CN115838728B - In vitro screening method for novel coronavirus full-length nucleocapsid protein DNA aptamer - Google Patents

Abstract

The invention provides an in vitro screening method of a novel coronavirus full-length nucleocapsid protein DNA aptamer, belonging to the technical field of biology. The invention screens out the nucleic acid aptamer which can specifically bind to the novel coronavirus nucleocapsid protein and has high affinity through the SELEX technology, has the characteristics of small molecular weight, better stability, easy modification, no immunogenicity, short preparation period and the like, and can be used for biochemical analysis, environmental monitoring, basic chemistry, new drug synthesis and the like.

Description

In vitro screening method for novel coronavirus full-length nucleocapsid protein DNA aptamer

Technical Field

The invention relates to the field of biotechnology, in particular to in vitro screening of a novel coronavirus full-length nucleocapsid protein DNA aptamer.

Background

Aptamer refers to DNA or RNA molecules obtained by screening and separating by an exponential enrichment ligand system evolution technology (SELEX), and can be combined with a plurality of targets such as proteins, metal ions, small molecules, polypeptides and even whole cells with high affinity and specificity, so that the aptamer has wide prospect in biochemical analysis, environmental monitoring, basic chemistry, new drug synthesis and the like.

After renaturation, the aptamer can be folded to form various secondary structures, such as a stem-loop structure, a hairpin structure and the like, which are complementary with part of the space structure of the target, and then is specifically combined with the target under the action of hydrophobic action, hydrogen bond, electrostatic action, van der Waals force and other intermolecular forces. Nucleic acid aptamers have many commonalities with antibodies, such as being capable of specifically recognizing and binding to a certain protein, having good affinity and higher specificity to its target, but nucleic acid aptamers are more advantageous than antibodies in many aspects, mainly represented by the following points:

(1) The aptamer is easier to synthesize and chemically modify, can be synthesized manually and chemically by a solid-phase synthesis method, has small batch-to-batch difference and low synthesis cost, can modify certain chemical groups during synthesis, enhances the stability of the aptamer, and can facilitate subsequent drug coupling and the like. In contrast, the synthesis of antibodies requires preparation of antigen, selection of immunized animals, cell fusion and expansion of culture, and the like, and a series of purification steps are required in the following, and the whole procedure is very complicated and time-consuming, and there are some differences between different batches of synthesized antibodies.

(2) The stability of the aptamer is better, the aptamer can be stored only in a refrigerator at the temperature of-20 ℃, and the storage time is long. The preservation condition of the antibody is severe, and the activity of the antibody is reduced after a few months, which affects the use of the antibody.

(3) Nucleic acid aptamers are less immunogenic than antibodies.

(4) The target range of aptamer is wider, various small molecules, metal ions, polypeptides or proteins, nucleic acids, cells and the like can be used as the screening targets, and the targets of antibodies are mostly proteins.

The basic principle of the ligand systematic evolution (SELEX) technology for in vitro exponential enrichment is that a random single-stranded oligonucleotide library constructed in advance is utilized to screen and separate a nucleic acid sequence capable of specifically binding to a target molecule from the interaction between the oligonucleotide library and the target molecule, and then a Polymerase Chain Reaction (PCR) in vitro amplification technology is utilized to enable the specific sequence in the library to obtain exponential enrichment.

Disclosure of Invention

The invention aims to provide a method for efficiently screening a nucleic acid aptamer and the nucleic acid aptamer screened by the method, wherein the nucleic acid aptamer screened by the method has strong affinity.

In order to achieve the aim of the invention, the following technical scheme is adopted.

A composition for screening for a nucleic acid aptamer comprising a solid support and a target molecule or a portion of a target molecule bound to the solid support, the target molecule being a novel coronavirus nucleocapsid protein and/or DNA; the solid support comprises magnetic beads and/or agarose gel beads. Both magnetic beads and agarose gel beads can be used to directly, efficiently and rapidly attach target molecules.

Preferably, the magnetic beads comprise carboxyl modifications and/or histone modifications; agarose gel beads contain streptavidin modifications.

More preferably, the method of preparing the above composition comprises the steps of:

taking carboxyl magnetic beads, activating surface carboxyl groups, and then adding novel coronavirus nucleocapsid protein for incubation; after incubation, the unreacted sites on the surface of the magnetic beads are blocked, and the composition is obtained after washing.

More preferably, the method of preparing the above composition comprises the steps of:

taking agarose gel beads, adding novel coronavirus nucleocapsid protein for incubation, and washing after incubation to obtain the composition.

Still more preferably, the activation of the carboxyl group is performed using N-hydroxysuccinimide (NHS) and 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC).

The invention also discloses a reaction system for screening the aptamer, which comprises:

a single-stranded DNA library comprising at least one nucleotide chain capable of specifically recognizing the target molecule or a portion of the target molecule;

the primer is used for amplifying a nucleic acid aptamer library, and the sequences of the primer are shown in SEQ ID NO.6 and SEQ ID NO. 7:

SEQ ID NO.6：CTTCTGCACGCCTCCTTCC；

SEQ ID NO.7：AGTGTCCGCCGATCTCGTCTCC；

the above composition for screening a nucleic acid aptamer;

and (3) a buffer solution.

Preferably, the buffer comprises a DPBS buffer.

Preferably, the single stranded DNA library is as shown in SEQ ID NO. 8:

SEQ ID NO.8：CTTCTGCACGCCTCCTTCC（N35）GGAGACGAGATCGGCGGACACT。

the invention also discloses a method for screening the aptamer, which comprises the following steps:

synthesizing a primer and a single-stranded DNA library;

screening by a magnetic bead method; comprising preparing the reaction system, positive and negative sieves and PCR amplification according to claim 3 or 4.

Preferably, a reaction system for screening for a nucleic acid aptamer is formulated, comprising the steps of:

synthesizing a single-stranded DNA library and primers;

compositions for screening nucleic acid aptamers are prepared.

Preferably, the positive screening comprises positive screening using magnetic beads with novel coronavirus nucleocapsid proteins; the counter-screening includes counter-screening using His magnetic beads.

Preferably, the number of screening rounds of the magnetic bead method is at least 9.

Preferably, the affinity Kd of the aptamer screened by the method can reach below 5 nM.

The aptamer screened by the invention has high specificity, small molecular weight, stable chemical property and easy preservation and marking.

The invention also discloses a compound, which is characterized by comprising the following components:

compositions for screening nucleic acid aptamers, and

the aptamer screened by the method.

Preferably, the nucleic acid aptamer comprises:

N2-62：

CGCCTCCTTCCACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.1）；

N10：

CGCCTCCTTCCTCTCGGGGTGTGTAGGGTCAGGGAGTGTGAGAGGAGGAGACGAGATCGGCG（SEQ ID NO.2）；

N35：

CACGTCGGGGGGGTCACACATGAACCGTGCGGATACGGAGACGAG（SEQ ID NO.3）；

N1-53：

CCGCCACGATCGGATTCGTCTCGGCTCTATCGGATTGGAGACGAGATCGGCGG

（SEQ ID NO.4）;

N2-56:

CGCCTACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.5）。

preferably, the nucleic acid aptamer further comprises: the aptamer also comprises a aptamer obtained by modifying the aptamer with a sequence shown as SEQ ID NO. 1-5.

More preferably, the modification comprises:

(1) Phosphorylation;

(2) Methylation;

(3) Amination;

(4) Sulfhydrylation;

(5) Isotopic;

(6) Replacement of oxygen with sulfur;

(7) Replacing oxygen with selenium;

(8) Coupling biotin;

(9) Coupling a chemiluminescent group;

(10) Coupling a chemical fluorophore;

(11) Coupling the polypeptide;

(12) Coupling a ligand;

(13) Coupling siRNA;

(14) Coupling a therapeutic group;

(15) And coupling latex microspheres.

The invention also discloses a reagent for detecting novel coronaviruses in the environment, which comprises:

FAM fluorescent dye, and the aptamer screened by the method.

Preferably, the nucleic acid aptamer comprises:

N2-62：

CGCCTCCTTCCACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.1）；

N10：

CGCCTCCTTCCTCTCGGGGTGTGTAGGGTCAGGGAGTGTGAGAGGAGGAGACGAGATCGGCG（SEQ ID NO.2）；

N35：

CACGTCGGGGGGGTCACACATGAACCGTGCGGATACGGAGACGAG（SEQ ID NO.3）；

N1-53：

CCGCCACGATCGGATTCGTCTCGGCTCTATCGGATTGGAGACGAGATCGGCGG

（SEQ ID NO.4）;

N2-56:

CGCCTACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.5）。

preferably, the present invention also discloses a method for detecting a novel coronavirus in an environment, comprising:

sampling a region to be detected in the environment;

mixing and incubating the sample with the reagent for detecting the novel coronavirus in the environment;

after incubation of the mixture, the fluorescence intensity in the mixture was measured, and the result was determined.

The invention also discloses a method for detecting SARS-CoV and/or SARS-CoV-2 in the environment, comprising the following steps:

sampling a region to be detected in the environment;

mixing the sample with the aptamer screened by the method to obtain a mixture;

detecting whether the SARS-CoV-aptamer complex or the SARS-CoV-aptamer complex is contained in the mixture.

Preferably, the nucleic acid aptamer comprises:

N2-62：

CGCCTCCTTCCACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.1）；

N10：

CGCCTCCTTCCTCTCGGGGTGTGTAGGGTCAGGGAGTGTGAGAGGAGGAGACGAGATCGGCG（SEQ ID NO.2）；

N35：

CACGTCGGGGGGGTCACACATGAACCGTGCGGATACGGAGACGAG（SEQ ID NO.3）；

N1-53：

CCGCCACGATCGGATTCGTCTCGGCTCTATCGGATTGGAGACGAGATCGGCGG

（SEQ ID NO.4）;

N2-56:

CGCCTACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.5）。

preferably, the method for detecting SARS-CoV and/or SARS-CoV-2 in an environment further comprises detecting whether the mixture contains SARS-CoV-aptamer complex and/or SARS-CoV-2-aptamer complex using a test strip.

More preferably, the test strip comprises:

nitrocellulose membrane, binding pad, sample pad and absorbent paper; the nitrocellulose membrane comprises a detection line and a quality control line, wherein an antibody used by the detection line comprises a SARS-CoV antibody, and an antibody used by the quality control line comprises an anti-streptavidin antibody; the binding pad contains the aptamer screened by the method.

The invention also discloses the application of the aptamer N2-62, N10, N35, N1-53, N2-56 in detecting novel coronaviruses and/or SARS-CoV in the environment.

The invention also discloses the application of the aptamer screened by the method, which comprises at least one of the following steps:

specifically recognizing SARS-CoV-2;

specifically binds SARS-CoV-2;

preparing a reagent for detecting or identifying SARS-CoV-2;

loading a medicament for treating the novel coronavirus pneumonia;

targeted delivery of drugs for the treatment of novel coronavirus pneumonia;

a developer or tracer that binds to the novel coronavirus.

Compared with the prior art, the invention has the beneficial effects that:

the invention uses the SELEX technology to screen out the aptamer capable of specifically combining the novel coronavirus nucleocapsid protein, and has high affinity and Kd of less than 5 nM. In addition, the single-stranded DNA library designed by the invention can improve the screening efficiency, and only 9 rounds of screening are needed to obtain the high-affinity aptamer. The aptamer has the characteristics of small molecular weight, better stability, easy modification, no immunogenicity, short preparation period and the like, and can be used for biochemical analysis, environmental monitoring, basic science, new drug synthesis and the like.

Drawings

FIG. 1 is a schematic illustration of the binding of an enrichment library to a target protein and a control protein;

FIG. 2 is data of nucleic acid aptamer N2-62 affinity detection;

FIG. 3 is nucleic acid aptamer N10 affinity assay data;

FIG. 4 is nucleic acid aptamer N35 affinity assay data;

FIG. 5 is a graph showing aptamer affinity for N1-53 and force detection data;

FIG. 6 is data for aptamer affinity N2-56 and force detection.

Detailed Description

Reference will now be made in detail to the exemplary embodiments, the implementations described in the following exemplary embodiments not being representative of all implementations consistent with the present disclosure. Rather, they are merely examples of methods consistent with some aspects of the present disclosure.

The experimental methods in the following examples, unless otherwise specified, are conventional methods or according to the conditions recommended by the manufacturer. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Example 1

Screening of nucleic acid aptamers

1. Random single stranded DNA libraries and primers shown in the following sequences were synthesized:

random single-stranded DNA library:

SEQ ID NO.8：

5’-CTTCTGCACGCCTCCTTCC（N35）GGAGACGAGATCGGCGGACACT-3’；

wherein "N35" represents a sequence of 35 arbitrary nucleotide bases joined together. The library was synthesized by the division of biological engineering (Shanghai).

The primer information is shown as SEQ ID NO.6 and SEQ ID NO.7, and is synthesized by Jin Weizhi Biotechnology Co.

SEQ ID NO.6：CTTCTGCACGCCTCCTTCC；

SEQ ID NO.7：AGTGTCCGCCGATCTCGTCTCC；

The primers were ddH ₂ O was dissolved to prepare a 50. Mu.M stock solution, which was stored at-40℃until use.

2. Magnetic bead method screening

The magnetic bead method is adopted for screening, the total screening is 9 rounds, and the specific screening method is as follows:

1. carboxyl magnetic bead immobilized novel coronavirus nucleocapsid protein

200 mu L of carboxyl magnetic beads are taken, washed with 200 mu L of ultrapure water for 4 times, and the magnetic beads are fished by a magnet, and the supernatant is removed. Respectively taking 100 mu L of prepared NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution), mixing in equal volume, adding into magnetic beads, incubating at room temperature for 20min to activate carboxyl groups on the surfaces of the magnetic beads, and then washing with a DPBS buffer solution for 1 time for later use;

taking 80. Mu.L of novel coronavirus nucleocapsid protein (purchased from Yiqiao Shenzhou, 40588-V08B, concentration of 0.5 mg/mL), adding 10mM of pH4.5, 260. Mu.LNaC-HAc buffer solution, mixing well, and adding into the activated magnetic beads; placing the mixture on a vertical mixer for incubation for 2 hours at room temperature, and coupling the novel coronavirus nucleocapsid protein to the surface of the magnetic bead through the amino group on the surface of the protein;

after the coupling, the coupling tube was placed on a magnetic rack, the supernatant was removed, the solution was washed 1 time with DPBS buffer, 200. Mu.L of 1M ethanolamine pH8.5 was added to the beads, and incubated on a vertical mixer at room temperature for 15min, and unreacted activation sites on the surface of the beads were blocked. Then, the mixture was placed on a magnetic rack, the blocking solution was aspirated, washed 3 times with 200. Mu.L of DPBS buffer, and finally dissolved in 200. Mu.L of DPBS buffer.

2. Reverse screening and screening

Preparation of reverse sieve magnetic beads:

the His small peptide is coupled with magnetic beads, the His small peptide is synthesized by Hangzhou Dangang biotechnology limited company and is 9 continuous histidines, and the step of coupling the His small peptide is the same as the step of coupling the novel coronavirus nucleocapsid protein. The concentration of His small peptide is 20mg/mL, diluted with 10mM NaAC-HAc buffer solution with pH of 4.5, specifically, 4 mu L of His small peptide is taken, 396 mu L of 10mM NaAC-HAc buffer solution with pH of 4.5 is added, the mixture is uniformly mixed, 500 mu L of ethanolamine is added for blocking, and finally, the mixture is dissolved in 500 mu L of DPBS, and the rest steps are the same.

Library solubilization and variational treatment: taking a 1OD random single-stranded nucleotide library, centrifuging at 13000 rpm for 2min, adding PBS buffer for dissolution, putting into a metal bath at 95 ℃ for denaturation for 10 min, then putting into ice for cooling for 5min, and standing at room temperature for 15min to form a stable conformation.

Incubation of library with magnetic beads:

taking a certain amount of His magnetic beads, washing the His magnetic beads with PBS buffer solution, adding the treated library into the His magnetic beads, adding a certain amount of herring sperm DNA, BSA and sodium chloride solution, uniformly mixing, and then incubating for a period of time on a vertical mixer at room temperature; placing the mixture on a magnetic frame, collecting supernatant, and carrying out positive screening on the supernatant and novel coronavirus nucleocapsid protein magnetic beads; the first round only has positive screening, from the second round, his magnetic beads are used for carrying out reverse screening before the positive screening taking the novel coronavirus nucleocapsid protein as a target is carried out, and 2 mu L of His protein of 20mg/mL and the novel coronavirus nucleocapsid protein magnetic beads are added into the supernatant of the reverse screening as a single-stranded nucleotide library for carrying out the positive screening; the magnetic beads after the positive screen and the reverse screen are added with 100 mu L ddH ₂ O, a metal bath at 95 ℃ for 10 min, and cooling on ice for a period of time, and then magnetically sucking the supernatant as an solution; to further increase the screening pressure, virus lysate and human serum were added starting from the fifth round.

qPCR monitors the progress of the reaction:

using nucleic acid molecules in the cells as templates, and performing amplification by qPCR; the method comprises the following steps: 2. Mu.L of the positive and negative screen solutions were added to 18. Mu.L of qPCR mix, respectively, and qPCR amplified for 30 cycles, and the data were analyzed.

3. PCR amplification in large quantities

The amplification cycle number is determined according to qPCR data, and the rest positive screening is added into PCR mix to amplify the corresponding cycle number.

4. Preparation of single strands

Because the double-stranded DNA obtained after PCR amplification has one strand modified with biotin, the agarose gel beads with streptavidin marks are used for capturing the double-stranded DNA through the action of the streptavidin and the biotin in the experiment, and then the target single-stranded DNA is dissociated through the denaturation of NaOH, and the specific experimental steps are as follows:

1) Incubation with agarose gel beads: 200. Mu.L of the gun head with the filter element was placed in an EP tube of 1.5 mL, 60. Mu.L of streptavidin-coated agarose gel beads were added, the mixture was washed twice with DPBS, 100. Mu.L each time, the double-stranded DNA product obtained by PCR3 amplification was added to the gun head with agarose gel beads after washing, 100. Mu.L each time, a 200. Mu.L gun was used to hit the liquid into a waste liquid cup, and the mixture was washed twice with DPBS.

2) 100. Mu.L of 40 mM NaOH solution was added and collected in a new EP tube, neutralized by adding 4. Mu.L of 1M HCl solution, and then by adding 104. Mu.L of 2 XPBS solution to obtain the library for the next round of screening.

3) Concentration measurement: the final yield was obtained by measuring the a260 value by NanoDrop times the OD value, the ssDNA concentration, and the volume.

3. Repeated screening

The magnetic bead method is used for repeatedly screening for 9 rounds, the secondary library obtained in the previous operation is used as an initial nucleic acid library in each operation, after the library is subjected to renaturation treatment, herring sperm DNA and BSA with corresponding volumes are added, the concentration of sodium chloride is regulated, and then the herring sperm DNA and BSA are incubated with magnetic beads coupled with proteins; after screening, SPR is used for detecting the change of the recognition capability of the DNA single-chain library to SARS-CoV-2 nucleocapsid protein, when the recognition capability of the DNA single-chain library to SARS-CoV-2 nucleocapsid protein meets the requirement, namely, the binding capability of the screened DNA single-chain library to target protein is higher than that of the library (figure 1) which is input by the screening start, wherein pool1, pool3, pool5, pool7 and pool9 respectively represent libraries obtained by screening of round 1, round 3, round 5, round 7 and round 9, the obtained library of round 9 can be seen to have much higher affinity than that of the library obtained by screening of round 1 to target, the requirement of sequencing is met, and the obtained library is subjected to high-throughput sequencing analysis.

4. Analysis and identification

After high-throughput sequencing analysis is carried out on the obtained enriched library product, a plurality of sequences are selected to be synthesized by general biology, and the affinity is detected;

in the subsequent detection, 4-6 sequences are determined to have strong binding capacity, and 3 sequences are truncated to obtain the nucleic acid aptamers shown in SEQ ID NO.1-5 respectively, which are named as N2-62, N10, N35, N1-53 and N2-56 respectively. Affinity characterizations are shown in figures 2-6.

Example 2

Preparation of test paper for detecting SARS-CoV

1. Aptamer coupled latex particles

Diluting Streptavidin (SA) -modified latex particles (mass fraction 1%, provided by Hangzhou Yoghurt) with ultrapure water to a mass fraction of 0.5%; then adding 4 times excess biotin modified aptamer into SA modified latex particles with the mass fraction of 0.5% for crosslinking, wherein the crosslinking condition is that the mixture is vibrated at room temperature for 1 h;

removing the aptamer sequence which is not bound to the surface of the latex particles in the supernatant by a centrifugal method, wherein the centrifugal condition is 4 ℃,10000 rpm and 10 min; then washing the crosslinked product twice by using ultrapure water through a centrifugal method, and finally, fixing the volume by using 50 mu L of dispensing liquid for standby;

according to the above-described procedure, a latex particle-nucleic acid aptamer conjugate was prepared, and when a plurality of nucleic acid aptamers were used with the latex particles to prepare a latex particle-nucleic acid aptamer conjugate, there were the following labeling methods:

1) Mixing and marking, namely marking different aptamer sequences on the same latex particle surface;

2) Single marking, namely marking the same nucleic acid aptamer sequence on the same latex particle surface, and then mixing different latex microspheres for use;

different latex particle-aptamer conjugates were prepared according to different labeling methods and different aptamers, and the conjugates are shown in table 1.

2. Pretreatment of

The following treatment fluid is prepared according to the formula:

sample pad treatment liquid: 1M Tris-HCl buffer, 1% PVP,1% PEG,5% BSA, pH 9.0;

bonding pad treatment liquid: 0.2 M Tris-HCl buffer, 5% BSA,1% PVP,2% PEG,20% sucrose, pH 8.0;

dialysate: 0.008 mol/L NaCl, pH 7.0;

pretreatment is carried out after preparation:

sample pad treatment: soaking glass fiber in sample pad treatment liquid, standing for 30 min, taking out, draining, and naturally drying for later use;

and (3) bond pad treatment: soaking glass fiber in the bonding pad treatment liquid, standing for 30 min, taking out, draining off water, and naturally drying for later use;

antibody dialysis: diluting the antibody, filling the diluted antibody into a dialysis bag, and sequentially putting the dialysis solution and the triple distilled water into dialysis 12 h;

3. spray-coated latex particles

Spraying the latex particle-aptamer conjugate on the pretreated bonding pad through a film drawing machine, wherein the mass fraction of the latex particle-aptamer conjugate is 0.5%, and the spraying amount is 6 mu L/cm;

4. scribing film

The film was drawn using a film drawing machine, and antibodies used for the detection line (T line) were: SARS-CoV nucleocapsid protein antibody at a concentration of 2 mg/mL;

the antibodies used for the quality control line (C line) were: anti-streptavidin antibody at a concentration of 1 mg/mL;

5. combination of two or more kinds of materials

And sequentially assembling the sample pad, the bonding pad, the nitrocellulose membrane and the absorbent paper on the PVC plate to obtain the test strip.

TABLE 1 latex particle-aptamer conjugates and test papers

Test paper serial number (with conjugate serial number)	Aptamer combinations	Marking method
			1	N35	Single mark
2	N10	Single mark
			3	N2-62	Single mark
4	N35/N2-62	Single mark
			5	N35/N10	Single mark
6	N2-62/N10	Single mark
			7	N35/N2-62/N10	Single mark
8	N35/N2-62	Hybrid marking
			9	N35/N10	Hybrid marking
10	N2-62/N10	Hybrid marking
			11	N35/N2-62/N10	Hybrid marking

Test example 1

Aptamer affinity detection

Surface Plasmon Resonance (SPR) was used to detect affinity and specificity of SARS-CoV-2 nucleocapsid protein aptamer to SARS-CoV-2 nucleocapsid protein.

1. The universal biosynthetic nucleic acid aptamers N2-62, N10, N35 were each diluted to 200 nM with DPBS buffer.

2. Channel 2 coupling SARS-CoV-2 nucleocapsid protein to CM5 chip surface: then mixing equal volumes of EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and feeding 50. Mu.L of the activated chip at a flow rate of 5. Mu.L/min; diluting SARS-CoV-2 nucleocapsid protein with 10mM sodium acetate with pH4.5 to a final concentration of 50 μg/mL, and introducing sample with a sample volume of 50 μl and a flow rate of 5 μl/min, wherein the coupling amount of SARS-CoV-2 nucleocapsid protein is 2000 Ru; after the sample injection is completed, the chip is sealed by ethanolamine, the flow speed is 5 mu L/min, and the sample injection is 50 mu L; channel 1 was treated as described above, except that the step of coupling the protein was not performed, and the step of activation and blocking was exactly the same as the control channel.

3. And (3) detection: kinetic detection parameters were set using a surface plasmon resonance (GE Healthcare, model: biacore T200), and 4 aptamer samples diluted in step 1 were sequentially passed through 1, 2, 3, and 4 channels, each aptamer being programmed as follows: and (3) injecting 30 mu L/min×2min, dissociating 30 mu L/min×3 min, regenerating 1M NaCl 30 mu L/min×0.5 min, and sequentially injecting diluted nucleic acid aptamers.

The affinity assay data are shown in FIGS. 2-6, each curve being a curve after channel 2 is subtracted by channel 1, illustrating the binding capacity of the corresponding aptamer to the target protein N protein. These data demonstrate that the nucleic acid aptamers N2-62, N10, N35 all detected strong binding to SARS-CoV-2 nucleocapsid protein using SPR, and KD values are shown in Table 1, respectively.

TABLE 1 affinity of SARS-CoV-2 nucleocapsid protein to aptamer

Name of the name	Affinity KD (nM)
		SEQ ID NO:1（N2-62）	3.24
SEQ ID NO:2（N10）	5.91
		SEQ ID NO:3（N35）	2.41
SEQ ID NO:4（N1-53）	4.01
		SEQ ID NO:5（N2-56）	5.96

As can be seen from Table 1, the aptamer screened by the invention has good affinity with the novel coronavirus nucleocapsid protein, which can reach below 5 nM and even lower than 3 nM, thus indicating that the aptamer can accurately and efficiently identify and bind the novel coronavirus.

Test example 2

Detection of SARS-CoV

The condition of the strip of the test strip is observed by dripping buffer solutions containing SARS-CoV with different concentrations:

preparing standard solutions with the concentration of 100 pg/mL, 1 ng/mL, 10 ng/mL and 100 ng/mL by using a DPBS buffer solution, sucking the standard solution by using a rubber head dropper, dripping 3 drops of the standard solution on a sample pad, standing for 15min after dripping, and judging the result:

positive (+): two bands appear, a detection line and a quality control line, which indicate that SARS-CoV or SARS-CoV exists in the sample;

negative (-). Only one strip appears on the quality control line, and no strip appears on the detection line, which indicates that the sample has no SARS-CoV or SARS-CoV;

invalidation: the quality control line does not appear as a red band, possibly due to incorrect operation or reagent failure, should be retested.

The test results are shown in Table 3. As can be seen from Table 3, the detection results were good, demonstrating that the nucleic acid aptamers screened according to the present invention were able to effectively detect SARS-CoV in the environment.

Test paper serial number	SARS-CoV（100ng/mL）	SARS-CoV（10ng/mL）	SARS-CoV（1ng/mL）	SARS-CoV（100pg/mL）	SARS-CoV（0）
						1	+	+	+	-	-
2	+	+	+	-	-
						3	+	+	+	-	-
4	+	+	+	-	-
						5	+	+	+	-	-
6	+	+	+	-	-
						7	+	+	+	-	-
8	+	+	+	-	-
						9	+	+	+	-	-
10	+	+	+	-	-
						11	+	+	+	-	-

Conventional operations in the operation steps of the present invention are well known to those skilled in the art, and are not described herein.

While the foregoing embodiments have been described in detail in connection with the embodiments of the invention, it should be understood that the foregoing embodiments are merely illustrative of the invention and are not intended to limit the invention, and any modifications, additions, substitutions and the like made within the principles of the invention are intended to be included within the scope of the invention.

Claims (7)

1. A nucleic acid aptamer, which is characterized in that the sequence is shown in SEQ ID NO. 4:

CCGCCACGATCGGATTCGTCTCGGCTCTATCGGATTGGAGACGAGATCGGCGG。

2. a modified aptamer, wherein the aptamer is the aptamer of claim 1 modified.

3. The aptamer of claim 2, wherein the modification comprises at least one of the following modification methods:

(1) Phosphorylation;

(2) Methylation;

(3) Amination;

(4) Sulfhydrylation;

(5) Isotopic;

(6) Replacement of oxygen with sulfur;

(7) Replacing oxygen with selenium;

(8) Coupling biotin;

(9) Coupling a chemiluminescent group;

(10) Coupling a chemical fluorophore;

(11) Coupling the polypeptide;

(12) Coupling a ligand;

(13) Coupling siRNA;

(14) Coupling a therapeutic group;

(15) And coupling latex microspheres.

4. An agent for detecting a novel coronavirus in an environment, comprising:

a FAM fluorescent dye-labeled nucleic acid aptamer according to any one of claims 1-3.

5. A method for detecting a novel coronavirus in an environment, comprising:

sampling a region to be detected in the environment;

incubating the sample with the reagent of claim 4;

after incubation of the mixture, the fluorescence intensity in the mixture was measured, and the result was determined.

6. A method for detecting SARS-CoV-2 in an environment, comprising:

sampling a region to be detected in the environment;

mixing the sample with the aptamer of any one of claims 1-3 to obtain a mixture;

detecting whether the mixture contains SARS-CoV-2-aptamer complex.

7. Use of a nucleic acid aptamer as claimed in any one of claims 1 to 3 in the manufacture of a reagent for detecting or identifying SARS-CoV-2.