CN107164383B

CN107164383B - Creatine kinase isoenzyme nucleic acid aptamer and application thereof

Info

Publication number: CN107164383B
Application number: CN201610866941.2A
Authority: CN
Inventors: 吕雪飞; 冯薇; 邓玉林
Original assignee: Beijing Institute of Technology BIT
Current assignee: Beijing Institute of Technology BIT
Priority date: 2016-09-29
Filing date: 2016-09-29
Publication date: 2020-08-14
Anticipated expiration: 2036-09-29
Also published as: CN107164383A

Abstract

The invention relates to a group of creatine kinase isoenzyme nucleic acid aptamers and application thereof, belonging to the technical field of biology. The nucleotide sequence of the aptamer is selected from SEQ ID No. 1-SEQ ID No.10 in a nucleotide sequence table, and the aptamer has high binding specificity and high affinity with creatine kinase isozyme. The nucleic acid aptamer can be used for detecting, separating, purifying and immobilizing creatine kinase isoenzyme, is applied to preparation of a biosensor and analysis and detection of target substances, and is particularly suitable for preparing detection test paper in a creatine kinase isoenzyme rapid detection kit. The nucleic acid aptamer for detecting the creatine kinase isoenzyme has the advantages that antibodies do not have, such as the characteristics of in vitro screening, synthesis, easy modification, high stability and the like.

Description

Creatine kinase isoenzyme nucleic acid aptamer and application thereof

Technical Field

The invention relates to a group of creatine kinase isoenzyme nucleic acid aptamers and application thereof, in particular to a group of nucleic acid aptamers with high specificity and high affinity with creatine kinase isoenzyme prepared by using SELEX technology in molecular biology technology, namely systematic evolution index enrichment technology, and application thereof. Belongs to the field of biotechnology.

Background

Creatine Kinase isoenzyme (Creatine Kinase-MB) is a biomarker clinically used for diagnosing acute myocardial infarction. Creatine kinase isoenzyme enters blood at 4-6 hours of acute myocardial infarction, reaches a peak value at 24 hours, and recovers to a normal level after 48-72 hours. The rapid diagnosis in the early stage of the onset of the disease is beneficial to making a better treatment scheme and has better treatment effect.

At present, colloidal gold immunochromatographic test strips are mostly adopted for rapid detection. The colloidal gold immunochromatographic test strip takes colloidal gold as a developing medium, utilizes the principle that an antigen antibody in immunology can be specifically combined, and completes the reaction in the chromatographic process, thereby achieving the purpose of detection. The colloidal gold immunochromatography method is characterized in that specific antigen or antibody is fixed on a membrane in a strip shape, a colloidal gold labeled reagent (antibody or monoclonal antibody) is adsorbed on a binding pad, after a sample is dripped on a sample pad of a test strip of the colloidal gold immunochromatography, the sample moves forwards through capillary action, firstly passes through a colloidal gold-antibody conjugate on the binding pad, fully contacts with the conjugate and reacts correspondingly, the conjugate reaches an antigen fixing position through continuous forward movement and reacts with the antigen fixing position, the conjugate of an object to be detected and the gold labeled reagent is specifically bound with the conjugate and is left, and the red color of the colloidal gold can be observed through naked eyes.

The appearance of aptamers provides a new solution for the detection of biological indicators. The aptamer is a single-stranded DNA or RNA that specifically binds to the target molecule. The first findings were that Ellington and Tuerk published their findings in Nature and Science, respectively, in 1990. For a given target molecule, aptamers that specifically interact with a given target molecule can be selected from a library of specific oligonucleotides by exponential enrichment of ligand phylogenetic Evolution (SELEX). Since 1990, researchers have continually discovered new aptamers that bind to a range of molecules that encompasses proteins, cells, and a few small molecules.

The aptamer is used for the test strip, so that the advantages of the aptamer can be fully exerted, and compared with an antibody, the aptamer has the advantages of wider range of affinity action, lower cost, easiness in modification and more stable property. More importantly, aptamers do not simply perform the function of an antibody, and are used in detection methods that exploit their binding ability to target molecules for recognition. The use of aptamers also includes: signal conversion is achieved by means of the modified aptamers, fluidic control is performed by means of the cross-linking capacity of the aptamers, and signal amplification is performed by means of the amplification capacity of the aptamers.

So far, no aptamer having high affinity and specificity with creatine kinase isoenzyme and no rapid detection method of creatine kinase isoenzyme based on the aptamer have been reported.

Disclosure of Invention

In order to overcome the defects of the existing detection method, the invention aims to provide a group of creatine kinase isoenzyme nucleic acid aptamers, and the nucleic acid aptamers have high specificity and high affinity with creatine kinase isoenzyme.

The invention also aims to provide application of a group of creatine kinase isoenzyme aptamers, wherein the aptamers and creatine kinase isoenzyme combination has high specificity and high affinity, can be used for detecting, separating, purifying and immobilizing creatine kinase isoenzyme, and can be applied to preparation of biosensors and analysis and detection of target substances.

In order to achieve the purpose of the invention, the technical scheme is provided as follows.

The aptamer can be combined with creatine kinase isozyme protein, and the nucleotide sequence of the aptamer is selected from the nucleotide sequences shown by sequence identifiers 1-10 represented by a numerical identifier <210> in a nucleotide sequence table, namely SEQ ID Nos. 1-10 in the nucleotide sequence table.

Further, preferably, the nucleotide sequence of the aptamer is selected from the nucleotide sequences of sequence identifiers 6-10 represented by a numerical identifier <210> in a nucleotide sequence table, namely, SEQ ID No. 6-SEQ ID No.10 in the nucleotide sequence table. The nucleotide sequences shown by SEQ ID No.6 to SEQ ID No.10 in the nucleotide sequence table are obtained by respectively and preferably selecting partial bases in each of the nucleotide sequences shown by SEQ ID No.1 to SEQ ID No.5 in the nucleotide sequence table, the affinity to creatine kinase isozyme is kept, but the cost is only one eighth of that of the nucleotide sequences shown by SEQ ID No.1 to SEQ ID No.5 in the nucleotide sequence table because the bases are fewer and the chain is shorter.

Furthermore, in the nucleotide sequences shown in SEQ ID No. 1-SEQ ID No.10 in the nucleotide sequence table, the 5 'end or the 3' end of each nucleotide sequence is modified with sulfydryl or biotin to obtain a group of creatine kinase isoenzyme aptamers modified with sulfydryl or biotin.

The application of the nucleic acid aptamer is to detect, separate, purify and immobilize creatine kinase isoenzyme, apply the nucleic acid aptamer to the preparation of a biosensor and the analysis and detection of target substances, and prepare reagents for clinical diagnosis and medicines for treating diseases;

further, the application is preferably the application of the nucleic acid aptamer in preparing a creatine kinase isoenzyme detection kit;

furthermore, the creatine kinase isoenzyme aptamer modified with sulfydryl or biotin is obtained by modifying one end of 5 'or one end of 3' of the nucleotide sequence of the aptamer so as to be convenient to apply.

The creatine kinase isoenzyme detection kit comprises detection test paper, wherein the detection test paper comprises a bottom plate, and a sample pad, a combination pad, a nitrocellulose membrane and a water absorption pad which are adhered to the bottom plate and are sequentially overlapped; a detection line is arranged on one side, close to the combination pad, of the nitrocellulose membrane, and a quality control line is arranged on one side, close to the water absorption pad, of the nitrocellulose membrane; the binding pad is coated with an aptamer A with 5 'end or 3' end labeled by colloidal gold and 5 'end or 3' end connected with a non-aptamer nucleotide sequence; the detection line is coated with a B nucleic acid aptamer combined with streptavidin, and the quality control line is coated with a complementary nucleotide sequence combined with the streptavidin, wherein the complementary nucleotide sequence is a nucleotide sequence complementary with the non-aptamer nucleotide sequence.

Wherein, the nucleotide sequences of the aptamer A and the aptamer B are different and are respectively selected from SEQ ID No.1 to SEQ ID No.5 in the nucleotide sequence table, or are respectively selected from SEQ ID No.6 to SEQ ID No.10 in the nucleotide sequence table; preferably selected from SEQ ID No.6 to SEQ ID No.10 in the nucleotide sequence table; wherein, the case that the A aptamer is a nucleotide sequence shown by SEQ ID No.2 in the nucleotide sequence table, the case that the B aptamer is a nucleotide sequence shown by SEQ ID No.5 in the nucleotide sequence table, and the case that the A aptamer is a nucleotide sequence shown by SEQ ID No.7 in the nucleotide sequence table, the case that the B aptamer is a nucleotide sequence shown by SEQ ID No.10 in the nucleotide sequence table should be excluded.

A preparation method of detection paper in the detection kit comprises the following steps:

(1) labeling the 5 'end or the 3' end of the aptamer A with colloidal gold, and connecting a section of non-aptamer nucleotide sequence to the 5 'end or the 3' end for hybridizing with a complementary nucleotide sequence on the quality control line;

(2) putting the sample pad and the combination pad into a phosphate buffer solution containing BSA and Tween, soaking for more than 30min, and drying for later use;

(3) dispersing the colloidal gold labeled A aptamer solution obtained in the step (1) on the bonding pad treated in the step (2);

(4) fixing a B nucleic acid aptamer combined with streptavidin and a complementary nucleotide sequence on a nitrocellulose membrane as a detection line and a quality control line, and drying for later use;

(5) and sequentially overlapping and adhering the sample pad, the combination pad, the nitrocellulose membrane and the water absorption pad on a bottom plate to prepare the detection test paper.

Wherein, the 5 'end or the 3' end of the aptamer A is labeled with colloidal gold after being modified with sulfydryl; the 5 'end or the 3' end of the aptamer B is modified with biotin, and the 5 'end or the 3' end of the complementary nucleic acid sequence is modified with biotin.

Preferably, the colloidal gold-labeled a aptamer is prepared as follows:

(1) adding a nucleic acid aptamer A modified with sulfydryl at the 5 'end or the 3' end into a TE buffer solution (Tris-EDTAbuffer) to prepare a solution 1, adding the solution 1 into Tris (2-carboxyethyl) phosphine (TCEP), and reacting for 1-2 h to obtain a solution 2, wherein the molar ratio of the TCEP to the nucleic acid aptamer A modified with sulfydryl is 5: 1-50: 1;

(2) centrifuging colloidal gold at 8000-12000 r/min for 10-30 min, discarding supernatant, adding ultrapure water, mixing with solution 2, shaking for 1min, and standing at 4 deg.C to room temperature overnight to obtain solution 3;

the volume ratio of the colloidal gold, the ultrapure water and the solution 2 is 500:50: 0.2-500: 50: 20.

(3) Adding a NaCl aqueous solution into the solution 3, uniformly mixing to obtain a solution 4, wherein the concentration of NaCl in the solution 4 is 20mM, shaking the solution 4 for 0.5-1 min, and reacting at 4 ℃ to room temperature for 6-12 h;

(4) adding a NaCl aqueous solution into the solution 4 treated in the step (3) to obtain a solution 5, wherein the concentration of NaCl in the solution 5 is 40mM, shaking the solution 5 for 0.5-1 min, and reacting at 4 ℃ to room temperature for 10-24 h;

(5) centrifuging the solution 5 treated in the step (4) for 10-30 min at 8000-1200 r/min, discarding the supernatant, and adding the heavy suspension to the original volume to obtain a liquid containing the colloidal gold-labeled A aptamer;

the resuspension is prepared by dissolving 200000.005g of polyethylene glycol (PEG), 0.5g of sucrose, 0.1g of Tween (Tween) -2010 mu L and 0.1g of Bovine Serum Albumin (BSA) in 10mL of Tris-hydrochloric acid solution;

(6) directly spotting the liquid containing the colloidal gold-labeled A aptamer obtained in the step (5) on the pretreated bonding pad by using a pipette, and drying to obtain the bonding pad coated with the colloidal gold-labeled A aptamer for later use; the pretreatment comprises the following steps: the conjugate pad was soaked in 50mL of phosphate buffer solution with 1g of bovine serum albumin, 1.5g of sucrose and 0.01g of sodium azide for 30min, and then washed with a large amount of phosphate buffer solution.

Preferably, the streptavidin-bound B aptamer or the streptavidin-bound complementary nucleotide sequence is prepared as follows:

(1) dissolving the raw materials by using a phosphate buffer solution to obtain a solution with the concentration of 100 mu M;

the raw material is B nucleic acid aptamer with biotin modified at 5 'end or 3' end or complementary nucleotide sequence powder with biotin modified at 5 'end or 3' end.

(2) Adding 42-168 mu L of streptavidin (1 mg/mL) into the solution prepared in the step (1), mixing uniformly, and standing at room temperature for 1-3 h to obtain a mixed solution;

the molar ratio of the raw material to the streptavidin is 4: 1-1: 1.

(3) And (3) centrifuging the mixed solution obtained in the step (2) for more than 10min at 12000r/min at the temperature of 4-room temperature by using a 30KD ultrafiltration tube, inverting the ultrafiltration tube, and centrifuging for more than 30min at 1000g at the temperature of 4-room temperature to obtain the solution after ultrafiltration, thereby obtaining the B nucleic acid aptamer combined with streptavidin or the complementary nucleotide sequence combined with the streptavidin.

Preferably, the detection line and the quality control line on the nitrocellulose membrane are prepared by the following steps:

scribing the B aptamer combined with streptavidin with the concentration of 1OD/30 muL-5 OD/30 muL at about 1/3 positions on the side, close to the binding pad, of the nitrocellulose membrane to obtain a detection line coated with the B aptamer combined with streptavidin, and scribing the complementary nucleotide sequence combined with streptavidin with the concentration of 0.025OD/30 muL-1 OD/30 muL at about 1/3 positions on the side, close to the water absorption pad, of the nitrocellulose membrane to obtain a quality control line coated with the complementary nucleotide sequence combined with streptavidin; during scribing, the flow velocity of the detection line and the quality control line is 1 mu L/cm; and after scribing, placing at room temperature for more than 2h for drying and fixing to obtain the nitrocellulose membrane marked with the detection line and the quality control line.

Preferably, the preparation method of the test paper is as follows:

pre-treating the sample pad: the sample pad was soaked in 50mL of phosphate buffer supplemented with 0.5g Bovine Serum Albumin (BSA), 50. mu. LTween-20 for 30min, then washed with a large amount of phosphate buffer, and dried for use.

And sequentially overlapping and adhering the pretreated sample pad, the binding pad coated with the aptamer A marked by the colloidal gold, the nitrocellulose membrane marked with the detection line and the quality control line and the water absorption pad to a bottom plate, wherein the nitrocellulose membrane marked with the detection line and the quality control line is fixed on the bottom plate, one end of the nitrocellulose membrane is pressed by the water absorption pad, the other end of the nitrocellulose membrane is pressed by the binding pad, and the binding pad is pressed by the sample pad to obtain the detection test paper.

A detection method for detecting creatine kinase isoenzyme is realized by the creatine kinase isoenzyme detection kit provided by the invention, and specifically comprises the following steps:

60-100 mul of phosphate buffer solution containing creatine kinase isozyme protein is dripped on a sample pad of detection paper in the detection kit, the solution moves to a water absorption pad under the action of capillary, after 5-20 min, a detection line presents a bright red strip indicating that creatine kinase isozyme protein exists, and if no red strip appears in the detection line, no creatine kinase isozyme protein exists, and the detection is finished.

Advantageous effects

1. The invention provides a group of creatine kinase isoenzyme nucleic acid aptamers, and the nucleic acid aptamers and creatine kinase isoenzyme nucleic acid aptamers have high binding specificity and high affinity.

2. The invention provides application of a group of nucleic acid aptamers for creatine kinase isoenzyme, and the detection of the creatine kinase isoenzyme by using the nucleic acid aptamers has some advantages which are not possessed by antibodies, such as the characteristics of in vitro screening, synthesis, easy modification, high stability and the like.

3. The invention provides application of a group of nucleic acid aptamers for creatine kinase isoenzyme, and the screened nucleic acid aptamers with high specificity and high affinity with creatine kinase isoenzyme can be specifically combined with creatine kinase isoenzyme and are used for preparing detection test paper in a creatine kinase isoenzyme rapid detection kit.

Drawings

FIG. 1 is a graph showing the relative affinities of single-stranded DNAs screened in each round of the creatine kinase isoenzyme aptamer screening process in example 1 and creatine kinase isoenzyme.

FIG. 2 is a schematic structural view of the test strip prepared in example 7.

In the figure, 1 is a sample pad, 2 is a combination pad, 3 is a nitrocellulose membrane, 4 is a water absorption pad, 5 is a bottom plate, 6 is a detection line, and 7 is a quality control line.

Detailed Description

The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention.

In the following examples:

unless otherwise specified, the experimental methods are all conventional methods.

The experimental materials used were all purchased from a conventional biochemical reagent store unless otherwise specified.

The invention utilizes the in vitro screening SELEX technology of the aptamer, takes creatine kinase isoenzyme as a positive screening target and takes tosyl magnetic beads as a negative screening target, and screens the aptamer which is specifically combined with the creatine kinase isoenzyme from a random oligomeric DNA library synthesized in vitro.

The aptamer sequences of the invention may be selected from naturally occurring or synthetic sequences, or from any other source of the same.

The aptamer sequence of the present invention contains a sequence identical to all of the nucleotides of the signature sequence. The aptamer can be labeled by colloidal gold after sulfydryl modification or combined with streptavidin after biotin modification, and can be applied to subsequent detection kits.

Example 1

1. Selection and Synthesis of Single-stranded DNA libraries

The following 5 DNAs were synthesized by Biotechnology engineering (Shanghai) Ltd: a 81 base DNA library having the nucleic acid sequence: ATCCAGAGTGACGCAGCA (N45) TGGACACGGTGGCTTAGT; "P1 biotin upstream": ATCCAGAGTGACGCAGCA, respectively; "P2 biotin downstream": ACTAAGCCACCGTGTCCA, respectively; "upstream of P3": ATCCAGAGTGACGCAGCA, respectively; "downstream of P4": ACTAAGCCACCGTGTCCA are provided. When 1OD DNA in each tube needs to be used, centrifuging at 12000rpm for 0.5min before opening the cover; 100 μ M stock solution was prepared according to the instructions on the tube wall.

2. Magnetic tosyl bead and creatine kinase isozyme combined

The tosyl beads (Dynal,2mL) were vortexed before use and 16.5. mu.L (2 × 10)⁷Respectively) washing magnetic beads twice by using Buffer B (0.1M Na-phosphate Buffer with the pH value of 7.4), adding 1mL of magnetic beads each time, performing vortex oscillation after adding, placing a 1.5mL centrifugal tube on a magnetic collector, after 1min, clarifying the solution, sucking supernatant on a magnetic frame by using a pipettor, removing interference in the magnetic bead solution in the washing process, and adjusting the protein amount and the magnetic bead amount along with the experimental process during the incubation of the magnetic beads and creatine kinase isozyme protein, wherein the protein amount and the magnetic bead amount are adjusted from 1 round to 7 rounds, and 16.5 mu L (2 × 10 10.4)⁷One) magnetic beads were bound with 5. mu.g creatine kinase isoenzyme (PROSPEC,1 mg/126.5. mu.L) protein. The magnetic beads were resuspended in 75. mu.L with Buffer B, then 0.63. mu.L (5. mu.g) of creatine kinase isozyme and 50. mu.L of Buffer C (3M ammonium sulfate in Buffer B) were added and incubated at 4 ℃ for 18h with rotation. The supernatant was magnetically separated and Buffer D (PBS) was addedpH 7.4, phosphate buffer) 1mL, and shaking was continued for 1 h. After this time, wash twice with buffer e (PBST pH 7.4), 1 mL/time, vortex wash. Finally, resuspend with 200. mu.L Buffer D (PBS). The amount of magnetic beads was kept constant for 8 to 9 cycles, and the volume of creatine kinase isoenzyme (0.63. mu.L) was reduced to 0.5. mu.L (4. mu.g). 10 rounds, 12.7. mu.L of magnetic beads, 0.5. mu.L of creatine kinase isozyme.

3. Positive screening and negative screening of empty magnetic beads

For positive selection, the 1OD DNA library was first dissolved in 240. mu.L PBS and mixed with 500. mu.L of resuspended creatine kinase isoenzyme-bound magnetic beads (16.5. mu.L) for the first round of selection. In the subsequent screening, the library for incubation with magnetic beads combined with creatine kinase isoenzyme is a DNA library prepared by single-stranded amplification in the previous round. In the 1-6 screening rounds, the DNA library and the magnetic beads combined with the creatine kinase isoenzyme are incubated in a shaking table at 37 ℃ for 120 min. As the number of rounds increases, the incubation time decreases: 90min for 7 to 8 rounds and 60min for 9 to 10 rounds. After each round of incubation with protein magnetic beads, the library was washed three times with PBS, finally resuspended in 40 μ LTE buffer, heated at 95 ℃ for 15min to separate the aptamer having affinity for creatine kinase isoenzyme from creatine kinase isoenzyme, and dissolved in TE buffer for amplification.

For each three rounds of positive screening, a counter-screen was performed to remove DNA from the DNA library that had an affinity for the magnetic beads themselves. In the reverse screening, after mixing 240. mu.L of the DNA library obtained after the previous round of single strand preparation with 500. mu.L of the resuspended magnetic beads (33. mu.L), incubating the mixture in a shaker at 37 ℃ for 120min, and collecting the solution not bound to the magnetic beads for the next round of screening.

4. Amplification and identification of libraries

The screening was started from 1OD aptamer pool, the DNA solution after screening was amplified as a template, and after amplification, the standard DNA loading was 2. mu.L and the Polymerase Chain Reaction (PCR) sample loading was 5. mu.L, which were identified by 4% agarose gel electrophoresis under 110V for 50 min.

The TE-resuspended DNA library was subjected to PCR and 3 total samples were assigned, one for subsequent screening (P2, P3), one for measuring relative affinity (P1, P4) and one for vector ligation (P3, P4). In the experiment, the dosage of the PCR reagent is as follows: upstream and downstream primers were 0.5. mu.L of each 2.5. mu. L, DNA library, and PCR mix 25. mu.L water 19. mu.L.

The PCR procedure was: pre-denaturation at 95 ℃ for 5min, followed by 15 PCR cycles, each consisting of: 30s at 95 ℃; 56.3 ℃ for 30s and 72 ℃ for 30 s. After the circulation is finished, the PCR program is finished at 72 ℃ for 3 min.

Purification of PCR products

Purification was performed according to the instructions of column recovery kit of Biotechnology engineering (Shanghai) Ltd. by preheating TE to 60 ℃ first, adding Buffer B3 in 400. mu.L kit to the 2-tube (80. mu.L) PCR product, 8000g 30s, ultrafiltering, and repeating the same procedure by putting the solution in the cannula on the outer side of the ultrafilter tube into the cannula again in order to allow as much DNA as possible to be adsorbed by the filter. Then washed twice with 500. mu.L Washing Buffer, centrifuged at 9000g for 30s, and discarded. Finally 9000g, 30s, centrifuge tube 1 time in air. The preheated 40. mu.L of TE was directly applied to the filter, left to stand for 2min, centrifuged, and the following DNA solution was taken out.

6. Preparation of Single-stranded DNA library

For single strand preparation, 40. mu.L of streptavidin magnetic beads (Dynal,2mL) was washed twice with 1mL of B & W buffer (2X) according to the instructions, vortexed, 1.5mL centrifuge tubes were placed in a magnetic collector, and after 1min, the solution was clarified and the supernatant was pipetted off the magnetic rack. The washing process removed the interference from the bead solution, and after washing, the beads were resuspended to 80 μ L using B & W buffer (10mM Tris-HCl (pH 7.5), 1mM EDTA, and 2M NaCl) (2 ×).

DNA obtained by PCR using two primers P2 and P3, double-stranded DNA purified in a volume of 80. mu.L was added to 40. mu.L of magnetic beads (fixed to 40. mu.L of magnetic beads after 3 cycles, concentration was not measured), the total volume was made up to 160. mu.L with 40. mu.L of TE, the mixture was left at room temperature for 10min, and 1 × B was used&W buffer washes twice with vortex shaking. Adding 200 μ L of 100mM NaOH, denaturing for 30min, collecting supernatant, adding 40 μ L of 1M NaH₂PO₄(pH 3.9) neutralization.

7. Relative affinity assay

Use of "P1 biotin upstream": ATCCAGAGTGACGCAGCA and "downstream of P4": ACTAAGCCACCGTGTCCA twoThe individual primers amplify the DNA library obtained from each round of screening, which can be the same method as the amplification before single-strand preparation, except for the primers. The amplified DNA is double-stranded DNA, and biotin is modified on one strand which has affinity with creatine kinase isozyme. And (4) measuring the concentration (quantified by a microplate) after the aptamer is purified, and homogenizing the concentration. The formulation was diluted with phosphate buffer to 37.5nM, 1 mL. Water bath at 95 ℃ for 20min and immediately on ice for 20min to open the double strand. Prior to the experiment, creatine kinase isozyme (PROSPEC,1 mg/126.5. mu.L) and another protein myoglobin (Abcam, 3.36mg/mL) for verifying the specificity were coated with a coating buffer (1.59g Na, respectively)₂CO₃，2.93g NaHCO₃Dissolved in 1L of ultrapure water) to 5. mu.g/mL. Creatine kinase isozyme was coated in a volume of 100. mu.L of target protein per well, three wells in parallel per round, and 96-well plates were incubated overnight at 4 ℃. The liquid was emptied and patted dry and washed with 200. mu.L of washing buffer (PBST: 0.2g KH)₂PO₄，2.9g Na₂HPO₄·12H₂O, 8.0g NaCl, 0.2g KCl in 1L ddH₂O, plus 0.5mL Tween-20) 1 time, 300. mu.L of blocking solution (0.05g BSA in 50mL coating buffer) per well was incubated at 4 ℃ for 1 h. After draining the liquid and patting it dry, wash twice with 200. mu.L wash buffer, 100. mu.L of each round of DNA pool was added to each well and incubated for 1h at 37 ℃. After the liquid was emptied and patted dry, washed three times with 300. mu.L of washing buffer, 100. mu.L of horseradish peroxidase-streptavidin (Shanghai Bin Yuntian Biotechnology Co., Ltd.) diluted 2000-fold was added to each well and incubated at 37 ℃ for 1 h. The liquid was emptied and patted dry, washed three times with wash buffer, then soaked for 5min with wash buffer, emptied and patted dry, and washed twice with 300 μ L of wash buffer to remove free horseradish peroxidase. Adding 100 μ L of 3,3 ', 5, 5' -Tetramethylbenzidine (TMB) color development solution (Shanghai Binyan biotechnology, Inc.) into each well, developing in dark for 30min, adding 50 μ L of 2M sulfuric acid solution into each well to terminate the reaction, and reading absorbance at 450nm with a microplate reader. Graphpad statistics were used and plotted as shown in fig. 1. The results show that the affinity of the DNA library and the creatine kinase isoenzyme is gradually increased along with the increase of the screening rounds, and the DNA library and the muscle serving as a control are simultaneously increasedThe affinity of the hemoglobin and the bovine serum albumin is reduced, which shows that the creatine kinase isoenzyme aptamer screening process plays a role in enriching high-affinity single-stranded DNA, and the DNA library after 10 rounds of screening contains creatine kinase isoenzyme aptamer.

8. Cloning and sequencing

The library was first subjected to PCR for 15 cycles as in the amplification procedure described previously. Here, 2.5. mu.L of each primer (P3, P4) was used. As with amplification during screening, it is identified and purified by agarose gel electrophoresis. The ligation was performed according to the instructions of the Vector (pEASY-T1Simple Cloning Vector, Beijing Quanyujin Biotechnology Co., Ltd.) and the linker system: 1 mu L of PCR product, 1 mu L of carrier and 3 mu L of water are added, and the reaction is carried out for 1min at room temperature. Then 5. mu.L of the ligation was added to 50. mu.L of competent cells, gently mixed and ice-cooled for 30 min. The heat shock was applied to the water bath at 42 ℃ for 30s and immediately placed on ice for 2 min. Add 250. mu.L of LB medium equilibrated to room temperature, incubate at 37 ℃ for 1h at 200 rpm. All first cultures were centrifuged at 4000rpm for 1min and the supernatant discarded, leaving 150. mu.L of flicked cells, which were all plated onto prepared ampicillin plates overnight at 37 ℃. White single clones were picked into 10. mu.L of sterile water and vortexed. Positive clones were identified by M13Forward Primer and M13Reverse Primer by taking 1. mu.L of the mixture in 25. mu.L of PCR system. And (5) carrying out shake bacteria on positive clones and then sequencing.

The nucleotide sequence obtained by sequencing is the nucleotide sequence of a group of creatine kinase isoenzyme nucleic acid aptamers, and the nucleotide sequence is as follows:

the nucleotide sequence of SEQ ID No. 1:

atccagagtg acgcagcacg gtggagtcgt tgggtcgtgg gggtggggtg gtgggattgg 60

tggtggacac ggtggcttag t 81

the nucleotide sequence of SEQ ID No. 2:

atccagagtg acgcagcagg ggtgggggtg ggtttgaagc acgtcgagtg ggatggcagg 60

gggtggacac ggtggcttag t81

the nucleotide sequence of SEQ ID No. 3:

atccagagtg acgcagcagg gacacatcca tccatgcaca ggactgtcta catcgctatg 60

ttatggacac ggtggcttag t 81

the nucleotide sequence of SEQ ID No. 4:

atccagagtg acgcagcagg ggggtgggtg ggggatctcg gaggatgctt ttagggggtt 60

gggtggacac ggtggcttag t 81

the nucleotide sequence of SEQ ID No. 5:

atccagagtg acgcagcaca ttgagagggg gtggccgtag tcaggtgggt gggggtttga 60

gtggacacgg tggcttagt 79

respectively and preferably selecting partial base in each of the nucleotide sequences shown by SEQ ID No. 1-SEQ ID No.5 in the nucleotide sequence table to obtain the nucleotide sequences shown by SEQ ID No. 6-SEQ ID No.10 in the nucleotide sequence table, which comprises the following steps:

the nucleotide sequence of SEQ ID No. 6:

cggtggagtc gttgggtcgt gggggtgggg tggtgggatt ggtgg 45

the nucleotide sequence of SEQ ID No. 7:

ggggtggggg tgggtttgaa gcacgtcgag tgggatggca ggggg 45

the nucleotide sequence of SEQ ID No. 8:

gggacacatc catccatgca caggactgtc tacatcgcta tgtta 45

the nucleotide sequence of SEQ ID No. 9:

ggggggtggg tgggggatct cggaggatgc ttttaggggg ttggg 45

the nucleotide sequence of SEQ ID No. 10:

cattgagagg gggtggccgt agtcaggtgg gtgggggttt gag 43

thiolated modified aptamers (including non-aptamer nucleotide sequences), exemplified by SEQ ID No. 7:

HS-(CH₂)₆-tttttttttt tttttttttt ggggtggggg tgggtttgaa gcacgtcgagtgggatggca gggg 65

the biotin modified aptamer is exemplified by SEQ ID No. 9:

biotin-ggggggtggg tgggggatct cggaggatgc ttttaggggg ttggg 45

complementary nucleic acid sequence:

aaaaaaaaaa aaaaaaaaaa-biotin 20

the above nucleotide sequences were all synthesized by Biotechnology engineering (Shanghai) Ltd.

Example 2

The creatine kinase isoenzyme aptamer described in example 1 was used to measure dissociation constants, specifically as follows:

(1) in a 96-well plate, 100. mu.L per well of creatine kinase isoenzyme (PROSPEC,1 mg/126.5. mu.L) solution at a concentration of 2000ng/mL was incubated overnight at 4 ℃ or for 2h at 37 ℃; creatine kinase isoenzyme solution coating buffer (1.59 gNa)₂CO₃，2.93g NaHCO₃Dissolved in 1L of ultrapure water).

(2) The liquid in the 96-well plate after the treatment in step (1) was emptied and patted dry, washed twice with 200. mu.L of phosphate Tween buffer for 1min each time.

(3) Adding 300 mu L of confining liquid into each hole of the 96-hole plate treated in the step (2), and incubating for 1h at 4 ℃; the confining liquid needs to be prepared as before, and is prepared by dissolving 0.06g of bovine serum albumin in 20mL of phosphate buffer;

(4) washing the 96-well plate treated in the step (3) with 200 mu L of phosphate Tween buffer for three times, wherein each time lasts for 1 min;

(5) diluting creatine kinase nucleic acid aptamers into 10nM, 20nM, 50nM, 100nM, 200nM and 400nM by using phosphate buffer solution, and sequentially adding the diluted aptamers to the 96-well plate treated in the step (4), wherein each 100 uL of the aptamers is contained in each well, and each concentration is three parallel wells;

(6) incubating at 37 ℃ for 1 h;

(7) after incubation, washing with phosphate tween buffer for three times;

(8) diluting streptavidin labeled by horseradish peroxidase (Shanghai Biyuntian biotechnology, Co., Ltd.) with phosphate buffer solution at a ratio of 1:2000, adding into the 96-well plate treated in step (7), incubating at 37 deg.C for 1h, wherein each well is 100 μ L;

(9) emptying the liquid in the 96-well plate treated in the step (8) and beating to dry, washing three times by using 300 mu L of phosphate Tween buffer solution, then soaking for 5min by using the phosphate Tween buffer solution, emptying the liquid and beating to dry, and washing twice by using 300 mu L of phosphate Tween buffer solution;

(10) adding 100 mu L of 3,3 ', 5, 5' -Tetramethylbenzidine (TMB) color development liquid (Shanghai Binyan biotechnology limited) into each hole of the 96-hole plate treated in the step (9), developing for 30min in a dark place, and stopping the reaction in time if the color of blue is faded;

(11) adding 50 mu L of 2M sulfuric acid into each hole of the 96-hole plate treated in the step (10), and reading the absorbance at 450nm by using a microplate reader;

(12) performing nonlinear regression with the amount of the aptamer added as abscissa and the relative amount of the aptamer bound to the protein (expressed as absorbance, with the actual measurement value being taken as blank) as ordinate, using the formula Y ═ Bmax · X/(Kd + X); in the formula, y represents the amount of the bound aptamer, Bmax represents the maximum adsorption amount, Kd represents the dissociation constant, and X is the concentration of the added aptamer; the X originally indicates the concentration of the aptamer in the free state, but in this experiment, the aptamer concentration is much higher than the protein concentration, so that the amount of X added is replaced by the aptamer addition amount. The regression coefficient and the fitting degree were obtained by the nonlinear regression formula "One positional binding (hyperbola)" in software Prism graphics 5.0.

(13) The dissociation constants of the nucleotide sequences shown in SEQ ID No. 1-SEQ ID No.10 in the sequence table are calculated to be 11.95nM, 25.95nM, 56.01nM, 0.81nM, 47.77nM, 63.57nM, 35.21nM, 112nM, 14.74nM and 24.04nM in sequence, which indicates that the nucleotide sequences have better affinity with creatine kinase isozyme and can be used for detecting creatine kinase isozyme.

Example 3

A preparation method of colloidal gold-labeled A aptamer comprises the following steps:

(1) adding TE buffer (Tris-EDTA buffer) into a sulfhydryl modified aptamer A with 20 thymine sequences connected at one end and having the nucleotide sequence shown in SEQ ID No.2 to prepare solution 1, adding Tris (2-carboxyethyl) phosphine (TCEP) into the solution 1, reacting for 2h, wherein the molar ratio of the TCEP to the sulfhydryl modified aptamer is 5:1, obtaining a solution 2;

(2) centrifuging 1mL of colloidal gold solution at 8000r/min for 30min, discarding the supernatant, adding 100 μ L of ultrapure water, mixing 12 μ L of solution 2, shaking for 1min, and standing overnight to obtain solution 3;

(3) adding 40mM NaCl aqueous solution with the same volume as the solution 3 into the solution 3 to obtain a solution 4 with the concentration of 20mM, shaking for 1min, and reacting at room temperature for 8 h;

(4) adding 1M NaCl aqueous solution again to obtain solution 5, wherein the concentration of the solution 5 in the centrifugal tube is 40mM, shaking for 1min, and standing overnight;

(5) placing the centrifuge tube at 8000r/min, centrifuging for 10min, discarding the supernatant, adding 100 μ L of resuspension (PEG 200000.005g, sucrose 0.5g, Tween-2010 μ L, BSA 0.1g, dissolved in 10mL of Tris-hydrochloric acid solution) to the original volume to obtain a liquid containing the colloidal gold labeled A aptamer;

(6) directly using a pipette to spot the liquid obtained in the step (5) on the pretreated combination pad 2, and drying for later use, wherein the pretreatment comprises the following steps: the conjugate pad 2 was soaked in 50mL of phosphate buffer solution with 1g of Bovine Serum Albumin (BSA), 1.5g of sucrose and 0.01g of sodium azide for 30min, and then washed with a large amount of phosphate buffer solution.

A method for preparing a B nucleic acid aptamer bound to streptavidin or a complementary nucleotide sequence bound to streptavidin, comprising the following steps:

the raw material is a B nucleic acid aptamer modified by biotin and provided with a nucleotide sequence shown in SEQ ID No.4 or a complementary nucleotide sequence modified by biotin and complementary with a non-aptamer nucleotide sequence on the nucleic acid aptamer provided with a nucleotide sequence shown in SEQ ID No. 2;

(2) adding 42 mu L of streptavidin of 1mg/mL, uniformly mixing, and standing for 3h at room temperature to obtain a mixed solution; the molar ratio between the starting material and streptavidin was 4: 1.

(3) And (3) centrifuging the mixed solution obtained in the step (2) for 10min at 12000r/min at the temperature of 4 ℃ by using a 30KD ultrafiltration tube, and then centrifuging for 30min at 1000g by inverting the ultrafiltration tube at the temperature of 4 ℃ to obtain the solution after ultrafiltration to obtain a streptavidin-labeled B aptamer with the nucleotide sequence shown in SEQ ID No.4 or a streptavidin-labeled complementary nucleotide sequence which is complementary with thymine (namely a non-aptamer nucleotide sequence) at the tail end of a DNA chain where the streptavidin-labeled aptamer with the nucleotide sequence shown in SEQ ID No.2 is located.

Example 4

(2) taking 1mL of colloidal gold, centrifuging at 12000r/min for 10min, discarding the supernatant, supplementing 100 mu L of ultrapure water, mixing with 0.4 mu L of solution 2, shaking for 1min, and standing overnight at 4 ℃ to obtain solution 3;

(3) adding 40mM NaCl aqueous solution with the same volume as the solution 3 into the solution 3 to obtain a solution 4, shaking the solution 4 for 0.5min, and keeping the temperature at 4 ℃ for 12 h;

the rest of the procedure was the same as that of example 3.

the preparation method of the B aptamer combined with streptavidin or the complementary nucleotide sequence combined with streptavidin in the example 3 is the same as the preparation method of the B aptamer combined with streptavidin or the complementary nucleotide sequence combined with streptavidin in the example 3, except that the SEQ ID No.4 in the example 3 is changed into the SEQ ID No. 1.

Example 5

A preparation method of colloidal gold labeled A aptamer comprises the following specific steps:

changing SEQ ID No.2 to SEQ ID No.5 in example 3,

(4) adding 1M NaCl aqueous solution again to obtain solution 5 with final concentration of 40mM of solution 5, shaking for 0.5min, and standing at 4 deg.C for 24 hr;

(5) centrifuging the solution 5 at 8000r/min for 30min, discarding the supernatant, adding 100 μ L of resuspension (PEG 200000.005g, sucrose 2.5g, Tween-2010 μ L, BSA 0.1g, dissolved in 10mL of Tris-hydrochloric acid solution) to the original volume to obtain a liquid containing the colloidal gold labeled A aptamer;

the rest of the procedure was the same as that of example 3.

replacement of SEQ ID No.4 in example 3 to SEQ ID No.1

the raw material is a B nucleic acid aptamer modified by biotin and provided with a nucleotide sequence shown in SEQ ID No.1 or a complementary nucleotide sequence modified by biotin and complementary with a non-aptamer nucleotide sequence on the nucleic acid aptamer provided with a nucleotide sequence shown in SEQ ID No. 5;

(2) adding 168 mu L of streptavidin of 1mg/mL, uniformly mixing, and standing for 1h at room temperature to obtain a mixed solution; the molar ratio of the raw material to the streptavidin is 1: 1.

(3) And (3) centrifuging the mixed solution obtained in the step (2) for 10min at 12000r/min under the condition of room temperature by using a 30KD ultrafiltration tube, then centrifuging for 30min at 1000g under the condition of room temperature by inverting the ultrafiltration tube to obtain the solution after ultrafiltration, and obtaining a streptavidin-labeled B nucleic acid aptamer with the nucleotide sequence shown in SEQ ID No.1 or a streptavidin-labeled complementary nucleotide sequence which is complementary with thymine (namely a non-aptamer nucleotide sequence) at the tail end of a DNA chain where the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID No.2 is located.

Example 6

wherein the aptamer A is selected from SEQ ID No. 1-SEQ ID No.10 in the nucleotide sequence table, and the rest is the same as the preparation method of the aptamer A marked by the colloidal gold in the embodiment 3.

wherein, the nucleotide sequences of the B nucleic acid aptamer and the A nucleic acid aptamer are different and are respectively selected from SEQ ID No. 1-SEQ ID No.10 in the nucleotide sequence table, and when the A nucleic acid aptamer is the nucleotide sequence shown by SEQ ID No.2 in the nucleotide sequence table, the B nucleic acid aptamer is not the nucleotide sequence shown by SEQ ID No.5 in the nucleotide sequence table, and when the A nucleic acid aptamer is the nucleotide sequence shown by SEQ ID No.7 in the nucleotide sequence table, the B nucleic acid aptamer is not the nucleotide sequence shown by SEQ ID No.10 in the nucleotide sequence table.

The remainder of the procedures were the same as those described in example 3for preparing a streptavidin-conjugated B aptamer or a streptavidin-conjugated complementary nucleotide sequence.

Example 7

The preparation of the detection line 6 and the quality control line 7 on the nitrocellulose membrane 3 comprises the following steps:

scribing the B aptamer which is combined with the streptavidin and has the concentration of 1OD/30 mu L at about 1/3 positions on the side, close to the combination pad 2, of the nitrocellulose membrane 3 to obtain a detection line 6 coated with the aptamer which is combined with the streptavidin; drawing a complementary nucleotide sequence which is combined with streptavidin and has the concentration of 0.025OD/30 mu L on the nitrocellulose membrane 3 at about 1/3 positions close to one side of the water absorption pad 4 to obtain a quality control line 7 coated with the complementary nucleotide sequence; during scribing, the flow velocity of the detection line 6 and the quality control line 7 is 1 mu L/cm; and standing at room temperature for 2h for drying and fixing to obtain the nitrocellulose membrane 3 marked with the detection line 6 and the quality control line 7.

The B nucleic acid aptamers combined with streptavidin are respectively selected from the B nucleic acid aptamers combined with streptavidin prepared in examples 3-6; the complementary nucleotide sequences binding to streptavidin are respectively selected from the complementary nucleotide sequences binding to streptavidin prepared in examples 3-6.

Example 8

The creatine kinase isoenzyme detection kit is realized by the following steps:

sequentially overlapping and bonding a pretreated sample pad 1 (made of a glass cellulose membrane), a combined pad 2 (made of a glass cellulose membrane) coated with a colloidal gold labeled aptamer A prepared in examples 3-6, a nitrocellulose membrane 3 marked with a detection line 6 and a quality control line 7 prepared in example 6 and a water absorption pad 4 (made of water absorption filter paper) on a PVC bottom plate 5(80mm multiplied by 5mm), wherein the nitrocellulose membrane 3 marked with the detection line 6 and the quality control line 7 is prepared in example 7 and fixed on the bottom plate 5, one end of the nitrocellulose membrane 3 is pressed by the water absorption pad 4, the other end of the nitrocellulose membrane is pressed by the combined pad 2, and the combined pad 2 is pressed by the sample pad 1 to obtain the detection test paper, as shown in FIG. 2.

Example 9

100 mu L of phosphate buffer solution containing creatine kinase isozyme protein is dripped on the sample pad 1 of the detection test paper prepared in the example 8, the solution moves to the water absorption pad 4 under the capillary action, after 20min, a detection line shows a red strip, which indicates that the creatine kinase isozyme protein is detected, and the detection is finished.

The present invention includes but is not limited to the above embodiments, and any general replacement or partial modification made within the spirit and principle of the present invention shall be considered to be within the protection scope of the present invention.

Claims

1. A creatine kinase isoenzyme aptamer, characterized in that: the nucleotide sequence of the aptamer is selected from SEQ ID No.4 in a nucleotide sequence table.

2. A set of creatine kinase isoenzyme aptamers, characterized in that: the nucleotide sequence of the aptamer is SEQ ID No.2 and SEQ ID No.4 in a nucleotide sequence table.

3. The creatine kinase isoenzyme nucleic acid aptamer according to claim 1 or 2, wherein: and modifying sulfydryl or biotin at the 5 'end or the 3' end of each nucleotide sequence to obtain the creatine kinase isoenzyme aptamer modified with sulfydryl or biotin.

4. Use of the creatine kinase isoenzyme nucleic acid aptamer according to any one of claims 1 to 3, wherein: the aptamer is used for separating, purifying and immobilizing creatine kinase isoenzyme, is applied to the preparation of biosensors, and is used for preparing reagents for clinical diagnosis and medicines for treating diseases.

5. Use of the creatine kinase isoenzyme aptamer according to claim 4, wherein: the nucleic acid aptamer is applied to preparation of a creatine kinase isoenzyme detection kit.

6. The creatine kinase isoenzyme detection kit comprises detection test paper, wherein the detection test paper comprises a base plate (5), a sample pad (1), a combination pad (2), a nitrocellulose membrane (3) and a water absorption pad (4), wherein the sample pad (1), the combination pad (2), the nitrocellulose membrane (3) and the water absorption pad are bonded on the base plate (5) and are sequentially overlapped; a detection line (6) is arranged on one side, close to the combination pad (2), of the nitrocellulose membrane (3), and a quality control line (7) is arranged on one side, close to the water absorption pad (4), of the nitrocellulose membrane (3); the method is characterized in that: the binding pad (2) is coated with an aptamer A with 5 'end or 3' end labeled by colloidal gold and 5 'end or 3' end connected with a non-aptamer nucleotide sequence; the detection line (6) is coated with a B nucleic acid aptamer combined with streptavidin, and the quality control line (7) is coated with a complementary nucleotide sequence combined with the streptavidin, wherein the complementary nucleotide sequence is a nucleotide sequence complementary to the non-aptamer nucleotide sequence;

the nucleotide sequences of the A aptamer and the B aptamer are different and are respectively selected from SEQ ID No.2 and SEQ ID No.4 in the nucleotide sequence table of claim 2.

7. A method for preparing the creatine kinase isoenzyme detection kit according to claim 6, wherein the kit comprises: the preparation method of the test paper comprises the following steps:

(1) labeling the 5 'end or the 3' end of the aptamer A with colloidal gold, and connecting a non-aptamer nucleotide sequence to the 5 'end or the 3' end;

(2) putting the sample pad (1) and the binding pad (2) into phosphate buffer solution containing BSA and Tween, soaking for more than 30min, and drying;

(3) dispersing a colloidal gold-labeled aptamer A solution on the binding pad (2) treated in the step (2);

(4) fixing a B nucleic acid aptamer combined with streptavidin and a complementary nucleotide sequence on a nitrocellulose membrane (3) as a detection line (6) and a quality control line (7), and drying;

(5) sequentially overlapping and adhering the sample pad (1), the combination pad (2), the nitrocellulose membrane (3) and the water absorption pad (4) on a bottom plate (5) to prepare the detection test paper;

modifying sulfydryl at the 5 'end or the 3' end of the aptamer A, and then labeling with colloidal gold; the 5 'end or the 3' end of the aptamer B is modified with biotin, and the 5 'end or the 3' end of the complementary nucleic acid sequence is modified with biotin.

8. The method for preparing the creatine kinase isoenzyme detection kit according to claim 7, characterized in that:

the preparation method of the colloidal gold-labeled A aptamer comprises the following steps:

(1) adding a nucleic acid aptamer A modified with sulfydryl at the 5 'end or the 3' end into a TE buffer solution to prepare a solution 1, adding the solution 1 into TCEP, and reacting for 1-2 h to obtain a solution 2, wherein the molar ratio of the TCEP to the nucleic acid aptamer A modified with sulfydryl is 5: 1-50: 1;

the volume ratio of the colloidal gold to the ultrapure water to the solution 2 is 500:50: 0.2-500: 50: 20;

the resuspension is prepared by dissolving 200000.005g of polyethylene glycol, 0.5g of sucrose, 0.1g of tween-2010 mu L and 0.1g of bovine serum albumin in 10mL of Tris-hydrochloric acid solution;

(6) spotting the liquid containing the colloidal gold-labeled aptamer A on the pretreated binding pad (2) by using a pipette, and drying to obtain the binding pad (2) coated with the colloidal gold-labeled aptamer A; the pretreatment comprises the following steps: soaking the bonding pad (2) in 50mL phosphate buffer solution added with 1g of bovine serum albumin, 1.5g of sucrose and 0.01g of sodium azide for 30min, and then washing with the phosphate buffer solution;

the preparation method of the B aptamer combined with streptavidin or the complementary nucleotide sequence combined with streptavidin comprises the following steps:

the raw material is B nucleic acid aptamer modified with biotin at the 5 'end or the 3' end or complementary nucleotide sequence powder modified with biotin at the 5 'end or the 3' end;

(2) adding 42-168 mu L of 1mg/mL streptavidin into the solution, mixing uniformly, and standing at room temperature for 1-3 h to obtain a mixed solution;

the molar ratio of the raw material to the streptavidin is 4: 1-1: 1;

(3) centrifuging the mixed solution for more than 10min at 12000r/min at 4-room temperature by using a 30KD ultrafiltration tube, inverting the ultrafiltration tube, and centrifuging for more than 30min at 1000g at 4-room temperature to obtain the solution after ultrafiltration to obtain a B nucleic acid aptamer combined with streptavidin or a complementary nucleotide sequence combined with the streptavidin;

the preparation steps of the detection line (6) and the quality control line (7) on the nitrocellulose membrane (3) are as follows:

scribing a B aptamer combined with streptavidin with the concentration of 1OD/30 muL-5 OD/30 muL at 1/3 on one side, close to a binding pad (2), of a nitrocellulose membrane (3) to obtain a detection line (6) coated with the B aptamer combined with streptavidin, scribing a complementary nucleotide sequence combined with streptavidin with the concentration of 0.025OD/30 muL-1 OD/30 muL at 1/3 on one side, close to a water absorption pad (4), of the nitrocellulose membrane (3) to obtain a quality control line (7) coated with the complementary nucleotide sequence combined with streptavidin; during scribing, the flow velocity of the detection line (6) and the quality control line (7) is 1 mu L/cm; after scribing, placing at room temperature for more than 2h for drying and fixing to obtain a nitrocellulose membrane (3) marked with a detection line (6) and a quality control line (7);

the preparation method of the test paper comprises the following steps:

pre-treating the sample pad (1): soaking the sample pad (1) in 50mL of phosphate buffer solution added with 0.5g of bovine serum albumin and 50 mu L of Tween-20 for 30min, then washing with the phosphate buffer solution, and drying to obtain a pretreated sample pad (1);

sequentially overlapping and adhering a pretreated sample pad (1), a binding pad (2) coated with a colloidal gold-labeled aptamer A, a nitrocellulose membrane (3) labeled with a detection line (6) and a quality control line (7) and a water absorption pad (4) to a bottom plate (5), wherein the nitrocellulose membrane (3) labeled with the detection line (6) and the quality control line (7) is fixed on the bottom plate (5), one end of the nitrocellulose membrane is pressed by the water absorption pad (4), the other end of the nitrocellulose membrane is pressed by the binding pad (2), and the binding pad (2) is pressed by the sample pad (1) to obtain the detection test paper.