concrete steps are as follows:

1, respectively aptamer SA04, SA06, SA07 and SA41 being diluted to concentration with binding buffer liquid is 3 μMs, 1.6 μMs, 0.8 μM, 0.4 μM, 0.2 μM, 0.1 μM and 0.05 μM.

2,95 DEG C of sex change 6min, then be placed in rapidly 10min on ice, then room temperature leaves standstill 5min.

3, each 100 μ L of aptamer getting above-mentioned each concentration add to isopyknic 20 μMs of sulfamethazine solution (solvent is binding buffer liquid), hatch 30min for 25 DEG C.

4, reaction solution full dose is added to Ultra-0.5Centrifugalfilter (10KD), the centrifugal 5min of 12000rpm.100 μ L reaction solutions are filtered across.Unconjugated aptamer, unconjugated sulfamethazine and sulfamethazine-aptamer mixture is included in the liquid be not filtered across; Only containing unconjugated sulfamethazine in the liquid filtered.

5, the content of sulfamethazine in high effective liquid chromatography for measuring filtrate is set up.

Dilution sulfamethazine standard working solution to 0 μM, 0.5 μM, 1 μM, 2 μMs, 5 μMs, 10 μMs, set up the typical curve of sulfamethazine.HPLC condition is: chromatographic column: XBriageShieldRP18 (4.6 × 250mm, 5 μm); Moving phase: water: acetonitrile: Glacial acetic acid=76:24:0.05; Determined wavelength 265nm; Flow velocity 1mL/min; Column temperature 30 DEG C, sampling volume 50 μ L.

The concentration of sulfamethazine is substituted into formula Y=[(2000-100 × X)/100-X]/10, tries to achieve the combination rate of sulfamethazine.Wherein Y is the combination rate of sulfamethazine, and X is the concentration of sulfamethazine in filtered solution.

Bring the combination rate of sulfamethazine and the concentration of aptamer into formula Y=BmaxX/ (Kd+X), carry out nonlinear fitting, finally obtain the value of dissociation constant Kd.Wherein Y is the combination rate of sulphamethazine, and Bmax is the Bmax of sulfamethazine, and X is the concentration of aptamer.By measuring the dissociation constant (Kd) of sulfamethazine aptamer, pass judgment on the avidity height of every bar aptamer.

Result is as shown in Figure 2: the dissociation constant of SA07 is minimum, is 79nM; Next is SA41, and the value of its dissociation constant is 122nM; The dissociation constant of SA04 and SA06 is slightly high, is respectively 203nM and 274nM.Because dissociation constant is lower, avidity is higher, therefore selects aptamer SA07 and SA41 to carry out next step specificity research.

Embodiment 3, competition law measure the specificity of aptamer

1, sulfamethazine (SM is got ₂), Sulphamerazine (SMR) and Sulphadiazine Sodium (SDZ) standard reserving solution, be diluted to final concentration with binding buffer liquid and be 4 μMs.

2, getting 5 μ g aptamer SA07 and SA41 is respectively dissolved in the binding buffer liquid of 100 μ L not drug containing, 95 DEG C of sex change 6min, then is placed in rapidly 10min on ice, and then room temperature leaves standstill 5min.

3, sulfamethazine, Sulphamerazine and Sulphadiazine Sodium that 100 μ L steps 1 are prepared are joined respectively the aptamer solution that step 2 is prepared, obtain Incubating Solution respectively, hatch 30min for 25 DEG C.Unconjugated aptamer, unconjugated medicine and medicine-aptamer mixture is included in Incubating Solution.

4, Incubating Solution full dose is added to 7 × 10 ⁷the magnetic bead of individual sulfamethazine bag quilt, hatches 30min for 25 DEG C.Finally take out the supernatant after hatching, measure the concentration of the ssDNA in supernatant with NanoDrop.

Control group selects initial libraries to replace aptamer to test, and other steps are consistent with above-mentioned.

As numerical value > 0, represent that aptamer can identify the medicine in supernatant, and value is higher, the ability in conjunction with this medicine is stronger; As numerical value ≈ 0, represent the medicine in aptamer nonrecognition supernatant, aptamer therefore can not be suppressed to be combined with the magnetic bead of sulfamethazine bag quilt.Meanwhile, acquired results is carried out T inspection, in order to check the accuracy of experimental result.

Result is as shown in Figure 3: the random library of control group (Control) to these three kinds of medicines all without combination, and the specificity of aptamer SA07 and SA41 is all very high, to analog (Sulphamerazine and Sulphadiazine Sodium) all without combination, result is carried out T inspection, find aptamer SA07 and the SA41 significant difference (P < 0.05) for the ratio of sulfamethazine and the ratio of other two kinds of medicines, further demonstrate the accuracy of this result.Compared with aptamer SA41, the specificity of aptamer SA07 is better, therefore selects aptamer SA07 to carry out the research of next step detection method.

Embodiment 4, the specific detection of direct competitive chemical luminescence detection method of sulphamethazine set up based on aptamer and application thereof

With the aptamer (biotin-SA07) of 3 ' end mark vitamin H for identification facility, rely on Streptavidin-biotin system, with the concentration of sulfamethazine in direct competitive pattern working sample.Concrete steps are as follows:

One, based on the direct competitive chemical luminescence detection method of the sulphamethazine of aptamer foundation

1, sulfamethazine-spacerarm-HRP (SM ₂-GA-HRP) preparation

(1) 1.405g sulfamethazine, 2.86g Pyroglutaric acid (Aladdin company, G111073) are mixed with 15mL pyridine, stirring at room temperature 2h, synthesis sulfamethazine-spacerarm (SM ₂-GA);

(2) by 3mg sulfamethazine-spacerarm (SM ₂-GA), 3.1mgEDCHCl, 1.84mgNHS and 0.5mLDMF mixing, the horseradish peroxidase (HRP) (Beijing Wei De Vicon Co., Ltd.) of 30mg is added after stirring at room temperature 2h, 4 DEG C of reactions are spent the night, synthesis sulfamethazine-spacerarm-HRP (SM ₂-GA-HRP).

2, the direct competitive chemical luminescence detection method of sulphamethazine

(1) get 25 μ Lbiotin-SA07 (solvent is binding buffer liquid, and concentration is 80nM), first 95 DEG C of heating 6min, make its sex change, and are placed in rapidly and place 10min on ice, and last room temperature places 5min, obtains pretreated biotin-SA07.

(2) by the pretreated biotin-SA07 of 25 μ L and 25 μ LSM ₂(binding buffer liquid dilutes-GA-HRP, extent of dilution is 1:800) mixing, and add sulfamethazine standard solution (the binding buffer liquid dilution of series concentration, concentration is respectively 0.1ng/mL, 0.4ng/mL, 1.1ng/mL, 3.3ng/mL, 9.9ng/mL, 29.6ng/mL, 88.9ng/mL, 266.7ng/mL and 800ng/mL), slight mixing, hatches 30min for 25 DEG C.

(3) respectively Incubating Solution full dose is added 96 orifice plates of Streptavidin bag quilt, 25 DEG C of standing 30min, pour out liquid in hole, 5 times are washed with binding buffer liquid, pat dry, every hole adds luminous substrate (A liquid: B liquid=1:1, v/v) (Thermo company) 50 μ L, luminous intensity (Relativelightunit, RLU) is measured after placing for some time.

The sulfamethazine standard substance of different concns are first calculated to biotin-SA07 and SM according to luminous intensity ₂the inhibiting rate (Inhibitionrate) of-GA-HRP, its accounting equation is: Inhibitionrate=1-(RLU _{sample product}– RLU _blank)/(RLU _contrast– RLU _blank).Wherein, RLU _samplefor sulphamethazine standard substance or values of chemiluminescence corresponding to sample treatment liquid; RLU _contrastfor only adding values of chemiluminescence corresponding to enzyme mark solution; RLU _blankrefer to the average relative values of chemiluminescence not adding sulphamethazine standard substance and enzyme mark solution gained.

By origin8.0 software, take inhibiting rate as ordinate zou, with the logarithm of sulphamethazine standard concentration for X-coordinate, set up quadruplex parameters matching competition curve.Detectability LOD (the IC of this detection method is drawn according to the matching competition curve set up ₁₀) be 0.92ng/mL, linearity range (IC ₂₀~ IC ₈₀) be 1.85-21.57ng/mL.

Two, based on the specific detection of the direct competitive chemical luminescence detection method of the sulphamethazine of aptamer foundation

1, get 25 μ Lbiotin-SA07, first 95 DEG C of heating 6min, make its sex change, and are placed in rapidly and place 10min on ice, and last room temperature places 5min, obtains pretreated biotin-SA07.

2, by the sulfamethazine solution (SM of the pretreated biotin-SA07 of 25 μ L and 25 μ LSM2-GA-HRP respectively with 50 μ L ₂), Sulphamerazine solution (SMR), sulfaphenazole solution (SPA), Sulfafurazole solution (SIZ), sulfametoxydiazine solution (SMD), sulfapyridine solution (SPY), sulfamonomethoxine solution (SMM), sulfaquinoxaline solution (SQX), Sulphadiazine Sodium solution (SDZ), sulfamethoxazole solution (SMZ), sulfadimethoxine solution (SDM), methoxy pyridazine solution (SMP) between sulfanilamide (SN), Sulfamethylthiazole solution (ST), White streptocide solution (SHZ), sulfacetamide solution (SBZM), Sulphadoxine solution (SAA), sulfanitran solution (SAN), sulfasalazine solution (SPH), Sulfamethoxazole solution (SMX), sulfamethylthiadiazole solution (SMT), sulfoamido uracil solution (SAU), Sulfabenzide solution (SBA), Sulfisomidine solution (SIM), Sulphaguanidine solution (SG), phthalylsulfathiazole solution (PST), sulfaethoxypyridazine solution (SEP), the slightly mixing (it is 1.5 μ g/mL that above-mentioned sulphamethazine and its homologue solution are all diluted to concentration with binding buffer liquid) of sulfabrom solution (SBM) and Sulfametopyrazine solution (SLE), hatches 30min for 25 DEG C.

(3) Incubating Solution full dose is added 96 orifice plates of Streptavidin bag quilt, 25 DEG C of standing 30min, pour out liquid in hole, 5 times are washed with binding buffer liquid, pat dry, every hole adds luminous substrate 50 μ L (A liquid: B liquid=1:1, v/v), luminous intensity (Relativelightunit, RLU) is measured after placing for some time.

Result is as shown in Figure 4: the cross reacting rate of the homologue solution of 27 kinds of sulphamethazines is all lower, and (cross reacting rate of SPY, SMM, SMR, SPA, SMZ, SMP, SBZM, SIZ, SMD is 6.41 ~ 6.86%, the cross reacting rate of SQZ, SDZ, ST, SHZ, SAA, SAN, SMX, SMT, SAU, SBA, SIM, SG, SLE is 7.09 ~ 7.78%, the cross reacting rate of SPH, PST, SEP, SBM is 8.24 ~ 8.92%, the cross reacting rate of SDM is 9.84%), and the cross reacting rate of sulfadimidine solution reaches 100%.Illustrate that the method can be used for specific detection sulphamethazine.

Three, the application of the direct competitive chemical luminescence detection method of sulphamethazine

Sulphamethazine is added into blank milk, add concentration and be respectively 25ng/mL, 50ng/mL, 100ng/mL and 200ng/mL, obtain the milk containing 25ng/mL sulphamethazine, the milk containing 50ng/mL sulphamethazine, the milk containing 100ng/mL sulphamethazine and containing the milk of 200ng/mL sulphamethazine respectively, each concentration arrange 5 parallel.Milk sample pre-treating process: get 0.5mL skimmed milk, the centrifugal 20min of 14000rpm/min, takes out supernatant, dilutes 10 times with binding buffer liquid.

Respectively the milk of the above-mentioned sulphamethazine containing different concns is detected with the direct competitive chemoluminescence method of step one, and pass through formula: the rate of recovery (%)=measured value/add value × 100%, calculates the rate of recovery.Process three days continuously according to the method described above, calculate the variation coefficient of the in a few days and in the daytime rate of recovery.

Result shows: the detected value of the sulphamethazine concentration in the milk containing 25ng/mL sulphamethazine is 22.9 ± 4.0ng/mL, and the rate of recovery is 91.6, and in a few days the variation coefficient is 12.4-23.4%, and the variation coefficient is 16.0% in the daytime; The detected value of the sulphamethazine concentration in the milk containing 50ng/mL sulphamethazine is 49.1 ± 8.9ng/mL, and the rate of recovery is 98.2, and in a few days the variation coefficient is 12.4-23.4%, and the variation coefficient is 17.8% in the daytime; The detected value of the sulphamethazine concentration in the milk containing 100ng/mL sulphamethazine is 91.1 ± 17.0ng/mL, and the rate of recovery is 91.1%, and in a few days the variation coefficient is 15.9-23.3%, and the variation coefficient is 17.0% in the daytime; The detected value of the sulphamethazine concentration in the milk containing 200ng/mL sulphamethazine is 176.0 ± 29.7ng/mL, and the rate of recovery is 88.0%, and in a few days the variation coefficient is 10.0-19.7%, and the variation coefficient is 14.9% in the daytime.Illustrate that method provided by the invention can be used for detecting the residual of sulphamethazine in milk.

Claims (7)

1. an aptamer is the arbitrary shown single strand dna in following (1)-(4):

(1) single strand dna as shown in sequence in sequence table 3;

(2) single strand dna as shown in sequence in sequence table 1;

(3) single strand dna as shown in sequence in sequence table 2;

(4) single strand dna as shown in sequence in sequence table 4.

2. a derivative for aptamer, for following (1)-(8) any one:

(1) with the nucleotide sequence of aptamer according to claim 1, there is more than 60% or 60% identity, and there is with described aptamer the derivative of the aptamer of identical function;

(2) hybridize with the nucleotide sequence of aptamer according to claim 1, and there is with described aptamer the derivative of the aptamer of identical function;

(3) RNA molecule of being transcribed by the nucleotide sequence of aptamer according to claim 1, and the derivative with described aptamer with the aptamer of identical function;

(4) peptide nucleic acid(PNA) of being encoded by aptamer according to claim 1, obtains the derivative of the aptamer with described aptamer with identical function;

(5) aptamer according to claim 1 is lacked, replaces or increase one or several Nucleotide, obtain the derivative of the aptamer with described aptamer with identical function;

(6) aptamer according to claim 1 is carried out Nucleotide replacement or modification, obtain the derivative of the aptamer with described aptamer with identical function;

(7) transform the skeleton of aptamer according to claim 1 as phosphorothioate ester skeleton, obtain the derivative of the aptamer with described aptamer with identical function;

(8) by one end of aptamer according to claim 1 or middle connection signal molecule and/or bioactive molecule and/or functional group, the derivative of the aptamer with described aptamer with identical function is obtained.

3. derivative according to claim 2, is characterized in that: being modified to phosphorylation, amination, methylating in described (6), sulfhydrylation or isotopologue;

Functional group in described (8) is vitamin H, fluorescent substance, radioactive substance, nano material, albumen or enzyme labelling.

4., for identifying a test kit for sulphamethazine, this test kit comprises the derivative of the aptamer described in the aptamer shown in claim 1 or Claims 2 or 3.

5. test kit according to claim 4, is characterized in that: described test kit also comprises sulfamethazine-spacerarm-HRP.

6. the derivative of aptamer according to claim 1 or the aptamer described in Claims 2 or 3 or the test kit described in claim 4 or 5 application in following (1)-(6) in any one:

(1) identification or aid identification sulphamethazine;

(2) product of preparation identification or aid identification sulphamethazine;

(3) detect or whether contain sulphamethazine in auxiliary detection testing sample;

(4) detect or auxiliary detection testing sample in sulphamethazine concentration;

(5) separation or auxiliary separating are from sulphamethazine;

(6) enrichment or auxiliary enrichment sulphamethazine.

7. application according to claim 6, is characterized in that: described testing sample is milk.