KR101263450B1 - DNA aptamer binding to kanamycin with specificity - Google Patents

Abstract

The present invention relates to a DNA aptamer that specifically binds to kanamycin, and more particularly to a DNA aptamer that specifically binds to kanamycin selected from a random ssDNA library and its use. DNA aptamers that specifically bind to kanamycin according to the present invention were selected from a random ssDNA library using SELEX (Systematic Evolution of Ligands by Exponential enrichment) technology using affinity chromatography, and selected DNA aptamers. The sequencing, characteristics and binding capacity of these were analyzed. Therefore, the DNA aptamer of the present invention can be usefully used for effectively detecting kanamycin.

Description

DNA aptamer binding to kanamycin with specificity

The present invention relates to antibiotic detection aptamers, and more particularly to DNA aptamers that specifically bind to kanamycin.

Antibiotics have been widely used to kill or inhibit microorganisms. However, the abuse of antibiotics has caused a variety of side effects in humans, leading to the emergence of antibiotic-resistant superbacteria. Therefore, the proper use of the appropriate amount of antibiotics is of great importance and it should be checked whether the food contains residues of antibiotics exceeding the Maximum Residue Limits (MRL) before distribution or sale on the market. Since the excess of antibiotic residue in food creates serious problems, a more reliable, accurate and easy detection system is required.

Kanamycin is an aminoglycoside antibiotic that is used to treat a variety of infections. Kanamycin interacts with the 30S subunit of prokaryotic ribosomes to induce mistranslation and prevent translocation. However, when ingested through food or over-the-counter medicines and abused in humans, kanamycin has serious side effects, including hearing loss and toxins in the kidneys.

Aptamers are single-stranded DNA (ssDNA) or RNA that have high specificity and affinity for specific targets. Aptamers are superior in cost to detection materials used in the field of sensors because of their high affinity for their targets, their excellent thermal stability and their ability to be synthesized in vitro . In addition, there is no restriction in the target material, aptamers for various targets such as proteins, biomolecules such as amino acids, small organic chemicals such as environmental hormones or antibiotics, and bacteria can be synthesized. Due to the properties of aptamers that specifically bind to target materials, a lot of research has recently been conducted to use aptamers in new drug development, drug delivery systems, and biosense.

Among the various sensing materials used in the existing biosense field, the superiority in sensitivity is the detection of the target material using the antibody. The first problem is that the injection of the target substance (antigen) to be detected into the body of the animal to secure the antibody made through the immune system of the living body and then undergo a purification process is time-consuming and expensive. In addition, the target material that can be used as an antigen is limited compared to the aptamer which has little restrictions on the target material, which makes it difficult to prepare antibodies to low molecular weight compounds such as toxic substances. In general, since antibodies are very large proteins having a size of 150 KDa or more, there are limitations in signal detection when applied to biosensors such as electrochemicals, and thermal stability is significantly lower than that of DNA or other chemicals. . Therefore, the existing technology using antibodies in the diagnosis of blood biomarkers is not cost and time efficient, the range of application is limited, there are limited problems in the application as a biosensor. As a new sensing material for improving these problems, a lot of researches using aptamers that show high affinity and safety specifically for various target materials and are easier to chemically synthesize and change than antibodies. In addition, since the Systematic Evolution of Ligands by EXponential enrichment (SELEX) was developed in 1990 by the Gold's and Ellington's groups, large macromolecules, such as proteins, have been the main experimental targets, but affinity chromatography, capillary Advances in evolved SELEX technology using capillary electrophoresis and magnetic beads have made it possible to diversify target molecules, including small molecules, such as hormones or organic molecules, which are small in size, making antibodies difficult to make. . Therefore, a lot of research is being conducted to select aptamers for small molecules and use them in various fields.

Accordingly, the present inventors have tried to develop a new aptamer for kanamycin, and as a result, a DNA aptamer showing high affinity for kanamycin from a chemically synthesized ssDNA library using SELEX (Systematic Evolution of Ligands by Exponential enrichment) technology The invention was completed by establishing the sequence and structure of the DNA aptamers.

It is an object of the present invention to provide a novel DNA aptamer specifically binding to kanamycin (kanamycin), a preparation method thereof, and a composition and kit for detecting kanamycin using the DNA aptamer.

In order to achieve the above object, the present invention provides a DNA aptamer (aptamer) that specifically binds to kanamycin (kanamycin), characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.

In addition,

1) fixing kanamycin to beads;

2) inducing binding by reacting the kanamycin-fixed beads with an ssDNA library having 30-50 arbitrary bases in the center with a primer region for PCR preserved in the sock end;

3) isolating ssDNA bound to the bead immobilized with kanamycin;

4) separating ssDNA from ssDNA bound to the isolated kanamycin immobilized beads; And

5) amplifying the ssDNA specifically binding to kanamycin by performing PCR using a primer pair complementary to the PCR primer region,

It provides a method for producing a DNA aptamer that specifically binds to kanamycin.

In another aspect, the present invention provides a composition for detecting kanamycin comprising a DNA aptamer specifically binding to kanamycin, characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.

In addition, the present invention provides a kit for detecting kanamycin comprising a DNA aptamer specifically binding to kanamycin, which has a nucleotide sequence of any one of SEQ ID NOs: 1 to 13.

The present invention is to develop a DNA aptamer showing a specific high affinity for kanamycin (kanamycin) using a system of Evolution of Ligands by Exponential enrichment (SELEX) using affinity chromatography from a random ssDNA library It was. According to the present invention, the use of DNA aptamers that can specifically bind to kanamycin is expected to measure kanamycin more sensitively and accurately than the antibody-based assays used in the prior art. Since it is small and easy to immobilize on the surface, it is advantageous for producing a biosensor chip and can be effectively used for the development of a composition and kit for detecting trace amounts of kanamycin remaining in the human body, food, and water and sewage source.

1 is a diagram schematically illustrating a process of performing SELEX using affinity chromatography.
Figure 2 is a diagram showing the results of performing the 12.5% urea (PAGE) analysis to identify the ssDNA screened after the screening process.
3 is a graph showing the binding force of the aptamers selected at each step in the repeated screening process.
FIG. 4 is a diagram showing DNA aptamers selected through SELEX separated by nucleotide sequence and structural similarity.
Figure 5 is a graph showing the degree of binding to kanamycin (kanamycin) using a fluorescent labeled aptamer.

Hereinafter, the present invention will be described in detail.

The present invention provides a DNA aptamer that specifically binds to kanamycin, which has a nucleotide sequence of any one of SEQ ID NOs: 1 to 13.

The DNA aptamer is more preferably one having a nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6, but is not limited thereto.

The DNA aptamer is preferably prepared in the following steps, but is not limited thereto.

1) immobilizing kanamycin on the beads;

2) inducing binding by reacting kanamycin-fixed beads and an ssDNA library having 30-50 arbitrary bases in the center with a primer region for PCR preserved in the sock end;

3) isolating ssDNA bound to the bead immobilized with kanamycin;

4) separating ssDNA from ssDNA bound to the isolated kanamycin immobilized beads; And

5) Amplifying the ssDNA that specifically binds to kanamycin by performing PCR using a primer pair complementary to the PCR primer region.

In the above method, the beads of step 1) are preferably sepharose beads or magnetic beads, but are not limited thereto.

In the above method, the primer region for PCR in step 2) is preferably SEQ ID NO: 14 and SEQ ID NO: 15, but is not limited thereto.

In the above method, the steps 3) to 5) are preferably performed by additionally repeating 5 to 15 times, and more preferably 8 to 13 times, but not limited thereto.

In order to select DNA aptamers that specifically bind to kanamycin, the inventors used SELEX (Systematic Evolution of Ligands by Exponential) using affinity chromatography on the antibiotic kanamycin from a chemically synthesized ssDNA library. Aptamer candidate ssDNA was selected using the enrichment technique (see FIGS. 1 to 3).

In addition, after analyzing the sequencing and structure from the selected aptamer candidate ssDNA, the inventors selected DNA aptamers that specifically bind to kanamycin with sequence and structural similarity (see FIG. 4 and Table 1).

In addition, the inventors of the present invention, in order to confirm the binding degree of each DNA aptamer, by analyzing the binding force using the magnetic bead immobilized with antibiotics and DNA aptamer immobilized with FAM fluorescent material, SEQ ID NO: 2, SEQ ID NO: 4 And it was confirmed that the binding degree of the DNA aptamer having the nucleotide sequence of SEQ ID NO: 6 is significantly high (see Figure 5).

Therefore, the DNA aptamer of the present invention was selected from the chemically synthesized ssDNA library using the SELEX technology to select DNA aptamers that specifically bind to the antibiotic kanamycin, and sequence, properties and binding capacity of the selected DNA aptamers By analyzing the DNA aptamer specifically binding to kanamycin having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13 was identified.

In another aspect, the present invention provides a composition for detecting kanamycin comprising a DNA aptamer specifically binding to kanamycin, characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.

The DNA aptamer is more preferably one having a nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6, but is not limited thereto.

The DNA aptamer of the present invention was selected from the chemically synthesized ssDNA library using the SELEX technology to select a DNA aptamer specifically binding to the antibiotic kanamycin, and analyzed the sequencing, properties and binding capacity of the selected DNA aptamer Through the DNA aptamer specifically binding to kanamycin having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13 was confirmed, can be usefully used as a composition for detecting or removing kanamycin comprising the same.

 In another aspect, the present invention provides a kit for detecting kanamycin comprising a DNA aptamer specifically binding to kanamycin, characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.

The DNA aptamer is more preferably one having a nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6, but is not limited thereto.

DNA aptamer of the present invention was selected from the chemically synthesized ssDNA library using the SELEX technology to select a DNA aptamer specifically binding to the antibiotic kanamycin, and analyzed the sequence, properties and binding capacity of the selected DNA aptamer Through, since the DNA aptamer specifically binding to kanamycin having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13 was confirmed, it can be usefully used as a kit for detecting kanamycin.

The kit of the present invention may include a buffer solution and containers for performing and analyzing the detection, if necessary, such as a bottle, a tub, a small sachet, an envelope, a tube or an ampoule. And the like, and they may be formed, in part or in whole, from plastic, glass, paper, foil or wax, and the like. The container may be equipped with a fully or partially separable stopper that may initially be part of the container or attached to the container by mechanical, adhesive or other means. The container may also be equipped with a stopper to access the contents by a needle. The kit may include an external package, and the external package may include instructions for use of the components.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

< Example  1> ssDNA ( single strand DNA ) Library Preparation

Synthetic ssDNA library [5'-CACCTAATACGACTCACTATAGCGGATCCGA (SEQ ID NO: 14) -N40-CTGGCTCGAACAAGCTTGC (SEQ ID NO: 14) having a binding sequence of conserved primers for PCR amplification and cloning at both ends and comprising a sequence of 40 random nucleotides in the middle) : 15) -3 ']. In addition, forward primer [5'-CACCTAATACGACTCACTATAGCGGA-3 '(SEQ ID NO: 16)], reverse primer [5'-GCAAGCTTGTTCGAGCCAG-3' (SEQ ID NO: 17) for PCR amplification and ssDNA generation. )] And biotin-bound reverse primer [5'-Biotin-GCAAGCTTGTTCGAGCCAG-3 '(SEQ ID NO: 18)] was used, and FAM-labeled forward primer [5'-FAM-CACCTAATACGACTCACTATAGCGGA-3' for binding analysis (SEQ ID NO: 19)]. In addition, all oligonucleotides were synthesized and PAGE-purified by Bionics (Korea).

< Example  2> Kanamycin ( Kanamycin ) Fixed Bead  Produce

Kanamycin (Generay Biotech, et al. Canada) was fixed to the beads.

Specifically, Sepharose beads activated with 2 g of CNBr were expanded in 100 mL of 1 mM HCl. The expanded Sepharose beads and 400 mg of kanamycin were mixed in a coupling buffer (0.1 M NaHCO ₃ , 0.5 M NaCl, pH 9.0) and then incubated at room temperature for 4 hours. After washing three times with coupling buffer, the coupled Sepharose beads were incubated in blocking buffer (1 M Tris-Base, 0.1 M NaHCO ₃ , 0.5 M NaCl, pH 9.0) for 2 hours at room temperature. It was. Washing steps with low pH Washing buffer (0.1 M acetic acid, 0.5 M NaCl, pH 4.0) and coupling buffer were performed twice in succession. Separose beads immobilized with kanamycin are resuspended in 5 mL of binding buffer (20 mM Tris-HCl, 50 mM NaCl, 5 mM KCl, 5 mM MgCl ₂ , pH 8.0) and positive affinity. Loaded on the column. In addition, CNBr-Sepharose beads without kanamycin as negative affinity columns were prepared for negative selection.

< Example  3> To kanamycin  Specific Aptamer  Selection

Affinity chromatography was performed to select aptamers specific for kanamycin (FIG. 1).

Specifically, to remove ssDNA that non-specifically binds to Sepharose beads, the ssDNA library (500 pmole) dissolved in 100 mL of binding buffer (500 pmole) for 3 minutes at 85 ℃, then 4 Pre-incubated for 1 hour at < RTI ID = 0.0 > The pre-cultured solution containing the ssDNA library was then loaded into a column filled with Sepharose beads, a negative affinity column. At this time, only the ssDNA library passing through without binding to the negative affinity was taken, and then loaded on a column filled with sepharose beads immobilized with kanamycin, and incubated at room temperature for 1 hour. Then, the column was washed twice with washing buffer (20 mM Tris-HCl, 50 mM NaCl, 5 mM KCl, 5 mM MgCl ₂ , 0.01% tween 20, pH 8.0), followed by elution buffer ( 20 mM Tris-HCl, 50 mM NaCl, 5 mM KCl, 5 mM MgCl ₂ , pH 8.0, 10 mM kanamycin). The eluted ssDNA was precipitated with ethanol, dissolved in 100 μl of distilled water, and then pfu - polymerase ( pfu- polymerase) using the forward primer and biotin-bound reverse primer of <Example 1> ( Amplification by PCR using Intron Biotechnology, Korea). In order to generate ssDNA for the next screening process, the biotin-coupled PCR product was incubated with magnetic beads coated with streptavidin. The selected ssDNA was collected using an external magnet under basic conditions. The selected ssDNA library was identified using 12.5% urea PAGE assay. In addition, after the first selection, the selected ssDNA was used for the next selection, and this selection was repeated. At this time, the amount of ssDNA and the incubation time of ssDNA in the beads immobilized with kanamycin were further reduced for strict screening. The screening process was performed by checking the kanamycin binding level of the remaining ssDNA.

As a result, as shown in FIG. 3, the binding force (%) was calculated through the following <Equation 1> for each stage of the screening process, and the binding force for each stage was confirmed until the eighth screening process (FIG. 3).

< Example  4> Cloning  And sequencing

The 9th repeated selected ssDNA was amplified by PCR using unmodified forward and reverse primers, cloned into a pENTR / TOPO vector (TOPO TA Cloning kit, Invitrogen, USA), and the vector was then transferred to Escherichia. coli ( E. coli ) TOP10 cells (Invitrogen, USA) were transformed. Clones into which ssDNA was inserted were purified using a miniprep kit (GeneAll, Korea), and then sequenced (COSMO Genetech, Korea). As a result of the sequencing analysis, as shown in Table 1, the nucleotide sequence of DNA specifically binding to kanamycin with high affinity was confirmed.

SEQ ID NO: Base sequence SEQ ID NO: 1   TGTCCAAGTGGTCTTGAGGTTATAAGCGGCGGCCGATCA SEQ ID NO: 2   AGATGGGGGTTGAGGCTAAGCCGACCGTAAGTTGGGCCGT SEQ ID NO: 3   CTGTAGGGTTGGCAGGGGCTTAAGCCTTCGTGGTCGGGTA SEQ ID NO: 4   CGAGATGGAGTACGTGATTTGGAGGTCGAAGTACTTGGGG SEQ ID NO: 5   TGCAGTGGTCTAGTCCCTTATGGTACTTTGAAGGGTTGTTA SEQ ID NO: 6   AGCGCCGAGCGTGCGGGATCTAGGGGGGAGGATAGGGTTG SEQ ID NO: 7   GTTACTAAAAAAGTTCAGGTGCGGCAATAGCACTCGAAGA SEQ ID NO: 8   ACGTTGTGGCAGTGAGTGCAGGCATGGCGCGACCACTTGA SEQ ID NO: 9   GTTGATAGATATAGAAGCTCCTCGGCCGTCAGCGCTTGGA  SEQ ID NO: 10   GAGATGGGAGGGGTGATTTCCTGTTGCCATCTGGGACAGC  SEQ ID NO: 11   TGGTAATCGAAGTAAAGAAGGCTTGAGGGGTGTATGCGCC  SEQ ID NO: 12   ACTATTAAGAAGTTGCGTTGGAAGGCACGAATTCGCCGCG  SEQ ID NO: 13   CATGTGCTGTGTCGACCTGGCGGTTGAACTGAGCGGTGGT

In addition, to analyze the structural similarity of the selected ssDNA, the secondary structure was investigated using the Mfold program ( http://mfold.bioinfo.rpi.edu/cgi-bin/dna-form1.cgi ).

As a result, as shown in FIG. 4, the DNA aptamer having the structure of the stem-loop including the nucleotide sequence of 'T-GG-A' could be analyzed, and the length of the loop and the position of '-GG-' And according to the length of the stem was divided into five groups (Fig. 4).

< Example  5> ssDNA Force of adhesion

In order to confirm the binding capacity of the selected ssDNA to kanamycin, it was analyzed using fluorescence measurement.

Specifically, 5 mg of kanamycin is mixed with 30 mg of magnetic beads (megnetic bead), followed by gentle stirring in 1 mL of coupling buffer (0.1 M borate, 0.67 M (NH ₄ ) ₂ SO ₄ , pH 9.5) 37 After incubation for 20 hours at 1 ° C., 1 mL of blocking buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ , 1.4 mM KH) was used to stop the reaction of tosyl groups on the surface of the magnetic beads remaining without reacting with kanamycin. Kanamycin was immobilized on Tosyl-activated magnetic beads (Invitrogen, USA) by incubating at 37 ° C. for 1 hour in ₂ PO ₄ , 0.05% tween 20, pH 7.4). The kanamycin-fixed magnetic beads were washed _twice with 1 mL of washing buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ , 1.4 mM KH ₂ PO ₄ , 0.01% tween 20, pH 7.4). , 0.6 mg of the kanamycin-fixed magnetic beads were incubated with FAM-labeled ssDNA aptamer for 1 hour at room temperature with gentle stirring in a 100 mL binding buffer, and unbound aptamers were removed by washing. The amount of FAM-labeled ssDNA aptamer bound to kanamycin-fixed magnetic beads was measured by fluorescence measurement (1420 Victor multilabel counter, PerkinElmer, USA) by separating only ssDNA labeled kanamycin-bound FAM using a magnet. .

As a result, as shown in FIG. 5, the degree of binding of the DNA aptamers having the nucleotide sequences of SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 6 was compared. Was found to be significantly high (FIG. 5).

Attach an electronic file to a sequence list

Claims (7)

DNA aptamer (aptamer) that specifically binds to kanamycin, characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.
1) fixing kanamycin to beads;
2) inducing binding by reacting the kanamycin-fixed beads with an ssDNA library having 30-50 arbitrary bases in the center with a primer region for PCR preserved in the sock end;
3) separating ssDNA bound to beads immobilized with kanamycin;
4) separating ssDNA from ssDNA bound to the isolated kanamycin immobilized beads; And
5) amplifying the ssDNA specifically binding to kanamycin by performing PCR using a primer pair complementary to the PCR primer region,
Method for producing a DNA aptamer specifically binding to kanamycin of claim 1 comprising a.
The method of claim 2, wherein the bead is a sepharose bead (sepharose bead) or magnetic bead (magnetic bead) characterized in that the method for producing a DNA aptamer specifically binding to kanamycin.
The kanamycin of claim 2, wherein the primer region for PCR in step 2) has a nucleotide sequence of SEQ ID NO: 14 at the 5 'end and a nucleotide sequence of SEQ ID NO: 15 at the 3' end. Method for producing DNA aptamers that specifically bind.
The method of claim 2, wherein the method of specifically binding to kanamycin comprising the step of performing the steps 2) to 5) additionally repeated eight or more times.
A kanamycin detection composition comprising a DNA aptamer specifically binding to kanamycin, characterized by having the nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.
Kit for detecting kanamycin comprising a DNA aptamer specifically binding to kanamycin, characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.

Images